diff options
author | Indrajith K L | 2022-12-03 17:00:20 +0530 |
---|---|---|
committer | Indrajith K L | 2022-12-03 17:00:20 +0530 |
commit | f5c4671bfbad96bf346bd7e9a21fc4317b4959df (patch) | |
tree | 2764fc62da58f2ba8da7ed341643fc359873142f /coreutils-5.3.0-bin/contrib/gawk | |
download | cli-tools-windows-master.tar.gz cli-tools-windows-master.tar.bz2 cli-tools-windows-master.zip |
Diffstat (limited to 'coreutils-5.3.0-bin/contrib/gawk')
37 files changed, 36489 insertions, 0 deletions
diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-1-GnuWin32.README b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-1-GnuWin32.README new file mode 100644 index 0000000..1bab5b6 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-1-GnuWin32.README @@ -0,0 +1,49 @@ +* Gawk-3.1.6 for Windows * +========================== + +What is it? +----------- +Gawk: pattern scanning and processing language + +Description +----------- +Several kinds of tasks occur repeatedly when working with text files. You might want to extract certain lines and discard the rest. Or you may need to make changes wherever certain patterns appear, but leave the rest of the file alone. Writing single-use programs for these tasks in languages such as C, C++ or Pascal is time-consuming and inconvenient. Such jobs are often easier with awk. The awk utility interprets a special-purpose programming language that makes it easy to handle simple data-reformatting jobs. The GNU implementation of awk is called gawk; it is fully compatible with the System V Release 4 version of awk. gawk is also compatible with the POSIX specification of the awk language. This means that all properly written awk programs should work with gawk. Thus, we usually don’t distinguish between gawk and other awk implementations. Using awk allows you to: - Manage small, personal databases - Generate reports - Validate data - Produce indexes and perform other document preparation tasks - Experiment with algorithms that you can adapt later to other computer languages. In addition, gawk provides facilities that make it easy to: - Extract bits and pieces of data for processing - Sort data - Perform simple network communications. The Win32 port has some limitations, In particular the ‘|&’ operator and TCP/IP networking are not supported. + +Homepage +-------- +http://www.gnu.org/software/gawk/gawk.html +Sources: http://ftp.gnu.org/gnu/gawk/gawk-3.1.6.tar.gz + +System +------ +- Win32, i.e. MS-Windows 95 / 98 / ME / NT / 2000 / XP / 2003 / Vista with msvcrt.dll +- if msvcrt.dll is not in your Windows/System folder, get it from + Microsoft <http://support.microsoft.com/default.aspx?scid=kb;en-us;259403"> + or by installing Internet Explorer 4.0 or higher + <http://www.microsoft.com/windows/ie> + +Notes +----- +- Bugs and questions on this MS-Windows port: gnuwin32@users.sourceforge.net + +Package Availability +-------------------- +- in: http://gnuwin32.sourceforge.net +Installation +------------ + +Sources +------- +- gawk-3.1.6-1-src.zip + +Compilation +----------- +The package has been compiled with GNU auto-tools, GNU make, and Mingw +(GCC for MS-Windows). Any differences from the original sources are given +in gawk-3.1.6-1-GnuWin32.diffs in gawk-3.1.6-1-src.zip. Libraries needed +for compilation can be found at the lines starting with 'LIBS = ' in the +Makefiles. Usually, these are standard libraries provided with Mingw, or +libraries from the package itself; 'gw32c' refers to the libgw32c package, +which provides MS-Windows substitutes or stubs for functions normally found in +Unix. For more information, see: http://gnuwin32.sourceforge.net/compile.html +and http://gnuwin32.sourceforge.net/packages/libgw32c.htm. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/ABOUT-NLS b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/ABOUT-NLS new file mode 100644 index 0000000..ec20977 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/ABOUT-NLS @@ -0,0 +1,1101 @@ +1 Notes on the Free Translation Project +*************************************** + +Free software is going international! The Free Translation Project is +a way to get maintainers of free software, translators, and users all +together, so that free software will gradually become able to speak many +languages. A few packages already provide translations for their +messages. + + If you found this `ABOUT-NLS' file inside a distribution, you may +assume that the distributed package does use GNU `gettext' internally, +itself available at your nearest GNU archive site. But you do _not_ +need to install GNU `gettext' prior to configuring, installing or using +this package with messages translated. + + Installers will find here some useful hints. These notes also +explain how users should proceed for getting the programs to use the +available translations. They tell how people wanting to contribute and +work on translations can contact the appropriate team. + + When reporting bugs in the `intl/' directory or bugs which may be +related to internationalization, you should tell about the version of +`gettext' which is used. The information can be found in the +`intl/VERSION' file, in internationalized packages. + +1.1 Quick configuration advice +============================== + +If you want to exploit the full power of internationalization, you +should configure it using + + ./configure --with-included-gettext + +to force usage of internationalizing routines provided within this +package, despite the existence of internationalizing capabilities in the +operating system where this package is being installed. So far, only +the `gettext' implementation in the GNU C library version 2 provides as +many features (such as locale alias, message inheritance, automatic +charset conversion or plural form handling) as the implementation here. +It is also not possible to offer this additional functionality on top +of a `catgets' implementation. Future versions of GNU `gettext' will +very likely convey even more functionality. So it might be a good idea +to change to GNU `gettext' as soon as possible. + + So you need _not_ provide this option if you are using GNU libc 2 or +you have installed a recent copy of the GNU gettext package with the +included `libintl'. + +1.2 INSTALL Matters +=================== + +Some packages are "localizable" when properly installed; the programs +they contain can be made to speak your own native language. Most such +packages use GNU `gettext'. Other packages have their own ways to +internationalization, predating GNU `gettext'. + + By default, this package will be installed to allow translation of +messages. It will automatically detect whether the system already +provides the GNU `gettext' functions. If not, the included GNU +`gettext' library will be used. This library is wholly contained +within this package, usually in the `intl/' subdirectory, so prior +installation of the GNU `gettext' package is _not_ required. +Installers may use special options at configuration time for changing +the default behaviour. The commands: + + ./configure --with-included-gettext + ./configure --disable-nls + +will, respectively, bypass any pre-existing `gettext' to use the +internationalizing routines provided within this package, or else, +_totally_ disable translation of messages. + + When you already have GNU `gettext' installed on your system and run +configure without an option for your new package, `configure' will +probably detect the previously built and installed `libintl.a' file and +will decide to use this. This might not be desirable. You should use +the more recent version of the GNU `gettext' library. I.e. if the file +`intl/VERSION' shows that the library which comes with this package is +more recent, you should use + + ./configure --with-included-gettext + +to prevent auto-detection. + + The configuration process will not test for the `catgets' function +and therefore it will not be used. The reason is that even an +emulation of `gettext' on top of `catgets' could not provide all the +extensions of the GNU `gettext' library. + + Internationalized packages usually have many `po/LL.po' files, where +LL gives an ISO 639 two-letter code identifying the language. Unless +translations have been forbidden at `configure' time by using the +`--disable-nls' switch, all available translations are installed +together with the package. However, the environment variable `LINGUAS' +may be set, prior to configuration, to limit the installed set. +`LINGUAS' should then contain a space separated list of two-letter +codes, stating which languages are allowed. + +1.3 Using This Package +====================== + +As a user, if your language has been installed for this package, you +only have to set the `LANG' environment variable to the appropriate +`LL_CC' combination. Here `LL' is an ISO 639 two-letter language code, +and `CC' is an ISO 3166 two-letter country code. For example, let's +suppose that you speak German and live in Germany. At the shell +prompt, merely execute `setenv LANG de_DE' (in `csh'), +`export LANG; LANG=de_DE' (in `sh') or `export LANG=de_DE' (in `bash'). +This can be done from your `.login' or `.profile' file, once and for +all. + + You might think that the country code specification is redundant. +But in fact, some languages have dialects in different countries. For +example, `de_AT' is used for Austria, and `pt_BR' for Brazil. The +country code serves to distinguish the dialects. + + The locale naming convention of `LL_CC', with `LL' denoting the +language and `CC' denoting the country, is the one use on systems based +on GNU libc. On other systems, some variations of this scheme are +used, such as `LL' or `LL_CC.ENCODING'. You can get the list of +locales supported by your system for your language by running the +command `locale -a | grep '^LL''. + + Not all programs have translations for all languages. By default, an +English message is shown in place of a nonexistent translation. If you +understand other languages, you can set up a priority list of languages. +This is done through a different environment variable, called +`LANGUAGE'. GNU `gettext' gives preference to `LANGUAGE' over `LANG' +for the purpose of message handling, but you still need to have `LANG' +set to the primary language; this is required by other parts of the +system libraries. For example, some Swedish users who would rather +read translations in German than English for when Swedish is not +available, set `LANGUAGE' to `sv:de' while leaving `LANG' to `sv_SE'. + + Special advice for Norwegian users: The language code for Norwegian +bokma*l changed from `no' to `nb' recently (in 2003). During the +transition period, while some message catalogs for this language are +installed under `nb' and some older ones under `no', it's recommended +for Norwegian users to set `LANGUAGE' to `nb:no' so that both newer and +older translations are used. + + In the `LANGUAGE' environment variable, but not in the `LANG' +environment variable, `LL_CC' combinations can be abbreviated as `LL' +to denote the language's main dialect. For example, `de' is equivalent +to `de_DE' (German as spoken in Germany), and `pt' to `pt_PT' +(Portuguese as spoken in Portugal) in this context. + +1.4 Translating Teams +===================== + +For the Free Translation Project to be a success, we need interested +people who like their own language and write it well, and who are also +able to synergize with other translators speaking the same language. +Each translation team has its own mailing list. The up-to-date list of +teams can be found at the Free Translation Project's homepage, +`http://www.iro.umontreal.ca/contrib/po/HTML/', in the "National teams" +area. + + If you'd like to volunteer to _work_ at translating messages, you +should become a member of the translating team for your own language. +The subscribing address is _not_ the same as the list itself, it has +`-request' appended. For example, speakers of Swedish can send a +message to `sv-request@li.org', having this message body: + + subscribe + + Keep in mind that team members are expected to participate +_actively_ in translations, or at solving translational difficulties, +rather than merely lurking around. If your team does not exist yet and +you want to start one, or if you are unsure about what to do or how to +get started, please write to `translation@iro.umontreal.ca' to reach the +coordinator for all translator teams. + + The English team is special. It works at improving and uniformizing +the terminology in use. Proven linguistic skills are praised more than +programming skills, here. + +1.5 Available Packages +====================== + +Languages are not equally supported in all packages. The following +matrix shows the current state of internationalization, as of October +2006. The matrix shows, in regard of each package, for which languages +PO files have been submitted to translation coordination, with a +translation percentage of at least 50%. + + Ready PO files af am ar az be bg bs ca cs cy da de el en en_GB eo + +----------------------------------------------------+ + GNUnet | [] | + a2ps | [] [] [] [] [] | + aegis | () | + ant-phone | () | + anubis | [] | + ap-utils | | + aspell | [] [] [] [] [] | + bash | [] [] [] | + batchelor | [] | + bfd | | + bibshelf | [] | + binutils | [] | + bison | [] [] | + bison-runtime | | + bluez-pin | [] [] [] [] [] | + cflow | [] | + clisp | [] [] | + console-tools | [] [] | + coreutils | [] [] [] | + cpio | | + cpplib | [] [] [] | + cryptonit | [] | + darkstat | [] () [] | + dialog | [] [] [] [] [] [] | + diffutils | [] [] [] [] [] [] | + doodle | [] | + e2fsprogs | [] [] | + enscript | [] [] [] [] | + error | [] [] [] [] | + fetchmail | [] [] () [] | + fileutils | [] [] | + findutils | [] [] [] | + flex | [] [] [] | + fslint | [] | + gas | | + gawk | [] [] [] | + gbiff | [] | + gcal | [] | + gcc | [] | + gettext-examples | [] [] [] [] [] | + gettext-runtime | [] [] [] [] [] | + gettext-tools | [] [] | + gimp-print | [] [] [] [] | + gip | [] | + gliv | [] | + glunarclock | [] | + gmult | [] [] | + gnubiff | () | + gnucash | () () [] | + gnucash-glossary | [] () | + gnuedu | | + gnulib | [] [] [] [] [] [] | + gnunet-gtk | | + gnutls | | + gpe-aerial | [] [] | + gpe-beam | [] [] | + gpe-calendar | | + gpe-clock | [] [] | + gpe-conf | [] [] | + gpe-contacts | | + gpe-edit | [] | + gpe-filemanager | | + gpe-go | [] | + gpe-login | [] [] | + gpe-ownerinfo | [] [] | + gpe-package | | + gpe-sketchbook | [] [] | + gpe-su | [] [] | + gpe-taskmanager | [] [] | + gpe-timesheet | [] | + gpe-today | [] [] | + gpe-todo | | + gphoto2 | [] [] [] [] | + gprof | [] [] | + gpsdrive | () () | + gramadoir | [] [] | + grep | [] [] [] [] [] [] | + gretl | | + gsasl | | + gss | | + gst-plugins | [] [] [] [] | + gst-plugins-base | [] [] [] | + gst-plugins-good | [] [] [] [] [] [] [] | + gstreamer | [] [] [] [] [] [] [] | + gtick | () | + gtkam | [] [] [] | + gtkorphan | [] [] | + gtkspell | [] [] [] [] | + gutenprint | [] | + hello | [] [] [] [] [] | + id-utils | [] [] | + impost | | + indent | [] [] [] | + iso_3166 | [] [] | + iso_3166_2 | | + iso_4217 | [] | + iso_639 | [] [] | + jpilot | [] | + jtag | | + jwhois | | + kbd | [] [] [] [] | + keytouch | | + keytouch-editor | | + keytouch-keyboa... | | + latrine | () | + ld | [] | + leafpad | [] [] [] [] [] | + libc | [] [] [] [] [] | + libexif | [] | + libextractor | [] | + libgpewidget | [] [] [] | + libgpg-error | [] | + libgphoto2 | [] [] | + libgphoto2_port | [] [] | + libgsasl | | + libiconv | [] [] | + libidn | [] [] | + lifelines | [] () | + lilypond | [] | + lingoteach | | + lynx | [] [] [] [] | + m4 | [] [] [] [] | + mailutils | [] | + make | [] [] | + man-db | [] () [] [] | + minicom | [] [] [] | + mysecretdiary | [] [] | + nano | [] [] [] | + nano_1_0 | [] () [] [] | + opcodes | [] | + parted | | + pilot-qof | [] | + psmisc | [] | + pwdutils | | + python | | + qof | | + radius | [] | + recode | [] [] [] [] [] [] | + rpm | [] [] | + screem | | + scrollkeeper | [] [] [] [] [] [] [] [] | + sed | [] [] [] | + sh-utils | [] [] | + shared-mime-info | [] [] [] [] | + sharutils | [] [] [] [] [] [] | + shishi | | + silky | | + skencil | [] () | + sketch | [] () | + solfege | | + soundtracker | [] [] | + sp | [] | + stardict | [] | + system-tools-ba... | [] [] [] [] [] [] [] [] [] | + tar | [] | + texinfo | [] [] [] | + textutils | [] [] [] | + tin | () () | + tp-robot | [] | + tuxpaint | [] [] [] [] [] | + unicode-han-tra... | | + unicode-transla... | | + util-linux | [] [] [] [] | + vorbis-tools | [] [] [] [] | + wastesedge | () | + wdiff | [] [] [] [] | + wget | [] [] | + xchat | [] [] [] [] [] [] | + xkeyboard-config | | + xpad | [] [] | + +----------------------------------------------------+ + af am ar az be bg bs ca cs cy da de el en en_GB eo + 10 0 1 2 9 22 1 42 41 2 60 95 16 1 17 16 + + es et eu fa fi fr ga gl gu he hi hr hu id is it + +--------------------------------------------------+ + GNUnet | | + a2ps | [] [] [] () | + aegis | | + ant-phone | [] | + anubis | [] | + ap-utils | [] [] | + aspell | [] [] [] | + bash | [] [] [] | + batchelor | [] [] | + bfd | [] | + bibshelf | [] [] [] | + binutils | [] [] [] | + bison | [] [] [] [] [] [] | + bison-runtime | [] [] [] [] [] | + bluez-pin | [] [] [] [] [] | + cflow | [] | + clisp | [] [] | + console-tools | | + coreutils | [] [] [] [] [] [] | + cpio | [] [] [] | + cpplib | [] [] | + cryptonit | [] | + darkstat | [] () [] [] [] | + dialog | [] [] [] [] [] [] [] [] | + diffutils | [] [] [] [] [] [] [] [] [] | + doodle | [] [] | + e2fsprogs | [] [] [] | + enscript | [] [] [] | + error | [] [] [] [] [] | + fetchmail | [] | + fileutils | [] [] [] [] [] [] | + findutils | [] [] [] [] | + flex | [] [] [] | + fslint | [] | + gas | [] [] | + gawk | [] [] [] [] | + gbiff | [] | + gcal | [] [] | + gcc | [] | + gettext-examples | [] [] [] [] [] [] | + gettext-runtime | [] [] [] [] [] [] | + gettext-tools | [] [] [] | + gimp-print | [] [] | + gip | [] [] [] | + gliv | () | + glunarclock | [] [] [] | + gmult | [] [] [] | + gnubiff | () () | + gnucash | () () () | + gnucash-glossary | [] [] | + gnuedu | [] | + gnulib | [] [] [] [] [] [] [] [] | + gnunet-gtk | | + gnutls | | + gpe-aerial | [] [] | + gpe-beam | [] [] | + gpe-calendar | | + gpe-clock | [] [] [] [] | + gpe-conf | [] | + gpe-contacts | [] [] | + gpe-edit | [] [] [] [] | + gpe-filemanager | [] | + gpe-go | [] [] [] | + gpe-login | [] [] [] | + gpe-ownerinfo | [] [] [] [] [] | + gpe-package | [] | + gpe-sketchbook | [] [] | + gpe-su | [] [] [] [] | + gpe-taskmanager | [] [] [] | + gpe-timesheet | [] [] [] [] | + gpe-today | [] [] [] [] | + gpe-todo | [] | + gphoto2 | [] [] [] [] [] | + gprof | [] [] [] [] | + gpsdrive | () () [] () | + gramadoir | [] [] | + grep | [] [] [] [] [] [] [] [] [] [] [] [] | + gretl | [] [] [] | + gsasl | [] [] | + gss | [] | + gst-plugins | [] [] [] | + gst-plugins-base | [] [] | + gst-plugins-good | [] [] [] | + gstreamer | [] [] [] | + gtick | [] | + gtkam | [] [] [] [] | + gtkorphan | [] [] | + gtkspell | [] [] [] [] [] [] | + gutenprint | [] | + hello | [] [] [] [] [] [] [] [] [] [] [] [] [] | + id-utils | [] [] [] [] [] | + impost | [] [] | + indent | [] [] [] [] [] [] [] [] [] [] | + iso_3166 | [] [] [] | + iso_3166_2 | [] | + iso_4217 | [] [] [] [] | + iso_639 | [] [] [] [] [] | + jpilot | [] [] | + jtag | [] | + jwhois | [] [] [] [] [] | + kbd | [] [] | + keytouch | [] | + keytouch-editor | [] | + keytouch-keyboa... | [] | + latrine | [] [] [] | + ld | [] [] | + leafpad | [] [] [] [] [] [] | + libc | [] [] [] [] [] | + libexif | [] | + libextractor | [] | + libgpewidget | [] [] [] [] [] | + libgpg-error | | + libgphoto2 | [] [] [] | + libgphoto2_port | [] [] | + libgsasl | [] [] | + libiconv | [] [] | + libidn | [] [] | + lifelines | () | + lilypond | [] | + lingoteach | [] [] [] | + lynx | [] [] [] | + m4 | [] [] [] [] | + mailutils | [] [] | + make | [] [] [] [] [] [] [] [] | + man-db | () | + minicom | [] [] [] [] | + mysecretdiary | [] [] [] | + nano | [] [] [] [] [] [] | + nano_1_0 | [] [] [] [] [] | + opcodes | [] [] [] [] | + parted | [] [] [] [] | + pilot-qof | | + psmisc | [] [] [] | + pwdutils | | + python | | + qof | [] | + radius | [] [] | + recode | [] [] [] [] [] [] [] [] | + rpm | [] [] | + screem | | + scrollkeeper | [] [] [] | + sed | [] [] [] [] [] | + sh-utils | [] [] [] [] [] [] [] | + shared-mime-info | [] [] [] [] [] [] | + sharutils | [] [] [] [] [] [] [] [] | + shishi | | + silky | [] | + skencil | [] [] | + sketch | [] [] | + solfege | [] | + soundtracker | [] [] [] | + sp | [] | + stardict | [] | + system-tools-ba... | [] [] [] [] [] [] [] [] | + tar | [] [] [] [] [] [] [] | + texinfo | [] [] | + textutils | [] [] [] [] [] | + tin | [] () | + tp-robot | [] [] [] [] | + tuxpaint | [] [] | + unicode-han-tra... | | + unicode-transla... | [] [] | + util-linux | [] [] [] [] [] [] [] | + vorbis-tools | [] [] | + wastesedge | () | + wdiff | [] [] [] [] [] [] [] [] | + wget | [] [] [] [] [] [] [] [] | + xchat | [] [] [] [] [] [] [] [] | + xkeyboard-config | [] [] [] [] | + xpad | [] [] [] | + +--------------------------------------------------+ + es et eu fa fi fr ga gl gu he hi hr hu id is it + 88 22 14 2 40 115 61 14 1 8 1 6 59 31 0 52 + + ja ko ku ky lg lt lv mk mn ms mt nb ne nl nn no + +-------------------------------------------------+ + GNUnet | | + a2ps | () [] [] () | + aegis | () | + ant-phone | [] | + anubis | [] [] [] | + ap-utils | [] | + aspell | [] [] | + bash | [] | + batchelor | [] [] | + bfd | | + bibshelf | [] | + binutils | | + bison | [] [] [] | + bison-runtime | [] [] [] | + bluez-pin | [] [] [] | + cflow | | + clisp | [] | + console-tools | | + coreutils | [] | + cpio | | + cpplib | [] | + cryptonit | [] | + darkstat | [] [] | + dialog | [] [] | + diffutils | [] [] [] | + doodle | | + e2fsprogs | [] | + enscript | [] | + error | [] | + fetchmail | [] [] | + fileutils | [] [] | + findutils | [] | + flex | [] [] | + fslint | [] [] | + gas | | + gawk | [] [] | + gbiff | [] | + gcal | | + gcc | | + gettext-examples | [] [] | + gettext-runtime | [] [] [] | + gettext-tools | [] [] | + gimp-print | [] [] | + gip | [] [] | + gliv | [] | + glunarclock | [] [] | + gmult | [] [] | + gnubiff | | + gnucash | () () | + gnucash-glossary | [] | + gnuedu | | + gnulib | [] [] [] [] | + gnunet-gtk | | + gnutls | | + gpe-aerial | [] | + gpe-beam | [] | + gpe-calendar | [] | + gpe-clock | [] [] [] | + gpe-conf | [] [] | + gpe-contacts | [] | + gpe-edit | [] [] [] | + gpe-filemanager | [] [] | + gpe-go | [] [] [] | + gpe-login | [] [] [] | + gpe-ownerinfo | [] [] | + gpe-package | [] [] | + gpe-sketchbook | [] [] | + gpe-su | [] [] [] | + gpe-taskmanager | [] [] [] [] | + gpe-timesheet | [] | + gpe-today | [] [] | + gpe-todo | [] | + gphoto2 | [] [] | + gprof | | + gpsdrive | () () () | + gramadoir | () | + grep | [] [] [] [] | + gretl | | + gsasl | [] | + gss | | + gst-plugins | [] | + gst-plugins-base | | + gst-plugins-good | [] | + gstreamer | [] | + gtick | | + gtkam | [] | + gtkorphan | [] | + gtkspell | [] [] | + gutenprint | | + hello | [] [] [] [] [] [] | + id-utils | [] | + impost | | + indent | [] [] | + iso_3166 | [] | + iso_3166_2 | [] | + iso_4217 | [] [] [] | + iso_639 | [] [] | + jpilot | () () () | + jtag | | + jwhois | [] | + kbd | [] | + keytouch | [] | + keytouch-editor | | + keytouch-keyboa... | | + latrine | [] | + ld | | + leafpad | [] [] | + libc | [] [] [] [] [] | + libexif | | + libextractor | | + libgpewidget | [] | + libgpg-error | | + libgphoto2 | [] | + libgphoto2_port | [] | + libgsasl | [] | + libiconv | | + libidn | [] [] | + lifelines | [] | + lilypond | | + lingoteach | [] | + lynx | [] [] | + m4 | [] [] | + mailutils | | + make | [] [] [] | + man-db | () | + minicom | [] | + mysecretdiary | [] | + nano | [] [] [] | + nano_1_0 | [] [] [] | + opcodes | [] | + parted | [] [] | + pilot-qof | | + psmisc | [] [] [] | + pwdutils | | + python | | + qof | | + radius | | + recode | [] | + rpm | [] [] | + screem | [] | + scrollkeeper | [] [] [] [] | + sed | [] [] | + sh-utils | [] [] | + shared-mime-info | [] [] [] [] [] | + sharutils | [] [] | + shishi | | + silky | [] | + skencil | | + sketch | | + solfege | | + soundtracker | | + sp | () | + stardict | [] [] | + system-tools-ba... | [] [] [] [] | + tar | [] [] [] | + texinfo | [] [] [] | + textutils | [] [] [] | + tin | | + tp-robot | [] | + tuxpaint | [] | + unicode-han-tra... | | + unicode-transla... | | + util-linux | [] [] | + vorbis-tools | [] | + wastesedge | [] | + wdiff | [] [] | + wget | [] [] | + xchat | [] [] [] [] | + xkeyboard-config | [] | + xpad | [] [] [] | + +-------------------------------------------------+ + ja ko ku ky lg lt lv mk mn ms mt nb ne nl nn no + 52 24 2 2 1 3 0 2 3 21 0 15 1 97 5 1 + + nso or pa pl pt pt_BR rm ro ru rw sk sl sq sr sv ta + +------------------------------------------------------+ + GNUnet | | + a2ps | () [] [] [] [] [] [] | + aegis | () () | + ant-phone | [] [] | + anubis | [] [] [] | + ap-utils | () | + aspell | [] [] | + bash | [] [] [] | + batchelor | [] [] | + bfd | | + bibshelf | [] | + binutils | [] [] | + bison | [] [] [] [] [] | + bison-runtime | [] [] [] [] | + bluez-pin | [] [] [] [] [] [] [] [] [] | + cflow | [] | + clisp | [] | + console-tools | [] | + coreutils | [] [] [] [] | + cpio | [] [] [] | + cpplib | [] | + cryptonit | [] [] | + darkstat | [] [] [] [] [] [] | + dialog | [] [] [] [] [] [] [] [] [] | + diffutils | [] [] [] [] [] [] | + doodle | [] [] | + e2fsprogs | [] [] | + enscript | [] [] [] [] [] | + error | [] [] [] [] | + fetchmail | [] [] [] | + fileutils | [] [] [] [] [] | + findutils | [] [] [] [] [] [] | + flex | [] [] [] [] [] | + fslint | [] [] [] [] | + gas | | + gawk | [] [] [] [] | + gbiff | [] | + gcal | [] | + gcc | [] | + gettext-examples | [] [] [] [] [] [] [] [] | + gettext-runtime | [] [] [] [] [] [] [] [] | + gettext-tools | [] [] [] [] [] [] [] | + gimp-print | [] [] | + gip | [] [] [] [] | + gliv | [] [] [] [] | + glunarclock | [] [] [] [] [] [] | + gmult | [] [] [] [] | + gnubiff | () | + gnucash | () [] | + gnucash-glossary | [] [] [] | + gnuedu | | + gnulib | [] [] [] [] [] | + gnunet-gtk | [] | + gnutls | [] [] | + gpe-aerial | [] [] [] [] [] [] [] | + gpe-beam | [] [] [] [] [] [] [] | + gpe-calendar | [] | + gpe-clock | [] [] [] [] [] [] [] [] | + gpe-conf | [] [] [] [] [] [] [] | + gpe-contacts | [] [] [] [] [] | + gpe-edit | [] [] [] [] [] [] [] [] | + gpe-filemanager | [] [] | + gpe-go | [] [] [] [] [] [] | + gpe-login | [] [] [] [] [] [] [] [] | + gpe-ownerinfo | [] [] [] [] [] [] [] [] | + gpe-package | [] [] | + gpe-sketchbook | [] [] [] [] [] [] [] [] | + gpe-su | [] [] [] [] [] [] [] [] | + gpe-taskmanager | [] [] [] [] [] [] [] [] | + gpe-timesheet | [] [] [] [] [] [] [] [] | + gpe-today | [] [] [] [] [] [] [] [] | + gpe-todo | [] [] [] [] | + gphoto2 | [] [] [] [] [] | + gprof | [] [] [] | + gpsdrive | [] [] [] | + gramadoir | [] [] | + grep | [] [] [] [] [] [] [] [] | + gretl | [] | + gsasl | [] [] [] | + gss | [] [] [] | + gst-plugins | [] [] [] [] | + gst-plugins-base | [] | + gst-plugins-good | [] [] [] [] | + gstreamer | [] [] [] | + gtick | [] | + gtkam | [] [] [] [] | + gtkorphan | [] | + gtkspell | [] [] [] [] [] [] [] [] | + gutenprint | [] | + hello | [] [] [] [] [] [] [] [] | + id-utils | [] [] [] [] | + impost | [] | + indent | [] [] [] [] [] [] | + iso_3166 | [] [] [] [] [] [] | + iso_3166_2 | | + iso_4217 | [] [] [] [] | + iso_639 | [] [] [] [] | + jpilot | | + jtag | [] | + jwhois | [] [] [] [] | + kbd | [] [] [] | + keytouch | [] | + keytouch-editor | [] | + keytouch-keyboa... | [] | + latrine | [] [] | + ld | [] | + leafpad | [] [] [] [] [] [] | + libc | [] [] [] [] [] | + libexif | [] | + libextractor | [] [] | + libgpewidget | [] [] [] [] [] [] [] | + libgpg-error | [] [] | + libgphoto2 | [] | + libgphoto2_port | [] [] [] | + libgsasl | [] [] [] [] | + libiconv | [] [] | + libidn | [] [] () | + lifelines | [] [] | + lilypond | | + lingoteach | [] | + lynx | [] [] [] | + m4 | [] [] [] [] [] | + mailutils | [] [] [] [] | + make | [] [] [] [] | + man-db | [] [] | + minicom | [] [] [] [] [] | + mysecretdiary | [] [] [] [] | + nano | [] [] [] | + nano_1_0 | [] [] [] [] | + opcodes | [] [] | + parted | [] | + pilot-qof | [] | + psmisc | [] [] | + pwdutils | [] [] | + python | | + qof | [] [] | + radius | [] [] | + recode | [] [] [] [] [] [] [] | + rpm | [] [] [] [] | + screem | | + scrollkeeper | [] [] [] [] [] [] [] | + sed | [] [] [] [] [] [] [] [] [] | + sh-utils | [] [] [] | + shared-mime-info | [] [] [] [] [] | + sharutils | [] [] [] [] | + shishi | [] | + silky | [] | + skencil | [] [] [] | + sketch | [] [] [] | + solfege | [] | + soundtracker | [] [] | + sp | | + stardict | [] [] [] | + system-tools-ba... | [] [] [] [] [] [] [] [] [] | + tar | [] [] [] [] [] | + texinfo | [] [] [] [] | + textutils | [] [] [] | + tin | () | + tp-robot | [] | + tuxpaint | [] [] [] [] [] | + unicode-han-tra... | | + unicode-transla... | | + util-linux | [] [] [] [] | + vorbis-tools | [] [] | + wastesedge | | + wdiff | [] [] [] [] [] [] | + wget | [] [] [] [] | + xchat | [] [] [] [] [] [] [] | + xkeyboard-config | [] [] | + xpad | [] [] [] | + +------------------------------------------------------+ + nso or pa pl pt pt_BR rm ro ru rw sk sl sq sr sv ta + 0 2 3 58 30 54 5 73 72 4 40 46 11 50 128 2 + + tg th tk tr uk ven vi wa xh zh_CN zh_HK zh_TW zu + +---------------------------------------------------+ + GNUnet | [] | 2 + a2ps | [] [] [] | 19 + aegis | | 0 + ant-phone | [] [] | 6 + anubis | [] [] [] | 11 + ap-utils | () [] | 4 + aspell | [] [] [] | 15 + bash | [] | 11 + batchelor | [] [] | 9 + bfd | | 1 + bibshelf | [] | 7 + binutils | [] [] [] | 9 + bison | [] [] [] | 19 + bison-runtime | [] [] [] | 15 + bluez-pin | [] [] [] [] [] [] | 28 + cflow | [] [] | 5 + clisp | | 6 + console-tools | [] [] | 5 + coreutils | [] [] | 16 + cpio | [] [] [] | 9 + cpplib | [] [] [] [] | 11 + cryptonit | | 5 + darkstat | [] () () | 15 + dialog | [] [] [] [] [] | 30 + diffutils | [] [] [] [] | 28 + doodle | [] | 6 + e2fsprogs | [] [] | 10 + enscript | [] [] [] | 16 + error | [] [] [] [] | 18 + fetchmail | [] [] | 12 + fileutils | [] [] [] | 18 + findutils | [] [] [] | 17 + flex | [] [] | 15 + fslint | [] | 9 + gas | [] | 3 + gawk | [] [] | 15 + gbiff | [] | 5 + gcal | [] | 5 + gcc | [] [] [] | 6 + gettext-examples | [] [] [] [] [] [] | 27 + gettext-runtime | [] [] [] [] [] [] | 28 + gettext-tools | [] [] [] [] [] | 19 + gimp-print | [] [] | 12 + gip | [] [] | 12 + gliv | [] [] | 8 + glunarclock | [] [] [] | 15 + gmult | [] [] [] [] | 15 + gnubiff | [] | 1 + gnucash | () | 2 + gnucash-glossary | [] [] | 9 + gnuedu | [] | 2 + gnulib | [] [] [] [] [] | 28 + gnunet-gtk | | 1 + gnutls | | 2 + gpe-aerial | [] [] | 14 + gpe-beam | [] [] | 14 + gpe-calendar | [] | 3 + gpe-clock | [] [] [] [] | 21 + gpe-conf | [] [] | 14 + gpe-contacts | [] [] | 10 + gpe-edit | [] [] [] [] | 20 + gpe-filemanager | [] | 6 + gpe-go | [] [] | 15 + gpe-login | [] [] [] [] [] | 21 + gpe-ownerinfo | [] [] [] [] | 21 + gpe-package | [] | 6 + gpe-sketchbook | [] [] | 16 + gpe-su | [] [] [] | 20 + gpe-taskmanager | [] [] [] | 20 + gpe-timesheet | [] [] [] [] | 18 + gpe-today | [] [] [] [] [] | 21 + gpe-todo | [] | 7 + gphoto2 | [] [] [] [] | 20 + gprof | [] [] | 11 + gpsdrive | | 4 + gramadoir | [] | 7 + grep | [] [] [] [] | 34 + gretl | | 4 + gsasl | [] [] | 8 + gss | [] | 5 + gst-plugins | [] [] [] | 15 + gst-plugins-base | [] [] [] | 9 + gst-plugins-good | [] [] [] [] [] | 20 + gstreamer | [] [] [] | 17 + gtick | [] | 3 + gtkam | [] | 13 + gtkorphan | [] | 7 + gtkspell | [] [] [] [] [] [] | 26 + gutenprint | | 3 + hello | [] [] [] [] [] | 37 + id-utils | [] [] | 14 + impost | [] | 4 + indent | [] [] [] [] | 25 + iso_3166 | [] [] [] [] | 16 + iso_3166_2 | | 2 + iso_4217 | [] [] | 14 + iso_639 | [] | 14 + jpilot | [] [] [] [] | 7 + jtag | [] | 3 + jwhois | [] [] [] | 13 + kbd | [] [] | 12 + keytouch | [] | 4 + keytouch-editor | | 2 + keytouch-keyboa... | [] | 3 + latrine | [] [] | 8 + ld | [] [] [] [] | 8 + leafpad | [] [] [] [] | 23 + libc | [] [] [] | 23 + libexif | [] | 4 + libextractor | [] | 5 + libgpewidget | [] [] [] | 19 + libgpg-error | [] | 4 + libgphoto2 | [] | 8 + libgphoto2_port | [] [] [] | 11 + libgsasl | [] | 8 + libiconv | [] | 7 + libidn | [] [] | 10 + lifelines | | 4 + lilypond | | 2 + lingoteach | [] | 6 + lynx | [] [] [] | 15 + m4 | [] [] [] | 18 + mailutils | [] | 8 + make | [] [] [] | 20 + man-db | [] | 6 + minicom | [] | 14 + mysecretdiary | [] [] | 12 + nano | [] [] | 17 + nano_1_0 | [] [] [] | 18 + opcodes | [] [] | 10 + parted | [] [] [] | 10 + pilot-qof | [] | 3 + psmisc | [] | 10 + pwdutils | [] | 3 + python | | 0 + qof | [] | 4 + radius | [] | 6 + recode | [] [] [] | 25 + rpm | [] [] [] [] | 14 + screem | [] | 2 + scrollkeeper | [] [] [] [] | 26 + sed | [] [] [] | 22 + sh-utils | [] | 15 + shared-mime-info | [] [] [] [] | 24 + sharutils | [] [] [] | 23 + shishi | | 1 + silky | [] | 4 + skencil | [] | 7 + sketch | | 6 + solfege | | 2 + soundtracker | [] [] | 9 + sp | [] | 3 + stardict | [] [] [] [] | 11 + system-tools-ba... | [] [] [] [] [] [] [] | 37 + tar | [] [] [] [] | 20 + texinfo | [] [] [] | 15 + textutils | [] [] [] | 17 + tin | | 1 + tp-robot | [] [] [] | 10 + tuxpaint | [] [] [] | 16 + unicode-han-tra... | | 0 + unicode-transla... | | 2 + util-linux | [] [] [] | 20 + vorbis-tools | [] [] | 11 + wastesedge | | 1 + wdiff | [] [] | 22 + wget | [] [] [] | 19 + xchat | [] [] [] [] | 29 + xkeyboard-config | [] [] [] [] | 11 + xpad | [] [] [] | 14 + +---------------------------------------------------+ + 77 teams tg th tk tr uk ven vi wa xh zh_CN zh_HK zh_TW zu + 170 domains 0 1 1 77 39 0 136 10 1 48 5 54 0 2028 + + Some counters in the preceding matrix are higher than the number of +visible blocks let us expect. This is because a few extra PO files are +used for implementing regional variants of languages, or language +dialects. + + For a PO file in the matrix above to be effective, the package to +which it applies should also have been internationalized and +distributed as such by its maintainer. There might be an observable +lag between the mere existence a PO file and its wide availability in a +distribution. + + If October 2006 seems to be old, you may fetch a more recent copy of +this `ABOUT-NLS' file on most GNU archive sites. The most up-to-date +matrix with full percentage details can be found at +`http://www.iro.umontreal.ca/contrib/po/HTML/matrix.html'. + +1.6 Using `gettext' in new packages +=================================== + +If you are writing a freely available program and want to +internationalize it you are welcome to use GNU `gettext' in your +package. Of course you have to respect the GNU Library General Public +License which covers the use of the GNU `gettext' library. This means +in particular that even non-free programs can use `libintl' as a shared +library, whereas only free software can use `libintl' as a static +library or use modified versions of `libintl'. + + Once the sources are changed appropriately and the setup can handle +the use of `gettext' the only thing missing are the translations. The +Free Translation Project is also available for packages which are not +developed inside the GNU project. Therefore the information given above +applies also for every other Free Software Project. Contact +`translation@iro.umontreal.ca' to make the `.pot' files available to +the translation teams. + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/AUTHORS b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/AUTHORS new file mode 100644 index 0000000..fa9e7fe --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/AUTHORS @@ -0,0 +1,13 @@ + Copyright (C) 2006, 2007 Free Software Foundation, Inc. + + Copying and distribution of this file, with or without modification, + are permitted in any medium without royalty provided the copyright + notice and this notice are preserved. + +Gawk was written by Paul Rubin, and finished by Paul Finlason and +Richard Stallman. + +David Trueman and Arnold Robbins took it over, with David doing most +of the work to make it compatible with new awk. + +Circa 1994, Arnold Robbins took over maintenance. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/COPYING b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/COPYING new file mode 100644 index 0000000..94a9ed0 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/COPYING @@ -0,0 +1,674 @@ + GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. <http://fsf.org/> + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for +software and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. We, the Free Software Foundation, use the +GNU General Public License for most of our software; it applies also to +any other work released this way by its authors. You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you have +certain responsibilities if you distribute copies of the software, or if +you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the manufacturer +can do so. This is fundamentally incompatible with the aim of +protecting users' freedom to change the software. The systematic +pattern of such abuse occurs in the area of products for individuals to +use, which is precisely where it is most unacceptable. Therefore, we +have designed this version of the GPL to prohibit the practice for those +products. If such problems arise substantially in other domains, we +stand ready to extend this provision to those domains in future versions +of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + <one line to give the program's name and a brief idea of what it does.> + Copyright (C) <year> <name of author> + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see <http://www.gnu.org/licenses/>. + +Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + <program> Copyright (C) <year> <name of author> + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, your program's commands +might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU GPL, see +<http://www.gnu.org/licenses/>. + + The GNU General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, you +may consider it more useful to permit linking proprietary applications with +the library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. But first, please read +<http://www.gnu.org/philosophy/why-not-lgpl.html>. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/INSTALL b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/INSTALL new file mode 100644 index 0000000..5458714 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/INSTALL @@ -0,0 +1,234 @@ +Installation Instructions +************************* + +Copyright (C) 1994, 1995, 1996, 1999, 2000, 2001, 2002, 2004, 2005, +2006 Free Software Foundation, Inc. + +This file is free documentation; the Free Software Foundation gives +unlimited permission to copy, distribute and modify it. + +Basic Installation +================== + +Briefly, the shell commands `./configure; make; make install' should +configure, build, and install this package. The following +more-detailed instructions are generic; see the `README' file for +instructions specific to this package. + + The `configure' shell script attempts to guess correct values for +various system-dependent variables used during compilation. It uses +those values to create a `Makefile' in each directory of the package. +It may also create one or more `.h' files containing system-dependent +definitions. Finally, it creates a shell script `config.status' that +you can run in the future to recreate the current configuration, and a +file `config.log' containing compiler output (useful mainly for +debugging `configure'). + + It can also use an optional file (typically called `config.cache' +and enabled with `--cache-file=config.cache' or simply `-C') that saves +the results of its tests to speed up reconfiguring. Caching is +disabled by default to prevent problems with accidental use of stale +cache files. + + If you need to do unusual things to compile the package, please try +to figure out how `configure' could check whether to do them, and mail +diffs or instructions to the address given in the `README' so they can +be considered for the next release. If you are using the cache, and at +some point `config.cache' contains results you don't want to keep, you +may remove or edit it. + + The file `configure.ac' (or `configure.in') is used to create +`configure' by a program called `autoconf'. You need `configure.ac' if +you want to change it or regenerate `configure' using a newer version +of `autoconf'. + +The simplest way to compile this package is: + + 1. `cd' to the directory containing the package's source code and type + `./configure' to configure the package for your system. + + Running `configure' might take a while. While running, it prints + some messages telling which features it is checking for. + + 2. Type `make' to compile the package. + + 3. Optionally, type `make check' to run any self-tests that come with + the package. + + 4. Type `make install' to install the programs and any data files and + documentation. + + 5. You can remove the program binaries and object files from the + source code directory by typing `make clean'. To also remove the + files that `configure' created (so you can compile the package for + a different kind of computer), type `make distclean'. There is + also a `make maintainer-clean' target, but that is intended mainly + for the package's developers. If you use it, you may have to get + all sorts of other programs in order to regenerate files that came + with the distribution. + +Compilers and Options +===================== + +Some systems require unusual options for compilation or linking that the +`configure' script does not know about. Run `./configure --help' for +details on some of the pertinent environment variables. + + You can give `configure' initial values for configuration parameters +by setting variables in the command line or in the environment. Here +is an example: + + ./configure CC=c99 CFLAGS=-g LIBS=-lposix + + *Note Defining Variables::, for more details. + +Compiling For Multiple Architectures +==================================== + +You can compile the package for more than one kind of computer at the +same time, by placing the object files for each architecture in their +own directory. To do this, you can use GNU `make'. `cd' to the +directory where you want the object files and executables to go and run +the `configure' script. `configure' automatically checks for the +source code in the directory that `configure' is in and in `..'. + + With a non-GNU `make', it is safer to compile the package for one +architecture at a time in the source code directory. After you have +installed the package for one architecture, use `make distclean' before +reconfiguring for another architecture. + +Installation Names +================== + +By default, `make install' installs the package's commands under +`/usr/local/bin', include files under `/usr/local/include', etc. You +can specify an installation prefix other than `/usr/local' by giving +`configure' the option `--prefix=PREFIX'. + + You can specify separate installation prefixes for +architecture-specific files and architecture-independent files. If you +pass the option `--exec-prefix=PREFIX' to `configure', the package uses +PREFIX as the prefix for installing programs and libraries. +Documentation and other data files still use the regular prefix. + + In addition, if you use an unusual directory layout you can give +options like `--bindir=DIR' to specify different values for particular +kinds of files. Run `configure --help' for a list of the directories +you can set and what kinds of files go in them. + + If the package supports it, you can cause programs to be installed +with an extra prefix or suffix on their names by giving `configure' the +option `--program-prefix=PREFIX' or `--program-suffix=SUFFIX'. + +Optional Features +================= + +Some packages pay attention to `--enable-FEATURE' options to +`configure', where FEATURE indicates an optional part of the package. +They may also pay attention to `--with-PACKAGE' options, where PACKAGE +is something like `gnu-as' or `x' (for the X Window System). The +`README' should mention any `--enable-' and `--with-' options that the +package recognizes. + + For packages that use the X Window System, `configure' can usually +find the X include and library files automatically, but if it doesn't, +you can use the `configure' options `--x-includes=DIR' and +`--x-libraries=DIR' to specify their locations. + +Specifying the System Type +========================== + +There may be some features `configure' cannot figure out automatically, +but needs to determine by the type of machine the package will run on. +Usually, assuming the package is built to be run on the _same_ +architectures, `configure' can figure that out, but if it prints a +message saying it cannot guess the machine type, give it the +`--build=TYPE' option. TYPE can either be a short name for the system +type, such as `sun4', or a canonical name which has the form: + + CPU-COMPANY-SYSTEM + +where SYSTEM can have one of these forms: + + OS KERNEL-OS + + See the file `config.sub' for the possible values of each field. If +`config.sub' isn't included in this package, then this package doesn't +need to know the machine type. + + If you are _building_ compiler tools for cross-compiling, you should +use the option `--target=TYPE' to select the type of system they will +produce code for. + + If you want to _use_ a cross compiler, that generates code for a +platform different from the build platform, you should specify the +"host" platform (i.e., that on which the generated programs will +eventually be run) with `--host=TYPE'. + +Sharing Defaults +================ + +If you want to set default values for `configure' scripts to share, you +can create a site shell script called `config.site' that gives default +values for variables like `CC', `cache_file', and `prefix'. +`configure' looks for `PREFIX/share/config.site' if it exists, then +`PREFIX/etc/config.site' if it exists. Or, you can set the +`CONFIG_SITE' environment variable to the location of the site script. +A warning: not all `configure' scripts look for a site script. + +Defining Variables +================== + +Variables not defined in a site shell script can be set in the +environment passed to `configure'. However, some packages may run +configure again during the build, and the customized values of these +variables may be lost. In order to avoid this problem, you should set +them in the `configure' command line, using `VAR=value'. For example: + + ./configure CC=/usr/local2/bin/gcc + +causes the specified `gcc' to be used as the C compiler (unless it is +overridden in the site shell script). + +Unfortunately, this technique does not work for `CONFIG_SHELL' due to +an Autoconf bug. Until the bug is fixed you can use this workaround: + + CONFIG_SHELL=/bin/bash /bin/bash ./configure CONFIG_SHELL=/bin/bash + +`configure' Invocation +====================== + +`configure' recognizes the following options to control how it operates. + +`--help' +`-h' + Print a summary of the options to `configure', and exit. + +`--version' +`-V' + Print the version of Autoconf used to generate the `configure' + script, and exit. + +`--cache-file=FILE' + Enable the cache: use and save the results of the tests in FILE, + traditionally `config.cache'. FILE defaults to `/dev/null' to + disable caching. + +`--config-cache' +`-C' + Alias for `--cache-file=config.cache'. + +`--quiet' +`--silent' +`-q' + Do not print messages saying which checks are being made. To + suppress all normal output, redirect it to `/dev/null' (any error + messages will still be shown). + +`--srcdir=DIR' + Look for the package's source code in directory DIR. Usually + `configure' can determine that directory automatically. + +`configure' also accepts some other, not widely useful, options. Run +`configure --help' for more details. + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/NEWS b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/NEWS new file mode 100644 index 0000000..a0ba8db --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/NEWS @@ -0,0 +1,2486 @@ + Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, + 2005, 2006, 2007 Free Software Foundation, Inc. + + Copying and distribution of this file, with or without modification, + are permitted in any medium without royalty provided the copyright + notice and this notice are preserved. + +Changes from 3.1.5 to 3.1.6 +--------------------------- + +1. `gawk 'program' /non/existant/file' no longer core dumps. + +2. Too many people the world over have complained about gawk's use of the + locale's decimal point for parsing input data instead of the traditional + period. So, even though gawk was being nicely standards-compliant, in + a Triumph For The Users, gawk now only uses the locale's decimal point + if --posix is supplied or if POSIXLY_CORRECT is set. It is the sincere + hope that this change will eliminate this FAQ from being asked. + +3. `gawk -v BINMODE=1 ...' works again. + +4. Internal file names like `/dev/user' now work again. (Note that these + file names are obsolete and will go away eventually.) + +5. Problems with wide strings in non "C" locales have been straightened + out everywhere. (At least, we think so.) + +6. Use of `ansi2knr' is no longer supported. Please use an ANSI C compiler. + +7. Updated to Autoconf 2.61, Automake 1.10, and Gettext 0.16.1. + +8. The getopt* and regex* files were synchronized with current GLIBC CVS. + See the ChangeLog for the versions and minor edits made. + +9. There are additional --lint-old warnings. + +10. Gawk now uses getaddrinfo(3) to look up names and IP addresses. This + allows the use of an IPv6 format address and paves the way for + eventual addition of `/inet6/...' and `/inet4/...' hostnames. + +11. We believe gawk to now be valgrind clean. At least when run against + the test suite. + +12. A number of issues dealing with the formatting and printing of very + large numbers in integer formats have been dealt with and fixed. + +13. Gawk now converts "+inf", "-inf", "+nan" and "-nan" into the corresponding + magic IEEE floating point values. Only those strings (case independent) + work. With --posix, gawk calls the system strtod directly. You asked + for it, you got it, you deal with it. + +14. Defining YYDEBUG enables the -D command line option. + +15. Gawk should now work out of the box on Tandem NSK/OSS systems. + +16. Lint messages rationalized: many more of the messages are now printed + only once, instead of every time they are encountered. + +17. The strftime() function now accepts an optional third argument, which + if non-zero or non-null, indicates that the time should be formatted + as UTC instead of as local time. + +18. The precedence of concatenation and `| getline' (in something like + "echo " "date" | getline stuff) has been reverted to the earlier + behavior and now once again matches Unix awk. + +19. New configure time flag --disable-directories-fatal which causes + gawk to silently skip directories on the command line. This behavior + is also enabled for --traditional, since it's what Unix awk does. + +20. A new option, --use-lc-numeric, forces use of the locale's decimal + point without the rest of the draconian restrictions imposed by + --posix. This softens somewhat the stance taken in item #2. + +21. Everything relevant has been updated to the GPL 3. + +22. Array growth should be faster now, at no cost in space. + +23. Lots more tests. + +24. One new translation. + +25. Various bugs fixed, see the ChangeLog for details. + +Changes from 3.1.4 to 3.1.5 +--------------------------- + +1. The random() suite has been updated to a current FreeBSD version, which + works on systems with > 32-bit ints. + +2. A new option, `--exec' has been added. It's like -f but ends option + processing. It also disables `x=y' variable assignments, but not -v. + It's needed mainly for CGI scripts, so that source code can't be + passed in as part of the URL. + +3. dfa.[ch] have been synced with GNU grep development. This also fixes + multiple regex matching problems in multibyte locales. + +4. Updated to Automake 1.9.5. + +5. Updated to Bison 2.0. + +6. The getopt* and regex* files were synchronized with current GLIBC CVS. + See the ChangeLog for the versions and minor edits made. + +7. `configure --disable-nls' now disables just gawk's own translations. + Gawk continues to work with the locale's numeric formatting. This + includes a bug fix in handling the printf ' flag (e.g., %'d). + +8. Gawk is now multibyte aware. This means that index(), length(), + substr() and match() all work in terms of characters, not bytes. + +9. Gawk is now smarter about parsing numeric constants in corner cases. + +11. Not closing open redirections no longer causes gawk to exit non-zero. + +10. The VMS port has been updated. + +11. Changes from Andrew Schorr at the xmlgawk project to provide for + open hooks from extensions are now included. This will let the + xmlgawk extension work in the standard gawk. + +12. Updated to gettext 0.14.4. Gawk no longer includes its own copy + of the gettext `intl' library, following current GNU practice to + rely on there being an external version thereof. + +13. A regexp of the form `//' will now generate a warning that it + is not a C++ comment from --lint (awk.y). + +14. The ^ and ^= operators with an integer exponent now use Exponentiation + by Squaring. This simultaneously fixes a problem with ^= and a negative + integer exponent. + +15. length(array) now returns the number of elements in the array. This is + is a non-standard extension that will fail in POSIX mode. + +16. Carriage return characters are now ignored in program source code. + +17. Four new translations added. + +18. Various minor bugs fixed. See the ChangeLog for the details. + +Changes from 3.1.3 to 3.1.4 +--------------------------- + +1. Gawk now supports the POSIX %F format, falling back to %f if the local + system printf doesn't handle it. + +2. Gawk now supports the ' flag in printf. E.g., %'d in a locale with thousands + separators includes the thousands separator in the value, e.g. 12,345. + + This has one problem; the ' flag is next to impossible to use on the + command line, without major quoting games. Oh well, TANSTAAFL. + +3. The dfa code has been reinstated; the performance degradation was + just too awful. Sigh. (For fun, use `export GAWK_NO_DFA=1' to + see the difference.) + +4. The special case `x = x y' is now recognized in the grammar, and gawk + now uses `realloc' to append the new value to the end of the existing + one. This can speed up the common case of appending onto a string. + +5. The dfa code was upgraded with most of the fixes from grep 2.5.1, and + the regex code was upgraded with GLIBC as mid-January 2004. The regex + code is faster than it was, but still not as fast as the dfa code, so + the dfa code stays in. The getopt code was also synced to current GLIBC. + +6. Support code upgraded to Automake 1.8.5, Autoconf 2.59, and gettext 0.14.1. + +7. When --posix is in effect, sub/gsub now follow the 2001 POSIX behavior. + Yippee. This is even documented in the manual. + +8. Gawk will now recover children that have died (input pipelines, two-way + pipes), upon detecting EOF from them, thus avoiding filling + up the process table. Open file descriptors are not recovered + (unfortunately), since that could break awk semantics. See the + ChangeLog and the source code for the details. + +9. Handling of numbers like `0,1' in non-American locales ought to + work correctly now. + +10. IGNORECASE is now locale-aware for characters with values above 128. + The dfa matcher is now used for IGNORECASE matches too. + +11. Dynamic function loading is better. The documentation has been improved + and some new APIs for use by dynamic functions have been added. + +12. Gawk now has a fighting chance of working on older systems, + a la SunOS 4.1.x. + +13. Issues with multibyte support on HP-UX are now resolved. `configure' now + disables such support there, since it's not up to what gawk needs. + +14. There are now even more tests in the test suite. + +15. Various bugs fixed; see ChangeLog for the details. + +Changes from 3.1.2 to 3.1.3 +--------------------------- + +1. Gawk now follows POSIX in handling of local numeric formats for + input, output and number/string conversions. + +2. Multibyte detection improved. See README_d/README.multibyte for more + info about multibyte locales. + +3. Handling of `close' made more POSIX-compliant for POSIXLY_CORRECT, + see the documentation. + +4. The record reading code was redone, again. This time it's much + better. Really! + +5. For RS = "\n" and RS = "", gawk now only sets RT when it has changed. + This provides considerable performance improvement. + +6. `match' now sets all the subscripts in the third argument array + correctly, even if not all subexpressions matched. + +7. Updated to Automake 1.7.5. configure.in renamed configure.ac. + +8. C-style switch statements are available, but must be enabled at + compile time via `configure --enable-switch'. For 3.2 they'll be + enabled by default. Thanks to Michael Benzinger for the initial + code. + +9. %c now always prints no more than one character, whatever + precision is provided. + +10. strtonum(<number>) now works again. + +11. Gawk is now much better about scalar/array typing of global + uninitiailzed variables passed as parameters. Once the parameter + is then used one way or the other, the global var's type is + adjusted accordingly. Thanks to Stepan Kasal for the original + (considerable) changes. + +12. Dynamic function loading under Windows32 should now be possible. See + README_d/README.pcdynamic. Thanks to Patrick T.J. McPhee for the changes. + +13. Updated to gettext 0.12.1. + +14. Gawk now follows historical practice and POSIX for the return + value of `rand': It's now 0 <= N < 1. + +Changes from 3.1.1 to 3.1.2 +--------------------------- + +1. Loops of the form: + + for (iggy in foo) + next + + no longer leak memory. + +2. gawk -v FIELDWIDTHS="..." now sets PROCINFO["FS"] correctly. + +3. All builtin operations and functions should now fully evaluate their + arguments so that side effects take place correctly. + +4. Fixed a logic bug in gsub/gensub for matches to null strings that occurred + later in the string after a nonnull match. + +5. getgroups code now works on Ultrix again. + +6. Completely new version of the full GNU regex engine now in place. + +7. Argument parsing and variable assignment has been cleaned up. + +8. An I/O bug on HP-UX has been documented and worked around. See + README_d/README.hpux. + +9. awklib/grcat should now compile correctly. + +10. Updated to automake 1.7.3, autoconf 2.57 and gettext 0.11.5 ; thanks to + Paul Eggert for the initial automake and autoconf work. + +11. As a result of #6, removed the use of the dfa code from GNU grep. + +12. It is now possible to use ptys for |& two-way pipes instead of + pipes. The basic plumbing for this was provided by Paolo Bonzini. + To make this happen: + + command = "unix command etc" + PROCINFO[command, "pty"] = 1 + + print ... |& command + command |& getline stuff + + In other words, set the element in PROCINFO *before* opening the + two-way pipe, and then gawk will use ptys instead of pipes. + + On systems without ptys or where all the ptys are in use, gawk + will fall back to using plain pipes. + +13. Fixed a regex matching across buffer boundaries bug, with a + heuristic. See io.c:rsre_get_a_record. + +14. Profiling no longer dumps core if there are extension functions in place. + +15. Grammar and scanner cleaned up, courtesy of Stepen Kasal, to hopefully + once and for all fix the `/=' operator vs. `/=.../' regex ambiguity. + Lots of other grammar simplifications applied, as well. + +16. BINMODE should work now on more Windows ports. + +17. Updated to bison 1.875. Includes fix to bisonfix.sed script. + +18. The NODE structure is now 20% (8 bytes) smaller (on x86, anyway), which + should help conserve memory. + +19. Builds not in the source directory should work again. + +20. Arrays now use 2 NODE's per element instead of three. Combined with + #18, (on the x86) this reduces the overhead from 120 bytes per element + to just 64 bytes: almost a 50% improvement. + +21. Programs that make heavy use of changing IGNORECASE should now be + much faster, particularly if using a regular expression for FS or RS. + IGNORECASE now correctly affects RS regex record splitting, as well. + +22. IGNORECASE no longer affects single-character field splitting (FS = "c"), + or single-character record splitting (RS = "c"). + + This cleans up some weird behavior, and makes gawk better match the + documentation, which says it only affects regex-based field splitting + and record splitting. + + The documentation on this was improved, too. + +23. The framework in test/ has been simplified, making it much easier to + add new tests while keeping the size of Makefile.am reasonable. Thanks + for this to Stepan Kasal. + +24. --lint=invalid causes lint warnings only about stuff that's actually + invalid. This needs additional work. + +25. More translations. + +26. The `get_a_record' routine has been revamped (currently by splitting it + into three variants). This should improve long-term maintainability. + +27. `match' now adds more entries to 3rd array arg: + match("the big dog", /([a-z]+) ([a-z]+) ([a-z]+)/, data) + fills in variables: + data[1, "start"], data[1, "length"], and so on. + +28. New `asorti' function with same interface as `asort', but sorts indices + instead of values. + +29. Documentation updated to FDL 1.2. + +30. New `configure' option --disable-lint at compile time disables lint + checking. With GCC dead-code-elimination, cuts almost 200K off the + executable size on GNU/Linux x86. Presumably speeds up runtime. + + Using this will cause some of the tests in the test suite to fail. + This option may be removed at a later date. + +31. Various minor cleanups, see the ChangeLog for details. + +Changes from 3.1.0 to 3.1.1 +--------------------------- + +1. Six new translations. + +2. Having more than 4 different values for OFMT and/or CONVFMT now works. + +3. The handling of dynamic regexes is now more more sane, esp. w.r.t. + the profiling code. The profiling code has been fixed in several + places. + +4. The return value of index("", "") is now 1. + +5. Gawk should no longer close fd 0 in child processes. + +6. Fixed test for strtod semantics and regenerated configure. + +7. Gawk can now be built with byacc; an accidental bison dependency was + removed. + +8. `yyerror' will no longer dump core on long source lines. + +9. Gawk now correctly queries getgroups(2) to figure out how many groups + the process has. + +10. New configure option to force use of included strftime, e.g. on + Solaris systems. See `./configure --help' for the details. Replaced + the included strftime.c with the one from textutils. + +11. OS/2 port has been updated. + +12. Multi-byte character support has been added, courtesy of IBM Japan. + +13. The `for (iggy in foo) delete foo[iggy]' -> `delete foo' optimisation + now works. + +14. Upgraded to gettext 0.11.2 and automake 1.5. + +15. Full gettext compatibility (new dcngettext function). + +16. The O'Reilly copyedits and indexing changes for the documentation have + been folded into the texinfo version of the manuals. + +17. A humongously long value for the AWKPATH environment variable will no + longer dump core. + +18. Configuration / Installation issues have been straightened out in + Makefile.am. + +Changes from 3.0.6 to 3.1.0 +--------------------------- + +1. A new PROCINFO array provides info about the process. The non-I/O /dev/xxx + files are now obsolete, and their use always generates a warning. + +2. A new `mktime' builtin function was added for creating time stamps. The + `mktime' function written in awk was removed from the user's guide. + +3. New `--gen-po' option creates GNU gettext .po files for strings marked + with a leading underscore. + +4. Gawk now completely interprets special file names internally, ignoring the + existence of real /dev/stdin, /dev/stdout files, etc. + +5. The mmap code was removed. It was a worthwhile experiment that just + didn't work out. + +6. The BINMODE variable is new; on non-UNIX systems it affects how gawk + opens files for text vs. binary. + +7. The atari port is now unsupported. + +8. Gawk no longer supports `next file' as two words. + +9. On systems that support it, gawk now sets the `close on exec' flag on all + files and pipes it opens. This makes sure that child processes run via + `system' or pipes have plenty of file descriptors available. + +10. New ports: Tandem and BeOS. The Tandem port is unsupported. + +11. If `--posix' is in effect, newlines are not allowed after ?:. + +12. Weird OFMT/CONVFMT formats no longer cause fatal errors. + +13. Diagnostics about array parameters now include the parameter's name, + not just its number. + +14. configure should now automatically add -D_SYSV3 for ISC Unix. + (This seems to have made it into the gawk 3.0.x line long ago.) + +15. It is now possible to open a two-way pipe via the `|&' operator. + See the discussion in the manual about putting `sort' into such a pipeline, + though. (NOTE! This is borrowed from ksh: it is not the same as + the same operator in csh!) + +16. The `close' function now takes an optional second string argument + that allows closing one or the other end of the two-way pipe to + a co-process. This is needed to use `sort' in a co-process, see + the doc. + +17. If TCP/IP is available, special file names beginning with `/inet' + can be used with `|&' for IPC. Thanks to Juergen Kahrs for the initial + code. + +18. With `--enable-portals' on the configure command line, gawk will also + treat file names that start with `/p/' as a 4.4 BSD type portal file, + i.e., a two-way pipe for `|&'. + +19. Unrecognized escapes, such as "\q" now always generate a warning. + +20. The LINT variable is new; it provides dynamic control over the --lint + option. + +21. Lint warnings can be made fatal by using --lint=fatal or `LINT = "fatal"'. + Use this if you're really serious about portable code. + +22. Due to an enhanced sed script, there is no longer any need to worry + about finding or using alloca. alloca.c is thus now gone. + +23. A number of lint warnings have been added. Most notably, gawk will + detect if a variable is used before assigned to. Warnings for + when a string that isn't a number gets converted to a number are + in the code but disabled; they seem to be too picky in practice. + + Also, gawk will now warn about function parameter names that shadow + global variable names. + +24. It is now possible to dynamically add builtin functions on systems + that support dlopen. This facility is not (yet) as portable or well + integrated as it might be. *** WARNING *** THIS FEATURE WILL EVOLVE! + +25. There are *many* new tests in the test suite. + +26. Profiling has been added! A separate version of gawk, named pgawk, is + built and generates a run-time execution profile. The --profile option + can be used to change the default output file. In regular gawk, this + option pretty-prints the parse tree. + +27. Gawk has been internationalized, using GNU gettext. Translations for + future distributions are most welcome. Simultaneously, gawk was switched + over to using automake. You need Automake 1.4a (from the CVS archive) + if you want to muck with the Makefile.am files. + +28. New `asort' function for sorting arrays. See the doc for details. + +29. The match function takes an optional array third argument to hold + the text matched by parenthesized sub-expressions. + +30. The bit op functions and octal and hex source code constants are on by + default, no longer a configure-time option. Recognition of non-decimal + data is now enabled at runtime with --non-decimal-data command line option. + +31. Internationalization features available at the awk level: new TEXTDOMAIN + variable and `bindtextdomain' and `dcgettext' functions. printf formats + may contain the "%2$3.5d" kind of notation for use in translations. See + the texinfo manual for details. + +32. The return value from `close' has been rationalized. Most notably, + closing something that wasn't open returns -1 but remains non-fatal. + +33. The array effeciency change from 3.0.5 was reverted; the semantics were + not right. Additionally, index values of previously stored elements + can no longer change dynamically. + +34. The new option --dump-variables dumps a list of all global variables and + their final types and values to a file you give, or to `awkvars.out'. + +35. Gawk now uses a recent version of random.c courtesy of the FreeBSD + project. + +36. The gawk source code now uses ANSI C function definitions (new style), + with ansi2knr to translate code for old compilers. + +37. `for (iggy in foo)' loops should be more robust now in the face of + adding/deleting elements in the middle; they loop over just the elements + that are present in the array when the loop starts. + +Changes from 3.0.5 to 3.0.6 +--------------------------- + +This is a bug fix release only, pending further development on 3.1.0. + +Bugs fixed and changes made: + +1. Subscripting an array with a variable that is just a number no + longer magically converts the variable into a string. + +2. Similarly, running a `for (iggy in foo)' loop where `foo' is a + function parameter now works correctly. + +3. Similarly, `i = ""; v[i] = a; if (i in v) ...' now works again. + +4. Gawk now special cases `for (iggy in foo) delete foo[iggy]' and + treats it as the moral equivalent of `delete foo'. This should be + a major efficiency win when portably deleting large arrays. + +5. VMS port brought up to date. + +Changes from 3.0.4 to 3.0.5 +--------------------------- + +This is a bug fix release only, pending further development on 3.1.0. + +Bugs Fixed: + + 1. `function foo(foo)' is now a fatal error. + + 2. Array indexing is now much more efficient: where possible, only one + copy of an index string is kept, even if used in multiple arrays. + + 3. Support was added for MacOS X and an `install-strip' target. + + 4. [s]printf formatting for `0' flag and floating point formats now + works correctly. + + 5. HP-UX large file support with GCC 2.95.1 now works. + + 6. Arguments that contain `=' but that aren't syntactically valid are + now treated as filenames, instead of as fatal errors. + + 7. `-v NF=foo' now works. + + 8. Non-ascii alphanumeric characters are now treated as such in the + right locales by regex.c. Similarly, a Latin-1 y-umlaut (decimal + value 255) in the program text no longer acts like EOF. + + 9. Array indexes are always compared as strings; fixes an obscure bug + when user input gets used for the `x in array' test. + +10. The usage message now points users to the documentation for how + to report bugs. + +11. `/=' now works after an array. + +12. `b += b += 1' now works correctly. + +13. IGNORECASE changing with calls `match' now works better. (Fix for + semi-obscure bug.) + +14. Multicharacter values for RS now generate a lint warning. + +15. The gawk open file caching is now much more efficient. + +16. Global arrays passed to functions are now managed better. In particular, + test/arynocls.awk won't crash referencing freed memory. + +17. In obscure cases, `getline var' can no longer clobber $0. + +Changes from 3.0.3 to 3.0.4 +--------------------------- + +This is a bug fix release only, pending further development on 3.1.0. + +Bugs Fixed: + + 1. A memory leak when turning a function parameter into an array was + fixed. + + 2. The non-decimal data option now works correctly. + + 3. Using an empty pair of brackets as an array subscript no longer causes + a core dump during parsing. In general, syntax errors should not + cause core dumps any more. + + 4. Standard input is no longer closed if it provides program source, + avoiding strange I/O problems. + + 5. Memory corruption during printing with `print' has been fixed. + + 6. The gsub function now correctly counts the number of matches. + + 7. A typo in doc/Makefile.in has been fixed, making installation work. + + 8. Calling `next' or `nextfile' from a BEGIN or END rule is now fatal. + + 9. Subtle problems in rebuilding $0 when fields were changed have been + fixed. + +10. `FS = FS' now correctly turns off the use of FIELDWIDTHS. + +11. Gawk now parses fields correctly when FS is a single character. + +12. It is now possible for RS to be the NUL character ("\0"). + +13. Weird problems with number conversions on MIPS and other systems + have been fixed. + +14. When parsing using FIELDWIDTHS is in effect, `split' with no third + argument will still use the value of FS. + +15. Large File Support for Solaris, HP-UX, AIX, and IRIX is now enabled at + compile time, thanks to Paul Eggert. + +16. Attempting to use the name of a function as a variable or array + from within the function is now caught as a fatal error, instead + of as a core dump. + +17. A bug in parsing hex escapes was fixed. + +18. A weird bug with concatenation where one expression has side effects + that changes another was fixed. + +19. printf/sprintf now behave much better for uses of the '0' and '#' flags + and with precisions and field widths. + +20. Further strangenesses with concatenation and multiple accesses of some + of the special variables was fixed. + +21. The Atari port is marked as no longer supported. + +22. Build problems on HP-UX have been fixed. + +23. Minor fixes and additional explanations added to the documentation. + +24. For RS = "", even a single leading newline is now correctly stripped. + +25. Obscure parsing problems for regex constants like /=.../ fixed, so + that a regex constant is recognized, and not the /= operator. + +26. Fixed a bug when closing a redirection that matched the current + or last FILENAME. + +27. Build problems on AIX fixed. + +Changes from 3.0.2 to 3.0.3 +--------------------------- + +The horrendous per-record memory leak introduced in 3.0.1 is gone, finally. + +The `amiga' directory is now gone; Amiga support is now entirely handled +by the POSIX support. + +Windows32 support has been added in the `pc' directory. See `README_d/README.pc' +for more info. + +The mmap changes are disabled in io.c, and will be removed entirely +in the next big release. They were an interesting experiment that just +really didn't work in practice. + +A minor memory leak that occurred when using `next' from within a +function has also been fixed. + +Problems with I/O from sub-processes via a pipe are now gone. + +Using "/dev/pid" and the other special /dev files no longer causes a core dump. + +The files regex.h, regex.c, getopt.h, getopt.c, and getopt1.c have been +merged with the versions in GNU libc. Thanks to Ulrich Drepper for his help. + +Some new undocumented features have been added. Use the source, Luke! +It is not clear yet whether these will ever be fully supported. + +Array performance should be much better for very very large arrays. "Virtual +memory required, real memory helpful." + +builtin.c:do_substr rationalized, again. + +The --re-interval option now works as advertised. + +The license text on some of the missing/* files is now generic. + +Lots more new test cases. + +Lots of other small bugs fixed, see the ChangeLog files for details. + +Changes from 3.0.1 to 3.0.2 +--------------------------- + +Gawk now uses autoconf 2.12. + +strftime now behaves correctly if passed an empty format string or if +the string formats to an empty result string. + +Several minor compilation and installation problems have been fixed. + +Minor page break issues in the user's guide have been fixed. + +Lexical errors no longer repeat ad infinitum. + +Changes from 3.0.0 to 3.0.1 +--------------------------- + +Troff source for a handy-dandy five color reference card is now provided. +Thanks to SSC for their macros. + +Gawk now behaves like Unix awk and mawk, in that newline acts as white +space for separating fields and for `split', by default. In posix mode, +only space and tab separate fields. The documentation has been updated to +reflect this. + +Tons and tons of small bugs fixed and new tests added, see the ChangeLogs. + +Lots fewer compile time warnings from gcc -Wall. Remaining ones aren't +worth fixing. + +Gawk now pays some attention to the locale settings. + +Fixes to gsub to catch several corner cases. + +The `print' statement now evaluates all expressions first, and then +prints them. This leads to less suprising behaviour if any expression has +output side effects. + +Miscellanious improvements in regex.h and regex.c. + +Gawk will now install itself as gawk-M.N.P in $(bindir), and link +`gawk' to it. This makes it easy to have multiple versions of gawk +simultaneously. It will also now install itself as `awk' in $(bindir) +if there is no `awk' there. This is in addition to installing itself as +`gawk'. This change benefits the Hurd, and possibly other systems. One +day, gawk will drop the `g', but not yet. + +`--posix' turns on interval expressions. Gawk now matches its documentation. + +`close(FILENAME)' now does something meaningful. + +Field management code in field.c majorly overhauled, several times. + +The gensub code has been fixed, several bugs are now gone. + +Gawk will use mmap for data file input if it is available. + +The printf/sprintf code has been improved. + +Minor issues in Makefile setup worked on and improved. + +builtin.c:do_substr rationalized. + +Regex matching fixed so that /+[0-9]/ now matches the leading +. + +For building on vms, the default compiler is now DEC C rather than VAX C. + +Changes from 2.15.6 to 3.0.0 +---------------------------- + +Fixed spelling of `Programming' in the copyright notice in all the files. + +New --re-interval option to turn on interval expressions. They're off +by default, except for --posix, to avoid breaking old programs. + +Passing regexp constants as parameters to user defined functions now +generates a lint warning. + +Several obscure regexp bugs fixed; alas, a small number remain. + +The manual has been thoroughly revised. It's now almost 50% bigger than +it used to be. + +The `+' modifier in printf is now reset correctly for each item. + +The do_unix variable is now named do_traditional. + +Handling of \ in sub and gsub rationalized (somewhat, see the manual for +the gory [and I do mean gory] details). + +IGNORECASE now uses ISO 8859-1 Latin-1 instead of straight ASCII. See the +source for how to revert to pure ASCII. + +--lint will now warn if an assignment occurs in a conditional context. +This may become obnoxious enough to need turning off in the future, but +"it seemed like a good idea at the time." + +%hf and %Lf are now diagnosed as invalid in printf, just like %lf. + +Gawk no longer incorrectly closes stdin in child processes used in +input pipelines. + +For integer formats, gawk now correctly treats the precision as the +number of digits to print, not the number of characters. + +gawk is now much better at catching the use of scalar values when +arrays are needed, both in function calls and the `x in y' constructs. + +New gensub function added. See the manual. + +If do_tradtional is true, octal and hex escapes in regexp constants are +treated literally. This matches historical behavior. + +yylex/nextc fixed so that even null characters can be included +in the source code. + +do_format now handles cases where a format specifier doesn't end in +a control letter. --lint reports an error. + +strftime() now uses a default time format equivalent to that of the +Unix date command, thus it can be called with no arguments. + +Gawk now catches functions that are used but not defined at parse time +instead of at run time. (This is a lint error, making it fatal could break +old code.) + +Arrays that max out are now handled correctly. + +Integer formats outside the range of an unsigned long are now detected +correctly using the SunOS 4.x cc compiler. + +--traditional option added as new preferred name for --compat, in keeping +with GCC. + +--lint-old option added, so that warnings about things not in old awk +are only given if explicitly asked for. + +`next file' has changed to one word, `nextfile'. `next file' is still +accepted but generates a lint warning. `next file' will go away eventually. + +Gawk with --lint will now notice empty source files and empty data files. + +Amiga support using the Unix emulation added. Thanks to fnf@ninemoons.com. + +test/Makefile is now "parallel-make safe". + +Gawk now uses POSIX regexps + GNU regex ops by default. --posix goes to +pure posix regexps, and --compat goes to traditional Unix regexps. However, +interval expressions, even though specified by POSIX, are turned off by +default, to avoid breaking old code. + +IGNORECASE now applies to string comparison as well as regexp operations. + +The AT&T Bell Labs Research awk fflush builtin function is now supported. +fflush is extended to flush stdout if no arg and everything if given +the null string as an argument. + +If RS is more than one character, it is treated as a regular expression +and records are delimited accordingly. The variable RT is set to the record +terminator string. This is disabled in compatibility mode. + +If FS is set to the null string (or the third arg. of split() is the null +string), splitting is done at every single character. This is disabled in +compatibility mode. + +Gawk now uses the Autoconf generated configure script, doing away with all +the config/* files and the machinery that went with them. The Makefile.in +has also changed accordingly, complete with all the standard GNU Makefile +targets. (Non-unix systems may still have their own config.h and Makefile; +see the appropriate README_d/README.* and/or subdirectory.) + +The source code has been cleaned up somewhat and the formatting improved. + +Changes from 2.15.5 to 2.15.6 +----------------------------- + +Copyrights updated on all changed files. + +test directory enhanced with four new tests. + +Gawk now generates a warning for \x without following hexadecimal digits. +In this case, it returns 'x', not \0. + +Several fixes in main.c related to variable initialization: + CONVFMT has a default value + resetup is called before initializing variables + the varinit table fixed up a bit (see the comments) + +gawk.1 updated with new BUG REPORTS section. + +A plain `print' inside a BEGIN or END now generates a lint warning (awk.y). + +Small fix in iop.c:get_a_record to avoid reading uninitialized memory. + +awk.y:yylex now does a better job of handling things if the source file +does not end in a newline. Probably there is more work to be done. + +Memory leaks fixed in awk.y, particularly in cases of duplicate function +parameters. Also, calling a function doesn't leak memory during parsing. + +Empty function bodies are now allowed (awk.y). + +Gawk now detects duplicate parameter names in functions (awk.y). + +New function `error' in msg.c added for use from awk.y. + +eval.c:r_get_lhs now checks if its argument is a parameter on the stack, +and pulls down the real variable. This catches more 'using an array as +a scalar' kinds of errors. + +main.c recovers C alloca space after parsing, this is important for +bison-based parsers. re.c recovers C alloca space after doing an research. +[Changes from Pat Rankin] + +builtin.c now declares the random() related functions based on +RANDOM_MISSING from config.h. [Suggested by Pat Rankin] + +awk.h now handles alloca correctly for HP-UX. [Kaveh Ghazi] + +regex.h and config/cray60 updated for Unicos 8.0. [Hal Peterson] + +Fixed re.c and dfa.c so that gawk no longer leaks memory when using +lots of dynamic regexps. + +Removed dependency on signed chars from `idx' variable in awk.h. Gawk +now passes its test suite if compiled with `gcc -fno-signed-char'. + +Fixed warning on close in io.c to go under lint control. Too many people +have complained about the spurious message, particularly when closing a +child pipeline early. + +Gawk now correctly handles RS = "" when input is from a terminal +(iop.c:get_a_record). + +Config file added for GNU. + +gawk 'BEGIN { exit 1 } ; END { exit }' now exits 1, as it should +(eval.c:interpret). + +sub and gsub now follow posix, \ escapes both & and \. Each \ must +be doubled initially in the program to get it into the string. +Thanks to Mike Brennan for pointing this out (builtin.c:sub_common). + +If FS is "", gawk behaves like mawk and nawk, making the whole record be $1. +Yet Another Dark Corner. Sigh (field.c:def_parse_field). + +Gawk now correctly recomputes string values for numbers if CONVFMT has +changed (awk.h:force_string, node.c:r_force_string). + +A regexp of the form `/* this looks like a comment but is not */' will +now generate a warning from --lint (awk.y). + +Gawk will no longer core dump if given an empty input file (awk.y:get_src_buf, +iop.c:optimal_bufsize). + +A printf format of the form %lf is handled correctly. The `l' generates +a lint warning (builtin.c:format_tree) [Thanks to Mark Moraes]. + +Lynxos config file added. + +`continue' outside a loop treated as `next' only in compatibility mode, +instead of by default; recent att nawk chokes on this now. `break' +outside a loop now treated as `next' in compatibility mode (eval.c). + +Bug fix in string concatenation, an arbitrary number of expressions +are allowed (eval.c). + +$1 += $2 now works correctly (eval.c). + +Changing IGNORECASE no longer resets field-splitting to FS if it was +using FIELDWIDTHS (eval.c, field.c). + +Major enhancement: $0 and NF for last record read are now preserved +into the END rule (io.c). + +Regexp fixes: + /./ now matches a newline (regex.h) + ^ and $ match beginning and end of string only, not any embedded + newlines (re.c) + regex.c should compile and work ok on 64-bit mips/sgi machines + +Changes from 2.15.4 to 2.15.5 +----------------------------- + +FUTURES file updated and re-arranged some with more rational schedule. + +Many prototypes handled better for ANSI C in protos.h. + +getopt.c updated somewhat. + +test/Makefile now removes junk directory, `bardargtest' renamed `badargs.' + +Bug fix in iop.c for RS = "". Eat trailing newlines off of record separator. + +Bug fix in Makefile.bsd44, use leading tab in actions. + +Fix in field.c:set_FS for FS == "\\" and IGNORECASE != 0. + +Config files updated or added: + cray60, DEC OSF/1 2.0, Utek, sgi405, next21, next30, atari/config.h, + sco. + +Fix in io.c for ENFILE as well as EMFILE, update decl of groupset to +include OSF/1. + +Rationalized printing as integers if numbers are outside the range of a long. +Changes to node.c:force_string and builtin.c. + +Made internal NF, NR, and FNR variables longs instead of ints. + +Add LIMITS_H_MISSING stuff to config.in and awk.h, and default defs for +INT_MAX and LONG_MAX, if no limits.h file. Add a standard decl of +the time() function for __STDC__. From ghazi@noc.rutgers.edu. + +Fix tree_eval in awk.h and r_tree_eval in eval.c to deal better with +function parameters, particularly ones that are arrays. + +Fix eval.c to print out array names of arrays used in scalar contexts. + +Fix eval.c in interpret to zero out source and sourceline initially. This +does a better job of providing source file and line number information. + +Fix to re_parse_field in field.c to not use isspace when RS = "", but rather +to explicitly look for blank and tab. + +Fix to sc_parse_field in field.c to catch the case of the FS character at the +end of a record. + +Lots of miscellanious bug fixes for memory leaks, courtesy Mark Moraes, +also fixes for arrays. + +io.c fixed to warn about lack of explicit closes if --lint. + +Updated missing/strftime.c to match posted strftime 6.2. + +Bug fix in builtin.c, in case of non-match in sub_common. + +Updated constant used for division in builtin.c:do_rand for DEC Alpha +and CRAY Y-MP. + +POSIXLY_CORRECT in the environment turns on --posix (fixed in main.c). + +Updated srandom prototype and calls in builtin.c. + +Fix awk.y to enforce posix semantics of unary +: result is numeric. + +Fix array.c to not rearrange the hash chain upon finding an index in +the array. This messed things up in cases like: + for (index1 in array) { + blah + if (index2 in array) # blew away the for + stuff + } + +Fixed spelling errors in the man page. + +Fixes in awk.y so that + gawk '' /path/to/file +will work without core dumping or finding parse errors. + +Fix main.c so that --lint will fuss about an empty program. +Yet another fix for argument parsing in the case of unrecognized options. + +Bug fix in dfa.c to not attempt to free null pointers. + +Bug fix in builtin.c to only use DEFAULT_G_PRECISION for %g or %G. + +Bug fix in field.c to achieve call by value semantics for split. + +Changes from 2.15.3 to 2.15.4 +----------------------------- + +Lots of lint fixes, and do_sprintf made mostly ANSI C compatible. + +Man page updated and edited. + +Copyrights updated. + +Arrays now grow dynamically, initially scaling up by an order of magnitude + and then doubling, up to ~ 64K. This should keep gawk's performance + graceful under heavy load. + +New `delete array' feature added. Only documented in the man page. + +Switched to dfa and regex suites from grep-2.0. These offer the ability to + move to POSIX regexps in the next release. + +Disabled GNU regex ops. + +Research awk -m option now recognized. It does nothing in gawk, since gawk + has no static limits. Only documented in the man page. + +New bionic (faster, better, stronger than before) hashing function. + +Bug fix in argument handling. `gawk -X' now notices there was no program. + Additional bug fixes to make --compat and --lint work again. + +Many changes for systems where sizeof(int) != sizeof(void *). + +Add explicit alloca(0) in io.c to recover space from C alloca. + +Fixed file descriptor leak in io.c. + +The --version option now follows the GNU coding standards and exits. + +Fixed several prototypes in protos.h. + +Several tests updated. On Solaris, warn that the out? tests will fail. + +Configuration files for SunOS with cc and Solaris 2.x added. + +Improved error messages in awk.y on gawk extensions if do_unix or do_compat. + +INSTALL file added. + +Fixed Atari Makefile and several VMS specific changes. + +Better conversion of numbers to strings on systems with broken sprintfs. + +Changes from 2.15.2 to 2.15.3 +----------------------------- + +Increased HASHSIZE to a decent number, 127 was way too small. + +FILENAME is now the null string in a BEGIN rule. + +Argument processing fixed for invalid options and missing arguments. + +This version will build on VMS. This included a fix to close all files + and pipes opened with redirections before closing stdout and stderr. + +More getpgrp() defines. + +Changes for BSD44: <sys/param.h> in io.c and Makefile.bsd44. + +All directories in the distribution are now writable. + +Separated LDFLAGS and CFLAGS in Makefile. CFLAGS can now be overridden by + user. + +Make dist now builds compressed archives ending in .gz and runs doschk. + +Amiga port. + +New getopt.c fixes Alpha OSF/1 problem. + +Make clean now removes possible test output. + +Improved algorithm for multiple adjacent string concatenations leads to + performance improvements. + +Fix nasty bug whereby command-line assignments, both with -v and at run time, + could create variables with syntactically illegal names. + +Fix obscure bug in printf with %0 flag and filling. + +Add a lint check for substr if provided length exceeds remaining characters + in string. + +Update atari support. + +PC support enhanced to include support for both DOS and OS/2. (Lots more + #ifdefs. Sigh.) + +Config files for Hitachi Unix and OSF/1, courtesy of Yoko Morishita + (morisita@sra.co.jp) + +Changes from 2.15.1 to 2.15.2 +----------------------------- + +Additions to the FUTURES file. + +Document undefined order of output when using both standard output + and /dev/stdout or any of the /dev output files that gawk emulates in + the absence of OS support. + +Clean up the distribution generation in Makefile.in: the info files are + now included, the distributed files are marked read-only and patched + distributions are now unpacked in a directory named with the patch level. + +Changes from 2.15 to 2.15.1 +--------------------------- + +Close stdout and stderr before all redirections on program exit. This allows + detection of write errors and also fixes the messages test on Solaris 2.x. + +Removed YYMAXDEPTH define in awk.y which was limiting the parser stack depth. + +Changes to config/bsd44, Makefile.bsd44 and configure to bring it into line + with the BSD4.4 release. + +Changed Makefile to use prefix, exec_prefix, bindir etc. + +make install now installs info files. + +make install now sets permissions on installed files. + +Make targets added: uninstall, distclean, mostlyclean and realclean. + +Added config.h to cleaner and clobber make targets. + +Changes to config/{hpux8x,sysv3,sysv4,ultrix41} to deal with alloca(). + +Change to getopt.h for portability. + +Added more special cases to the getpgrp() call. + +Added README.ibmrt-aos and config/ibmrt-aos. + +Changes from 2.14 to 2.15 +--------------------------- + +Command-line source can now be mixed with library functions. + +ARGIND variable tracks index in ARGV of FILENAME. + +GNU style long options in addition to short options. + +Plan 9 style special files interpreted by gawk: + /dev/pid + /dev/ppid + /dev/pgrpid + /dev/user + $1 = getuid + $2 = geteuid + $3 = getgid + $4 = getegid + $5 ... $NF = getgroups if supported + +ERRNO variable contains error string if getline or close fails. + +Very old options -a and -e have gone away. + +Inftest has been removed from the default target in test/Makefile -- the + results were too machine specific and resulted in too many false alarms. + +A README.amiga has been added. + +The "too many arguments supplied for format string" warning message is only + in effect under the lint option. + +Code improvements in dfa.c. + +Fixed all reported bugs: + + Writes are checked for failure (such as full filesystem). + + Stopped (at least some) runaway error messages. + + gsub(/^/, "x") does the right thing for $0 of 0, 1, or more length. + + close() on a command being piped to a getline now works properly. + + The input record will no longer be freed upon an explicit close() + of the input file. + + A NUL character in FS now works. + + In a substitute, \\& now means a literal backslash followed by what + was matched. + + Integer overflow of substring length in substr() is caught. + + An input record without a newline termination is handled properly. + + In io.c, check is against only EMFILE so that system file table + is not filled. + + Renamed all files with names longer than 14 characters. + + Escaped characters in regular expressions were being lost when + IGNORECASE was used. + + Long source lines were not being handled properly. + + Sourcefiles that ended in a tab but no newline were bombing. + + Patterns that could match zero characters in split() were not working + properly. + + The parsedebug option was not working. + + The grammar was being a bit too lenient, allowing some very dubious + programs to pass. + + Compilation with DEBUG defined now works. + + A variable read in with getline was not being treated as a potential + number. + + Array subscripts were not always of string type. + + +Changes from 2.13.2 to 2.14 +--------------------------- + +Updated manual! + +Added "next file" to skip efficiently to the next input file. + +Fixed potential of overflowing buffer in do_sprintf(). + +Plugged small memory leak in sub_common(). + +EOF on a redirect is now "sticky" -- it can only be cleared by close()ing + the pipe or file. + +Now works if used via a #! /bin/gawk line at the top of an executable file + when that line ends with whitespace. + +Added some checks to the grammar to catch redefinition of builtin functions. + This could eventually be the basis for an extension to allow redefining + functions, but in the mean time it's a good error catching facility. + +Negative integer exponents now work. + +Modified do_system() to make sure it had a non-null string to be passed + to system(3). Thus, system("") will flush any pending output but not go + through the overhead of forking an un-needed shell. + +A fix to floating point comparisons so that NaNs compare right on IEEE systems. + +Added code to make sure we're not opening directories for reading and such. + +Added code to do better diagnoses of weird or null file names. + +Allow continue outside of a loop, unless in strict posix mode. Lint option + will issue warning. + +New missing/strftime.c. There has been one change that affects gawk. Posix + now defines a %V conversion so the vms conversion has been changed to %v. + If this version is used with gawk -Wlint and they use %V in a call to + strftime, they'll get a warning. + +Error messages now conform to GNU standard (I hope). + +Changed comparisons to conform to the description found in the file POSIX. + This is inconsistent with the current POSIX draft, but that is broken. + Hopefully the final POSIX standard will conform to this version. + (Alas, this will have to wait for 1003.2b, which will be a revision to + the 1003.2 standard. That standard has been frozen with the broken + comparison rules.) + +The length of a string was a short and now is a size_t. + +Updated VMS help. + +Added quite a few new tests to the test suite and deleted many due to lack of + written releases. Test output is only removed if it is identical to the + "good" output. + +Fixed a couple of bugs for reference to $0 when $0 is "" -- particularly in + a BEGIN block. + +Fixed premature freeing in construct "$0 = $0". + +Removed the call to wait_any() in gawk_popen(), since on at least some systems, + if gawk's input was from a pipe, the predecessor process in the pipe was a + child of gawk and this caused a deadlock. + +Regexp can (once again) match a newline, if given explicitly. + +nextopen() makes sure file name is null terminated. + +Fixed VMS pipe simulation. Improved VMS I/O performance. + +Catch . used in variable names. + +Fixed bug in getline without redirect from a file -- it was quitting after the + first EOF, rather than trying the next file. + +Fixed bug in treatment of backslash at the end of a string -- it was bombing + rather than doing something sensible. It is not clear what this should mean, + but for now I issue a warning and take it as a literal backslash. + +Moved setting of regexp syntax to before the option parsing in main(), to + handle things like -v FS='[.,;]' + +Fixed bug when NF is set by user -- fields_arr must be expanded if necessary + and "new" fields must be initialized. + +Fixed several bugs in [g]sub() for no match found or the match is 0-length. + +Fixed bug where in gsub() a pattern anchored at the beginning would still + substitute throughout the string. + +make test does not assume that . is in PATH. + +Fixed bug when a field beyond the end of the record was requested after + $0 was altered (directly or indirectly). + +Fixed bug for assignment to field beyond end of record -- the assigned value + was not found on subsequent reference to that field. + +Fixed bug for FS a regexp and it matches at the end of a record. + +Fixed memory leak for an array local to a function. + +Fixed hanging of pipe redirection to getline + +Fixed coredump on access to $0 inside BEGIN block. + +Fixed treatment of RS = "". It now parses the fields correctly and strips + leading whitespace from a record if FS is a space. + +Fixed faking of /dev/stdin. + +Fixed problem with x += x + +Use of scalar as array and vice versa is now detected. + +IGNORECASE now obeyed for FS (even if FS is a single alphabetic character). + +Switch to GPL version 2. + +Renamed awk.tab.c to awktab.c for MSDOS and VMS tar programs. + +Renamed this file (CHANGES) to NEWS. + +Use fmod() instead of modf() and provide FMOD_MISSING #define to undo + this change. + +Correct the volatile declarations in eval.c. + +Avoid errant closing of the file descriptors for stdin, stdout and stderr. + +Be more flexible about where semi-colons can occur in programs. + +Check for write errors on all output, not just on close(). + +Eliminate the need for missing/{strtol.c,vprintf.c}. + +Use GNU getopt and eliminate missing/getopt.c. + +More "lint" checking. + + +Changes from 2.13.1 to 2.13.2 +----------------------------- + +Toward conformity with GNU standards, configure is a link to mkconf, the latter + to disappear in the next major release. + +Update to config/bsd43. + +Added config/apollo, config/msc60, config/cray2-50, config/interactive2.2 + +sgi33.cc added for compilation using cc rather than gcc. + +Ultrix41 now propagates to config.h properly -- as part of a general + mechanism in configure for kludges -- #define anything from a config file + just gets tacked onto the end of config.h -- to be used sparingly. + +Got rid of an unnecessary and troublesome declaration of vprintf(). + +Small improvement in locality of error messages. + +Try to diagnose use of array as scalar and vice versa -- to be improved in + the future. + +Fix for last bug fix for Cray division code--sigh. + +More changes to test suite to explicitly use sh. Also get rid of + a few generated files. + +Fixed off-by-one bug in string concatenation code. + +Fix for use of array that is passed in from a previous function parameter. + Addition to test suite for above. + +A number of changes associated with changing NF and access to fields + beyond the end of the current record. + +Change to missing/memcmp.c to avoid seg. fault on zero length input. + +Updates to test suite (including some inadvertently left out of the last patch) + to invoke sh explicitly (rather than rely on #!/bin/sh) and remove some + junk files. test/chem/good updated to correspond to bug fixes. + +Changes from 2.13.0 to 2.13.1 +----------------------------- + +More configs and PORTS. + +Fixed bug wherein a simple division produced an erroneous FPE, caused by + the Cray division workaround -- that code is now #ifdef'd only for + Cray *and* fixed. + +Fixed bug in modulus implementation -- it was very close to the above + code, so I noticed it. + +Fixed portability problem with limits.h in missing.c + +Fixed portability problem with tzname and daylight -- define TZNAME_MISSING + if strftime() is missing and tzname is also. + +Better support for Latin-1 character set. + +Fixed portability problem in test Makefile. + +Updated PROBLEMS file. + +=============================== gawk-2.13 released ========================= +Changes from 2.12.42 to 2.12.43 +------------------------------- + +Typo in awk.y + +Fixed up strftime.3 and added doc. for %V. + +Changes from 2.12.41 to 2.12.42 +------------------------------- + +Fixed bug in devopen() -- if you had write permission in /dev, + it would just create /dev/stdout etc.!! + +Final (?) VMS update. + +Make NeXT use GFMT_WORKAROUND + +Fixed bug in sub_common() for substitute on zero-length match. Improved the + code a bit while I was at it. + +Fixed grammar so that $i++ parses as ($i)++ + +Put support/* back in the distribution (didn't I already do this?!) + +Changes from 2.12.40 to 2.12.41 +------------------------------- + +VMS workaround for broken %g format. + +Changes from 2.12.39 to 2.12.40 +------------------------------- + +Minor man page update. + +Fixed latent bug in redirect(). + +Changes from 2.12.38 to 2.12.39 +------------------------------- + +Updates to test suite -- remove dependence on changing gawk.1 man page. + +Changes from 2.12.37 to 2.12.38 +------------------------------- + +Fixed bug in use of *= without whitespace following. + +VMS update. + +Updates to man page. + +Option handling updates in main.c + +test/manyfiles redone and added to bigtest. + +Fixed latent (on Sun) bug in handling of save_fs. + +Changes from 2.12.36 to 2.12.37 +------------------------------- + +Update REL in Makefile-dist. Incorporate test suite into main distribution. + +Minor fix in regtest. + +Changes from 2.12.35 to 2.12.36 +------------------------------- + +Release takes on dual personality -- 2.12.36 and 2.13.0 -- any further + patches before public release won't count for 2.13, although they will for + 2.12 -- be careful to avoid confusion! patchlevel.h will be the last thing + to change. + +Cray updates to deal with arithmetic problems. + +Minor test suite updates. + +Fixed latent bug in parser (freeing memory). + +Changes from 2.12.34 to 2.12.35 +------------------------------- + +VMS updates. + +Flush stdout at top of err() and stderr at bottom. + +Fixed bug in eval_condition() -- it wasn't testing for MAYBE_NUM and + doing the force_number(). + +Included the missing manyfiles.awk and a new test to catch the above bug which + I am amazed wasn't already caught by the test suite -- it's pretty basic. + +Changes from 2.12.33 to 2.12.34 +------------------------------- + +Atari updates -- including bug fix. + +More VMS updates -- also nuke vms/version.com. + +Fixed bug in handling of large numbers of redirections -- it was probably never + tested before (blush!). + +Minor rearrangement of code in r_force_number(). + +Made chem and regtest tests a bit more portable (Ultrix again). + +Added another test -- manyfiles -- not invoked under any other test -- very Unix + specific. + +Rough beginning of LIMITATIONS file -- need my AWK book to complete it. + +Changes from 2.12.32 to 2.12.33 +------------------------------- + +Expunge debug.? from various files. + +Remove vestiges of Floor and Ceil kludge. + +Special case integer division -- mainly for Cray, but maybe someone else + will benefit. + +Workaround for iop_close closing an output pipe descriptor on Cray -- + not conditional since I think it may fix a bug on SGI as well and I don't + think it can hurt elsewhere. + +Fixed memory leak in assoc_lookup(). + +Small cleanup in test suite. + +Changes from 2.12.31 to 2.12.32 +------------------------------- + +Nuked debug.c and debugging flag -- there are better ways. + +Nuked version.sh and version.c in subdirectories. + +Fixed bug in handling of IGNORECASE. + +Fixed bug when FIELDWIDTHS was set via -v option. + +Fixed (obscure) bug when $0 is assigned a numerical value. + +Fixed so that escape sequences in command-line assignments work (as it already + said in the comment). + +Added a few cases to test suite. + +Moved support/* back into distribution. + +VMS updates. + +Changes from 2.12.30 to 2.12.31 +------------------------------- + +Cosmetic manual page changes. + +Updated sunos3 config. + +Small changes in test suite including renaming files over 14 chars. in length. + +Changes from 2.12.29 to 2.12.30 +------------------------------- + +Bug fix for many string concatenations in a row. + +Changes from 2.12.28 to 2.12.29 +------------------------------- + +Minor cleanup in awk.y + +Minor VMS update. + +Minor atari update. + +Changes from 2.12.27 to 2.12.28 +------------------------------- + +Got rid of the debugging goop in eval.c -- there are better ways. + +Sequent port. + +VMS changes left out of the last patch -- sigh! config/vms.h renamed + to config/vms-conf.h. + +Fixed missing/tzset.c + +Removed use of gcvt() and GCVT_MISSING -- turns out it was no faster than + sprintf("%g") and caused all sorts of portability headaches. + +Tuned get_field() -- it was unnecessarily parsing the whole record on reference + to $0. + +Tuned interpret() a bit in the rule_node loop. + +In r_force_number(), worked around bug in Uglix strtod() and got rid of + ugly do{}while(0) at Michal's urging. + +Replaced do_deref() and deref with unref(node) -- much cleaner and a bit faster. + +Got rid of assign_number() -- contrary to comment, it was no faster than + just making a new node and freeing the old one. + +Replaced make_number() and tmp_number() with macros that call mk_number(). + +Changed freenode() and newnode() into macros -- the latter is getnode() + which calls more_nodes() as necessary. + +Changes from 2.12.26 to 2.12.27 +------------------------------- + +Completion of Cray 2 port (includes a kludge for floor() and ceil() + that may go or be changed -- I think that it may just be working around + a bug in chem that is being tweaked on the Cray). + +More VMS updates. + +Moved kludge over yacc's insertion of malloc and realloc declarations + from protos.h to the Makefile. + +Added a lisp interpreter in awk to the test suite. (Invoked under + bigtest.) + +Cleanup in r_force_number() -- I had never gotten around to a thorough + profile of the cache code and it turns out to be not worth it. + +Performance boost -- do lazy force_number()'ing for fields etc. i.e. + flag them (MAYBE_NUM) and call force_number only as necessary. + +Changes from 2.12.25 to 2.12.26 +------------------------------- + +Rework of regexp stuff so that dynamic regexps have reasonable + performance -- string used for compiled regexp is stored and + compared to new string -- if same, no recompilation is necessary. + Also, very dynamic regexps cause dfa-based searching to be turned + off. + +Code in dev_open() is back to returning fileno(std*) rather than + dup()ing it. This will be documented. Sorry for the run-around + on this. + +Minor atari updates. + +Minor vms update. + +Missing file from MSDOS port. + +Added warning (under lint) if third arg. of [g]sub is a constant and + handle it properly in the code (i.e. return how many matches). + +Changes from 2.12.24 to 2.12.25 +------------------------------- + +MSDOS port. + +Non-consequential changes to regexp variables in preparation for + a more serious change to fix a serious performance problem. + +Changes from 2.12.23 to 2.12.24 +------------------------------- + +Fixed bug in output flushing introduced a few patches back. This caused + serious performance losses. + +Changes from 2.12.22 to 2.12.23 +------------------------------- + +Accidentally left config/cray2-60 out of last patch. + +Added some missing dependencies to Makefile. + +Cleaned up mkconf a bit; made yacc the default parser (no alloca needed, + right?); added rs6000 hook for signed characters. + +Made regex.c with NO_ALLOCA undefined work. + +Fixed bug in dfa.c for systems where free(NULL) bombs. + +Deleted a few cant_happen()'s that *really* can't hapen. + +Changes from 2.12.21 to 2.12.22 +------------------------------- + +Added to config stuff the ability to choose YACC rather than bison. + +Fixed CHAR_UNSIGNED in config.h-dist. + +Second arg. of strtod() is char ** rather than const char **. + +stackb is now initially malloc()'ed since it may be realloc()'ed. + +VMS updates. + +Added SIZE_T_MISSING to config stuff and a default typedef to awk.h. + (Maybe it is not needed on any current systems??) + +re_compile_pattern()'s size is now size_t unconditionally. + +Changes from 2.12.20 to 2.12.21 +------------------------------- + +Corrected missing/gcvt.c. + +Got rid of use of dup2() and thus DUP_MISSING. + +Updated config/sgi33. + +Turned on (and fixed) in cmp_nodes() the behaviour that I *hope* will be in + POSIX 1003.2 for relational comparisons. + +Small updates to test suite. + +Changes from 2.12.19 to 2.12.20 +------------------------------- + +Sloppy, sloppy, sloppy!! I didn't even try to compile the last two + patches. This one fixes goofs in regex.c. + +Changes from 2.12.18 to 2.12.19 +------------------------------- + +Cleanup of last patch. + +Changes from 2.12.17 to 2.12.18 +------------------------------- + +Makefile renamed to Makefile-dist. + +Added alloca() configuration to mkconf. (A bit kludgey.) Just + add a single line containing ALLOCA_PW, ALLOCA_S or ALLOCA_C + to the appropriate config file to have Makefile-dist edited + accordingly. + +Reorganized output flushing to correspond with new semantics of + devopen() on "/dev/std*" etc. + +Fixed rest of last goof!! + +Save and restore errno in do_pathopen(). + +Miscellaneous atari updates. + +Get rid of the trailing comma in the NODETYPE definition (Cray + compiler won't take it). + +Try to make the use of `const' consistent since Cray compiler is + fussy about that. See the changes to `basename' and `myname'. + +It turns out that, according to section 3.8.3 (Macro Replacement) + of the ANSI Standard: ``If there are sequences of preprocessing + tokens within the list of arguments that would otherwise act as + preprocessing directives, the behavior is undefined.'' That means + that you cannot count on the behavior of the declaration of + re_compile_pattern in awk.h, and indeed the Cray compiler chokes on it. + +Replaced alloca with malloc/realloc/free in regex.c. It was much simpler + than expected. (Inside NO_ALLOCA for now -- by default no alloca.) + +Added a configuration file, config/cray60, for Unicos-6.0. + +Changes from 2.12.16 to 2.12.17 +------------------------------- + +Ooops. Goofed signal use in last patch. + +Changes from 2.12.15 to 2.12.16 +------------------------------- + +RENAMED *_dir to just * (e.g. missing_dir). + +Numerous VMS changes. + +Proper inclusion of atari and vms files. + +Added experimental (ifdef'd out) RELAXED_CONTINUATION and DEFAULT_FILETYPE + -- please comment on these! + +Moved pathopen() to io.c (sigh). + +Put local directory ahead in default AWKPATH. + +Added facility in mkconf to echo comments on stdout: lines beginning + with "#echo " will have the remainder of the line echoed when mkconf is run. + Any lines starting with "#" will otherwise be treated as comments. The + intent is to be able to say: + "#echo Make sure you uncomment alloca.c in the Makefile" + or the like. + +Prototype fix for V.4 + +Fixed version_string to not print leading @(#). + +Fixed FIELDWIDTHS to work with strict (turned out to be easy). + +Fixed conf for V.2. + +Changed semantics of /dev/fd/n to be like on real /dev/fd. + +Several configuration and updates in the makefile. + +Updated manpage. + +Include tzset.c and system.c from missing_dir that were accidently left out of + the last patch. + +Fixed bug in cmdline variable assignment -- arg was getting freed(!) in + call to variable. + +Backed out of parse-time constant folding for now, until I can figure out + how to do it right. + +Fixed devopen() so that getline <"-" works. + +Changes from 2.12.14 to 2.12.15 +------------------------------- + +Changed config/* to a condensed form that can be used with mkconf to generate + a config.h from config.h-dist -- much easier to maintain. Please check + carefully against what you had before for a particular system and report + any problems. vms.h remains separate since the stuff at the bottom + didn't quite fit the mkconf model -- hopefully cleared up later. + +Fixed bug in grammar -- didn't allow function definition to be separated from + other rules by a semi-colon. + +VMS fix to #includes in missing.c -- should we just be including awk.h? + +Updated README for texinfo.tex version. + +Updating of copyright in all .[chy] files. + +Added but commented out Michal's fix to strftime. + +Added tzset() emulation based on Rick Adams' code. Added TZSET_MISSING to + config.h-dist. + +Added strftime.3 man page for missing_dir + +More posix: func, **, **= don't work in -W posix + +More lint: ^, ^= not in old awk + +gawk.1: removed ref to -DNO_DEV_FD, other minor updating. + +Style change: pushbak becomes pushback() in yylex(). + +Changes from 2.12.13 to 2.12.14 +------------------------------- + +Better (?) organization of awk.h -- attempt to keep all system dependencies + near the top and move some of the non-general things out of the config.h + files. + +Change to handling of SYSTEM_MISSING. + +Small change to ultrix config. + +Do "/dev/fd/*" etc. checking at runtime. + +First pass at VMS port. + +Improvements to error handling (when lexeme spans buffers). + +Fixed backslash handling -- why didn't I notice this sooner? + +Added programs from book to test suite and new target "bigtest" to Makefile. + +Changes from 2.12.12 to 2.12.13 +------------------------------- + +Recognize OFS and ORS specially so that OFS = 9 works without efficiency hit. + Took advantage of opportunity to tune do_print*() for about 10% win on a + print with 5 args (i.e. small but significant). + +Somewhat pervasive changes to reconcile CONVFMT vs. OFMT. + +Better initialization of builtin vars. + +Make config/* consistent wrt STRTOL_MISSING. + +Small portability improvement to alloca.s + +Improvements to lint code in awk.y + +Replaced strtol() with a better one by Chris Torek. + +Changes from 2.12.11 to 2.12.12 +------------------------------- + +Added PORTS file to record successful ports. + +Added #define const to nothing if not STDC and added const to strtod() header. + +Added * to printf capabilities and partially implemented ' ' and '+' (has an + effect for %d only, silently ignored for other formats). I'm afraid that's + as far as I want to go before I look at a complete replacement for + do_sprintf(). + +Added warning for /regexp/ on LHS of MATCHOP. + +Changes from 2.12.10 to 2.12.11 +------------------------------- + +Small Makefile improvements. + +Some remaining nits from the NeXT port. + +Got rid of bcopy() define in awk.h -- not needed anymore (??) + +Changed private in builtin.c -- it is special on Sequent. + +Added subset implementation of strtol() and STRTOL_MISSING. + +A little bit of cleanup in debug.c, dfa.c. + +Changes from 2.12.9 to 2.12.10 +------------------------------ + +Redid compatability checking and checking for # of args. + +Removed all references to variables[] from outside awk.y, in preparation + for a more abstract interface to the symbol table. + +Got rid of a remaining use of bcopy() in regex.c. + +Changes from 2.12.8 to 2.12.9 +----------------------------- + +Portability improvements for atari, next and decstation. + +Bug fix in substr() -- wasn't handling 3rd arg. of -1 properly. + +Manpage updates. + +Moved support from src release to doc release. + +Updated FUTURES file. + +Added some "lint" warnings. + +Changes from 2.12.7 to 2.12.8 +----------------------------- + +Changed time() to systime(). + +Changed warning() in snode() to fatal(). + +strftime() now defaults second arg. to current time. + +Changes from 2.12.6 to 2.12.7 +----------------------------- + +Fixed bug in sub_common() involving inadequate allocation of a buffer. + +Added some missing files to the Makefile. + +Changes from 2.12.5 to 2.12.6 +----------------------------- + +Fixed bug wherein non-redirected getline could call iop_close() just + prior to a call from do_input(). + +Fixed bug in handling of /dev/stdout and /dev/stderr. + +Changes from 2.12.4 to 2.12.5 +----------------------------- + +Updated README and support directory. + +Changes from 2.12.3 to 2.12.4 +----------------------------- + +Updated CHANGES and TODO (should have been done in previous 2 patches). + +Changes from 2.12.2 to 2.12.3 +----------------------------- + +Brought regex.c and alloca.s into line with current FSF versions. + +Changes from 2.12.1 to 2.12.2 +----------------------------- + +Portability improvements; mostly moving system prototypes out of awk.h + +Introduction of strftime. + +Use of CONVFMT. + +Changes from 2.12 to 2.12.1 +----------------------------- + +Consolidated treatment of command-line assignments (thus correcting the +-v treatment). + +Rationalized builtin-variable handling into a table-driven process, thus +simplifying variable() and eliminating spc_var(). + +Fixed bug in handling of command-line source that ended in a newline. + +Simplified install() and lookup(). + +Did away with double-mallocing of identifiers and now free second and later +instances of a name, after the first gets installed into the symbol table. + +Treat IGNORECASE specially, simplifying a lot of code, and allowing +checking against strict conformance only on setting it, rather than on each +pattern match. + +Fixed regexp matching when IGNORECASE is non-zero (broken when dfa.c was +added). + +Fixed bug where $0 was not being marked as valid, even after it was rebuilt. +This caused mangling of $0. + + +Changes from 2.11.1 to 2.12 +----------------------------- + +Makefile: + +Portability improvements in Makefile. +Move configuration stuff into config.h + +FSF files: + +Synchronized alloca.[cs] and regex.[ch] with FSF. + +array.c: + +Rationalized hash routines into one with a different algorithm. +delete() now works if the array is a local variable. +Changed interface of assoc_next() and avoided dereferencing past the end of the + array. + +awk.h: + +Merged non-prototype and prototype declarations in awk.h. +Expanded tree_eval #define to short-circuit more calls of r_tree_eval(). + +awk.y: + +Delinted some of the code in the grammar. +Fixed and improved some of the error message printing. +Changed to accomodate unlimited length source lines. +Line continuation now works as advertised. +Source lines can be arbitrarily long. +Refined grammar hacks so that /= assignment works. Regular expressions + starting with /= are recognized at the beginning of a line, after && or || + and after ~ or !~. More contexts can be added if necessary. +Fixed IGNORECASE (multiple scans for backslash). +Condensed expression_lists in array references. +Detect and warn for correct # args in builtin functions -- call most of them + with a fixed number (i.e. fill in defaults at parse-time rather than at + run-time). +Load ENVIRON only if it is referenced (detected at parse-time). +Treat NF, FS, RS, NR, FNR specially at parse time, to improve run time. +Fold constant expressions at parse time. +Do make_regexp() on third arg. of split() at parse tiem if it is a constant. + +builtin.c: + +srand() returns 0 the first time called. +Replaced alloca() with malloc() in do_sprintf(). +Fixed setting of RSTART and RLENGTH in do_match(). +Got rid of get_{one,two,three} and allowance for variable # of args. at + run-time -- this is now done at parse-time. +Fixed latent bug in [g]sub whereby changes to $0 would never get made. +Rewrote much of sub_common() for simplicity and performance. +Added ctime() and time() builtin functions (unless -DSTRICT). ctime() returns + a time string like the C function, given the number of seconds since the epoch + and time() returns the current time in seconds. +do_sprintf() now checks for mismatch between format string and number of + arguments supplied. + +dfa.c + +This is borrowed (almost unmodified) from GNU grep to provide faster searches. + +eval.c + +Node_var, Node_var_array and Node_param_list handled from macro rather + than in r_tree_eval(). +Changed cmp_nodes() to not do a force_number() -- this, combined with a + force_number() on ARGV[] and ENVIRON[] brings it into line with other awks +Greatly simplified cmp_nodes(). +Separated out Node_NF, Node_FS, Node_RS, Node_NR and Node_FNR in get_lhs(). +All adjacent string concatenations now done at once. + +field.c + +Added support for FIELDWIDTHS. +Fixed bug in get_field() whereby changes to a field were not always + properly reflected in $0. +Reordered tests in parse_field() so that reference off the end of the buffer + doesn't happen. +set_FS() now sets *parse_field i.e. routine to call depending on type of FS. +It also does make_regexp() for FS if needed. get_field() passes FS_regexp + to re_parse_field(), as does do_split(). +Changes to set_field() and set_record() to avoid malloc'ing and free'ing the + field nodes repeatedly. The fields now just point into $0 unless they are + assigned to another variable or changed. force_number() on the field is + *only* done when the field is needed. + +gawk.1 + +Fixed troff formatting problem on .TP lines. + +io.c + +Moved some code out into iop.c. +Output from pipes and system() calls is properly synchronized. +Status from pipe close properly returned. +Bug in getline with no redirect fixed. + +iop.c + +This file contains a totally revamped get_a_record and associated code. + +main.c + +Command line programs no longer use a temporary file. +Therefore, tmpnam() no longer required. +Deprecated -a and -e options -- they will go away in the next release, + but for now they cause a warning. +Moved -C, -V, -c options to -W ala posix. +Added -W posix option: throw out \x +Added -W lint option. + + +node.c + +force_number() now allows pure numerics to have leading whitespace. +Added make_string facility to optimize case of adding an already malloc'd + string. +Cleaned up and simplified do_deref(). +Fixed bug in handling of stref==255 in do_deref(). + +re.c + +contains the interface to regexp code + +Changes from 2.11.1 to FSF version of same +------------------------------------------ +Thu Jan 4 14:19:30 1990 Jim Kingdon (kingdon at albert) + + * Makefile (YACC): Add -y to bison part. + + * missing.c: Add #include <stdio.h>. + +Sun Dec 24 16:16:05 1989 David J. MacKenzie (djm at hobbes.ai.mit.edu) + + * Makefile: Add (commented out) default defines for Sony News. + + * awk.h: Move declaration of vprintf so it will compile when + -DVPRINTF_MISSING is defined. + +Mon Nov 13 18:54:08 1989 Robert J. Chassell (bob at apple-gunkies.ai.mit.edu) + + * gawk.texinfo: changed @-commands that are not part of the + standard, currently released texinfmt.el to those that are. + Otherwise, only people with the as-yet unreleased makeinfo.c can + format this file. + +Changes from 2.11beta to 2.11.1 (production) +-------------------------------------------- + +Went from "beta" to production status!!! + +Now flushes stdout before closing pipes or redirected files to +synchronize output. + +MS-DOS changes added in. + +Signal handler return type parameterized in Makefile and awk.h and +some lint removed. debug.c cleaned up. + +Fixed FS splitting to never match null strings, per book. + +Correction to the manual's description of FS. + +Some compilers break on char *foo = "string" + 4 so fixed version.sh and +main.c. + +Changes from 2.10beta to 2.11beta +--------------------------------- + +This release fixes all reported bugs that we could reproduce. Probably +some of the changes are not documented here. + +The next release will probably not be a beta release! + +The most important change is the addition of the -nostalgia option. :-) + +The documentation has been improved and brought up-to-date. + +There has been a lot of general cleaning up of the code that is not otherwise +documented here. There has been a movement toward using standard-conforming +library routines and providing them (in missing.d) for systems lacking them. +Improved (hopefully) configuration through Makfile modifications and missing.c. +In particular, straightened out confusion over vprintf #defines, declarations +etc. + +Deleted RCS log comments from source, to reduce source size by about one third. +Most of them were horribly out-of-date, anyway. + +Renamed source files to reflect (for the most part) their contents. + +More and improved error messages. Cleanup and fixes to yyerror(). +String constants are not altered in input buffer, so error messages come out +better. Fixed usage message. Make use of ANSI C strerror() function +(provided). + +Plugged many more memory leaks. The memory consumption is now quite +reasonable over a wide range of programs. + +Uses volatile declaration if STDC > 0 to avoid problems due to longjmp. + +New -a and -e options to use awk or egrep style regexps, respectively, +since POSIX says awk should use egrep regexps. Default is -a. + +Added -v option for setting variables before the first file is encountered. +Version information now uses -V and copyleft uses -C. + +Added a patchlevel.h file and its use for -V and -C. + +Append_right() optimized for major improvement to programs with a *lot* +of statements. + +Operator precedence has been corrected to match draft Posix. + +Tightened up grammar for builtin functions so that only length +may be called without arguments or parentheses. + +/regex/ is now a normal expression that can appear in any expression +context. + +Allow /= to begin a regexp. Allow ..[../..].. in a regexp. + +Allow empty compound statements ({}). + +Made return and next illegal outside a function and in BEGIN/END respectively. + +Division by zero is now illegal and causes a fatal error. + +Fixed exponentiation so that x ^ 0 and x ^= 0 both return 1. + +Fixed do_sqrt, do_log, and do_exp to do argument/return checking and +print an error message, per the manual. + +Fixed main to catch SIGSEGV to get source and data file line numbers. + +Fixed yyerror to print the ^ at the beginning of the bad token, not the end. + +Fix to substr() builtin: it was failing if the arguments +weren't already strings. + +Added new node value flag NUMERIC to indicate that a variable is +purely a number as opposed to type NUM which indicates that +the node's numeric value is valid. This is set in make_number(), +tmp_number and r_force_number() when appropriate and used in +cmp_nodes(). This fixed a bug in comparison of variables that had +numeric prefixes. The new code uses strtod() and eliminates is_a_number(). +A simple strtod() is provided for systems lacking one. It does no +overflow checking, so could be improved. + +Simplification and efficiency improvement in force_string. + +Added performance tweak in r_force_number(). + +Fixed a bug with nested loops and break/continue in functions. + +Fixed inconsistency in handling of empty fields when $0 has to be rebuilt. +Happens to simplify rebuild_record(). + +Cleaned up the code associated with opening a pipe for reading. Gawk +now has its own popen routine (gawk_popen) that allocates an IOBUF +and keeps track of the pid of the child process. gawk_pclose +marks the appropriate child as defunct in the right struct redirect. + +Cleaned up and fixed close_redir(). + +Fixed an obscure bug to do with redirection. Intermingled ">" and ">>" +redirects did not output in a predictable order. + +Improved handling of output buffering: now all print[f]s redirected to a tty +or pipe are flushed immediately and non-redirected output to a tty is flushed +before the next input record is read. + +Fixed a bug in get_a_record() where bcopy() could have copied over +a random pointer. + +Fixed a bug when RS="" and records separated by multiple blank lines. + +Got rid of SLOWIO code which was out-of-date anyway. + +Fix in get_field() for case where $0 is changed and then $(n) are +changed and then $0 is used. + +Fixed infinite loop on failure to open file for reading from getline. +Now handles redirect file open failures properly. + +Filenames such as /dev/stdin now allowed on the command line as well as +in redirects. + +Fixed so that gawk '$1' where $1 is a zero tests false. + +Fixed parsing so that `RLENGTH -1' parses the same as `RLENGTH - 1', +for example. + +The return from a user-defined function now defaults to the Null node. +This fixes a core-dump-causing bug when the return value of a function +is used and that function returns no value. + +Now catches floating point exceptions to avoid core dumps. + +Bug fix for deleting elements of an array -- under some conditions, it was +deleting more than one element at a time. + +Fix in AWKPATH code for running off the end of the string. + +Fixed handling of precision in *printf calls. %0.2d now works properly, +as does %c. [s]printf now recognizes %i and %X. + +Fixed a bug in printing of very large (>240) strings. + +Cleaned up erroneous behaviour for RS == "". + +Added IGNORECASE support to index(). + +Simplified and fixed newnode/freenode. + +Fixed reference to $(anything) in a BEGIN block. + +Eliminated use of USG rand48(). + +Bug fix in force_string for machines with 16-bit ints. + +Replaced use of mktemp() with tmpnam() and provided a partial implementation of +the latter for systems that don't have it. + +Added a portability check for includes in io.c. + +Minor portability fix in alloc.c plus addition of xmalloc(). + +Portability fix: on UMAX4.2, st_blksize is zero for a pipe, thus breaking +iop_alloc() -- fixed. + +Workaround for compiler bug on Sun386i in do_sprintf. + +More and improved prototypes in awk.h. + +Consolidated C escape parsing code into one place. + +strict flag is now turned on only when invoked with compatability option. +It now applies to fewer things. + +Changed cast of f._ptr in vprintf.c from (unsigned char *) to (char *). +Hopefully this is right for the systems that use this code (I don't). + +Support for pipes under MSDOS added. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/PROBLEMS b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/PROBLEMS new file mode 100644 index 0000000..072d56e --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/PROBLEMS @@ -0,0 +1,15 @@ + Copyright (C) 2005, 2006 Free Software Foundation, Inc. + + Copying and distribution of this file, with or without modification, + are permitted in any medium without royalty provided the copyright + notice and this notice are preserved. + +This is a list of known problems in gawk 3.1. +I don't know when this will be fixed, if ever. See also FUTURES +and the gawk.texi doc for other things that need doing. + +1. The interactions with the lexer and yyerror need reworking. It is possible + to get line numbers that are one line off if --compat or --posix is + true and either `nextfile' or `delete array' are used. + + Really the whole lexical analysis stuff needs reworking. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README new file mode 100644 index 0000000..1206429 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README @@ -0,0 +1,113 @@ + Copyright (C) 2005, 2006, 2007 Free Software Foundation, Inc. + + Copying and distribution of this file, with or without modification, + are permitted in any medium without royalty provided the copyright + notice and this notice are preserved. + +README: + +This is GNU Awk 3.1.6. It is upwardly compatible with the Bell Labs +research version of awk. It is almost completely compliant with the +2004 POSIX 1003.1 standard for awk. (See the note below about POSIX.) + +This is a bug fix release. See NEWS and ChangeLog for details. + +Work to be done is described briefly in the FUTURES file. Changes in this +version are summarized in the NEWS file. Please read the LIMITATIONS file. + +Read the file POSIX.STD for a discussion of issues where the standard +says one thing but gawk does something different. + +To format the documentation with TeX, use at least version 2000-10-27.17 +of texinfo.tex. There is a usable copy of texinfo.tex in the doc directory. + +INSTALLATION: + +Check whether there is a system-specific README file for your system under +the `README_d' directory. If there's something there that you should +have read and didn't, and you bug me about it, I'm going to yell at you. + +See the file INSTALL for installation instructions. + +If you have neither bison nor yacc, use the awkgram.c file here. It was +generated with bison, and has no proprietary code in it. (Note that +modifying awkgram.y without bison or yacc will be difficult, at best. +You might want to get a copy of bison from the FSF too.) + +If you have a Windows32, MS-DOS or OS/2 system, use the stuff in the `pc' +directory. Similarly, there is a separate directory for VMS. + +Ports for the Atari and old Tandem systems are supplied, but they are +unsupported. Thus, their code appears in the `unsupported' directory. + +Appendix B of ``GAWK: Effective Awk Programming'' discusses configuration +in detail. The configuration process is based on GNU Autoconf and +Automake. + +After successful compilation, do `make check' to run the test suite. +There should be no output from the `cmp' invocations except in the +cases where there are small differences in floating point values, and +possibly in the case of strftime. Several of the tests ignore errors +on purpose; those are not a problem. If there are other differences, +please investigate and report the problem. + +PRINTING THE MANUAL + +The `doc' directory contains a recent version of texinfo.tex, which will +be necessary for printing the manual. Use `make dvi' to get a DVI file +from the manual. In the `doc' directory, use `make postscript' to get +PostScript versions of the manual, the man page, and the reference card. + +BUG REPORTS AND FIXES (Un*x systems): + +Please coordinate changes through Arnold Robbins. In particular, see +the section in the manual on reporting bugs. Note that comp.lang.awk +is about the worst place to post a gawk bug report. Please, use the +mechanisms outlined in the manual. + +Email should be sent to bug-gawk@gnu.org. This address sends mail to +Arnold Robbins and the general GNU utilities bug list. The advantage +to using this address is that bug reports are archived at GNU Central. + +Arnold Robbins + +BUG REPORTS AND FIXES, non-Unix systems: + +Amiga: + Fred Fish + fnf@ninemoons.com + +Alpha/Linux: + Michal Jaegermann + michal@gortel.phys.ualberta.ca + +BeOS: + Martin Brown + mc@whoever.com + +MS-DOS: + Scott Deifik + scottd.mail@sbcglobal.net + + Darrel Hankerson + hankedr@mail.auburn.edu + +MS-Windows: + Juan Grigera + juan@biophnet.unlp.edu.ar + +OS/2: + andreas.buening@@nexgo.de + +Tandem: + Stephen Davies + scldad@sdc.com.au + (Original Tandem port) + + Ralf Wildenhues + <Ralf.Wildenhues@gmx.de> + POSIX-compliant Tandem systems + +VMS: + Pat Rankin + rankin@pactechdata.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.FIRST b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.FIRST new file mode 100644 index 0000000..4957cb3 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.FIRST @@ -0,0 +1,21 @@ +Sat Feb 18 23:07:55 EST 1995 + +Starting with 2.15.6, gawk will preserve the value of NF and $0 for +the last record read into the END rule(s). This is important to you +if your program uses + + print + +in an END rule to mean + + print "" + +(i.e., print nothing). Examine your awk programs carefully to make sure +that they use `print ""' instead of `print', otherwise you will get +strange results. + +If you send me email about this, without having read this +file, I will yell at you. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.linux b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.linux new file mode 100644 index 0000000..9ba15c5 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.linux @@ -0,0 +1,21 @@ +Thu Apr 17 14:41:17 EDT 1997 + +Some Linux systems, notably RedHat systems through RedHat 4.1, have the +symbolic links for /dev/stdin and /dev/stdout messed up. Specifically, +/dev/stdin is linked to ../proc/self/fd/1 and /dev/stdout to +../proc/self/fd/0. This is backwards. This causes strange behavior +when using those files from within gawk. + +Removing and redoing the symlinks fixes the problem. It is fixed in +post-4.1 RedHat Linux. + +Arnold Robbins +arnold@skeeve.com + +Sun Aug 3 15:07:06 EDT 1997 + +As of version 3.1 of gawk, this is no longer a problem, since gawk now +completely interprets the special file names internally. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sco b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sco new file mode 100644 index 0000000..71494b7 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sco @@ -0,0 +1,67 @@ +Tue Dec 24 22:41:39 EST 1996 + +SCO's awk has a -e option which is similar to gawk's --source option, +allowing you to specify the script anywhere on the awk command line. + +This can be a problem, since gawk will install itself as `awk' in +$(bindir). If this is ahead of /bin and /usr/bin in the search path, +several of SCO's scripts that use -e will break, since gawk does not +accept this option. + +The solution is simple. After doing a `make install', do: + + rm -f /usr/local/bin/awk # or wherever it is installed. + +This removes the `awk' symlink so that SCO's programs will continue +to work. + +If you complain to me about this, I will fuss at you for not having +done your homework. + +Arnold Robbins +arnold@skeeve.com + +--------------------------- +Date: 14 Oct 1997 12:17 +0000 +From: Leigh Hebblethwaite <LHebblethwaite@transoft.com> +To: bug-gnu-utils@prep.ai.mit.edu + +I've just built gawk 3.0.3 on my system and have experienced a problem +with the routine pipeio2.awk in the test suite. However the problem +appears to be in the tr command rather than gawk. + +I'm using SCO Open Server 5. On the version I have there appears to be +a problem with tr such that: + + tr [0-9]. ........... + +does NOT translate 9s. This means that the output from: + + echo " 5 6 7 8 9 10 11" | tr [0-9]. ........... + +is: + + . . . . 9 .. .. + +This problem causes the pipeio2 test to be reported as a failure. + +Note that the following variation on the tr command works fine: + + tr 0123456789. ........... + +For your info the details of my system are summarised by the out put +of the uname -X command, which is: + +System = SCO_SV +Node = sgscos5 +Release = 3.2v5.0.2 +KernelID = 96/01/23 +Machine = Pentium +BusType = EISA +Serial = 4EC023443 +Users = 5-user +OEM# = 0 +Origin# = 1 +NumCPU = 1 + + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sony b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sony new file mode 100644 index 0000000..29ba875 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sony @@ -0,0 +1,12 @@ +Sun Jan 19 23:13:50 EST 1997 + +> Machine: SONY NWS-5000 (MIPS r4000) +> OS : NEWS-OS 4.2.1 (4.3BSD compatible) +> This OS doesn't have `uname' +> Tools : gcc-2.7.2.1, bison-1.25, cmp-2.7, bash-2.0 + +This system has the same problem with the test/tweakfld case that Ultrix MIPS +has. See the README.ultrix file for details. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.ultrix b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.ultrix new file mode 100644 index 0000000..917f02f --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.ultrix @@ -0,0 +1,46 @@ +When compiling on DECstation running Ultrix 4.0 a command 'cc -c -O +regex.c' is causing an infinite loop in an optimizer. Other sources +compile fine with -O flag. If you are going to use this flag either +add a special rule to Makefile for a compilation of regex.c, or issue +'cc -c regex.c' before hitting 'make'. + +From: Steve Simmons <scs@wotan.iti.org> +Subject: Non-bug report on gawk 2.13.2 +To: david@cs.dal.ca, arnold@skeeve.atl.ga.us +Date: Thu, 25 Jul 1991 13:45:38 -0300 + +Just fyi -- it passes tests with flying colors under Ultrix 4.2. The +README.ultrix file applies more than ever. You might want to add +these paragraphs to it: + + As of Ultrix 4.2 the optimise works for regex.c, but you must give an + additional switch to get everything optimised. Using '-Olimit 1500' + does the job. Without the switch gawk will compile and run correctly, + but you will get complaints about lost optimisations in builtin.c, + awk.tab.c and regex.c. + +From: Arnold Robbins <arnold@math.utah.edu> +Date: Sun Sep 8 07:05:07 EDT 1996 + +On Decstations using Ultrix 4.3, the tweakfld test case will fail. It +appears that routines in the math library return very small but non-zero +numbers in cases where most other systems return zero. + +From: Juergen Kahrs <jkahrs@castor.atlas.de> +Date: Wed Jan 17 13:15:34 MET 2001 + +On Ultrix 4.3, configure like this: + + ./configure --disable-nls + +In custom.h, we defined HAVE_MKTIME in order to avoid a linker error. +If you compile with + + make check + +every test will pass, except for the badargs test: + + *** Error code 1 (ignored) + +This shouldnt cause problems. + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.yacc b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.yacc new file mode 100644 index 0000000..6332986 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.yacc @@ -0,0 +1,10 @@ +Sat Jan 28 22:07:17 EST 1995 + +Some older versions of yacc (notably Ultrix's) have limits on the depth +of the parse stack. This only shows up when gawk is dealing with deeply +nested control structures, such as those in `awf'. + +The problem goes away if you use either bison or Berkeley yacc. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.VMS b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.VMS new file mode 100644 index 0000000..4d19398 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.VMS @@ -0,0 +1,81 @@ + +Compiling GAWK on VMS: + + There's a DCL command procedure that will issue all the necessary +CC and LINK commands, and there's also a Makefile for use with the MMS +utility. From the source directory, use either + |$ @[.VMS]VMSBUILD.COM +or + |$ MMS/DECRIPTION=[.VMS]DECSRIP.MMS GAWK + +DEC C -- use either vmsbuild.com or descrip.mms as is. +VAX C -- use `@vmsbuild VAXC' or `MMS/MACRO=("VAXC")'. On a system + with both VAX C and DEC C installed where DEC C is the default, + use `MMS/MACRO=("VAXC","CC=CC/VAXC")' for the MMS variant; for + the vmsbuild.com variant, any need for `/VAXC' will be detected + automatically. +GNU C -- use `@vmsbuild GNUC' or `MMS/MACRO=("GNUC")'. On a system + where the GCC command is not already defined, use either + `@vmsbuild GNUC DO_GNUC_SETUP' or + `MMS/MACRO=("GNUC","DO_GNUC_SETUP")'. + + Tested under Alpha/VMS V7.1 using DEC C V6.4. GAWK should work +without modifications for VMS V4.6 and up. + + +Installing GAWK on VMS: + + All that's needed is a 'foreign' command, which is a DCL symbol +whose value begins with a dollar sign. + |$ GAWK :== $device:[directory]GAWK +(Substitute the actual location of gawk.exe for 'device:[directory]'.) +That symbol should be placed in the user's login.com or in the system- +wide sylogin.com procedure so that it will be defined every time the +user logs on. + + Optionally, the help entry can be loaded into a VMS help library. + |$ LIBRARY/HELP SYS$HELP:HELPLIB [.VMS]GAWK.HLP +(You may want to substitute a site-specific help library rather than +the standard VMS library 'HELPLIB'.) After loading the help text, + |$ HELP GAWK +will provide information about both the gawk implementation and the +awk programming language. + + The logical name AWK_LIBRARY can designate a default location +for awk program files. For the '-f' option, if the specified filename +has no device or directory path information in it, Gawk will look in +the current directory first, then in the directory specified by the +translation of AWK_LIBRARY if it the file wasn't found. If the file +still isn't found, then ".awk" will be appended and the file access +will be re-tried. If AWK_LIBRARY is not defined, that portion of the +file search will fail benignly. + + +Running GAWK on VMS: + + Command line parsing and quoting conventions are significantly +different on VMS, so examples in _The_GAWK_Manual_ or the awk book +often need minor changes. They *are* minor though, and all the awk +programs should run correctly. + + Here are a couple of trivial tests: + |$ gawk -- "BEGIN {print ""Hello, World!""}" + |$ gawk -"W" version !could also be -"W version" or "-W version" +Note that upper- and mixed-case text must be quoted. + + The VMS port of Gawk includes a DCL-style interface in addition +to the original shell-style interface. See the help entry for details. +One side-effect of dual command line parsing is that if there's only a +single parameter (as in the quoted string program above), the command +becomes ambiguous. To work-around this, the normally optional "--" +flag is required to force shell rather than DCL parsing. If any other +dash-type options (or multiple parameters such as data files to be +processed) are present, there is no ambiguity and "--" can be omitted. + + The logical name AWKPATH can be used to override the default +search path of "SYS$DISK:[],AWK_LIBRARY:" when looking for awk program +files specified by the '-f' option. The format of AWKPATH is a comma- +separated list of directory specifications. When defining it, the +value should be quoted so that it retains a single translation, not a +multi-translation RMS searchlist. + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.aix b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.aix new file mode 100644 index 0000000..283d387 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.aix @@ -0,0 +1,6 @@ +Tue Mar 11 13:21:26 IST 2003 +============================ + +On AIX 4.2 systems, you need: + + ./configure --disable-nls && make all check install diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.atari b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.atari new file mode 100644 index 0000000..0c7fd74 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.atari @@ -0,0 +1,26 @@ +Sun May 2 18:40:46 IDT 1999 + +See the README.1st file in the atari directory. + +-------------------------------------------------------- +Gawk on the Atari has been compiled and tested using gcc, both +with and without -mshort flag. Other compilers can be used but if +sizeof(pointer) != sizeof(int) this code will not compile correctly +with a non-ANSI compiler (prototypes and library). + +Compiled executables were tested and passed successfully a test suite +similar to 'make test'. Required changes are minor and minor +modifications are due to differences in environment and/or shell. If +a need will arise a modified test suite with a driving Makefile (for +gulam) is available on a request from Michal Jaegermann, +michal@gortel.phys.ualberta.ca or michal@ellpspace.math.ualberta.ca, +via e-mail. + +Sample files atari/Makefile.st, atari/Makefile.awklib and +atari/config.h assume gcc compilation and execution under TOS; it is +likely that one would want to change it for another setup. If they +are ok then copy atari/Makefile.st to Makefile, atari/config.h to +config.h and atari/Makefile.awklib to awklib/Makefile.. Pay attention +to code fragments bracketed by '#ifdef atarist ... #endif'. These +modifications may not be required/desired with a different OS and/or +libraries. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.beos b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.beos new file mode 100644 index 0000000..e0a8189 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.beos @@ -0,0 +1,86 @@ +README for GNU awk under BeOS +Last updated MCB, Tue Feb 6 10:15:46 GMT 2001 + +BeOS port contact: Martin C Brown (mc@whoever.com) + +Building/Installing +-------------------------- + +Since BeOS DR9, all the tools that you should need to build gawk are now +included with BeOS. The process is basically identical to the Unix process +of running configure and then make. Full instructions are given below: + +You can compile gawk under BeOS by extracting the standard sources, +and running the configure script. You MUST specify the location prefix +for the installation directory. Under BeOS DR9 and beyond the best +directory to use is /boot/home/config, so the configure command +would be: + +$ configure --prefix=/boot/home/config + +This will install the compiled application into /boot/home/config/bin, +which is already specified in the standard PATH. + +Once the configuration process has been completed, you can run make and +then make install: + +$ make +.... +$ make install + +Socket Notes +---------------------- + +Due to the socket implementation under BeOS not all of the features under +gawk's socket implementation may work properly. In particular: + + BeOS does not support a BSD SO_LINGER option, so sockets cannot remain + open after a close if data is still present on the incoming buffer. + + BeOS does not allow data to be read from a socket without removing the data + from the buffer (peek). If you need to use this feature in gawk, create a + separate input buffer and peek into your own copy, rather than the OS version. + + BeOS does not support RAW socket connections, only UDP or TCP. + +Note that these are BeOS Unix-layer compatibility problems, and only affect certain +aspects of network communication. Most socket based gawk scripts, and any scripts +that do not rely on sockets should work fine (excepting any other notes in this section). + +File Handle Notes +--------------------------- + +Expect the multiple file test (when running make check) to fail. The reason for this is +explained in the email shown below: + +------------------------------------------------------- +From mc@whoever.com Sun Jul 23 17:06:38 2000 +Date: Sun, 23 Jul 2000 07:23:49 +0100 +Subject: Re: gawk-3.0.5 results on BeOS +From: Martin C Brown <mc@whoever.com> +To: Aharon Robbins <arnold@skeeve.com>, <haible@ilog.fr> + +Arnold/Bruno, + +> This is a known BeOS problem. I am cc'ing the BeOS port person. +> Sorry I don't have a fix. + +This problem is directly related to the FOPEN_MAX/OPEN_MAX parameter used in +the stdio library by the BeOS. It seems that the BeOS strictly enforces this +number to the point that opening the 128th file causes all previously opened +files (except stdin/out/err) to be closed - hence the bad number. + +I've tried this outside of gawk and the same thing happens, so it's not a +gawk problem. + +I've spent the past few days trying to find a suitable workaround, but it's +obviously difficult trying to patch a kernel from the outside :)) + +I'll be reporting this as a bug to Be shortly. + +MC + +-- +Martin 'MC' Brown, mc@mcslp.com http://www.mcwords.com +Writer, Author, Consultant +'Life is pain, anyone who says differently is selling something' diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.cygwin-dynamic b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.cygwin-dynamic new file mode 100644 index 0000000..948538f --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.cygwin-dynamic @@ -0,0 +1,88 @@ +From: courierdavid@hotmail.com +Newsgroups: comp.lang.awk +Subject: Re: Compiling gawk extensions under Cygwin +Date: 14 Mar 2005 20:47:09 -0800 +Organization: http://groups.google.com +Lines: 67 +Message-ID: <1110862029.175727.109280@o13g2000cwo.googlegroups.com> +References: <1e4e8dbe.0501140813.18248833@posting.google.com> + <u62nb2-pro.ln1@news.heiming.de> +NNTP-Posting-Host: 194.237.142.24 +Mime-Version: 1.0 +Content-Type: text/plain; charset="iso-8859-1" +X-Trace: posting.google.com 1110862033 8921 127.0.0.1 (15 Mar 2005 04:47:13 GMT) +X-Complaints-To: groups-abuse@google.com +NNTP-Posting-Date: Tue, 15 Mar 2005 04:47:13 +0000 (UTC) +User-Agent: G2/0.2 +Complaints-To: groups-abuse@google.com +Injection-Info: o13g2000cwo.googlegroups.com; posting-host=194.237.142.24; + posting-account=Iz4C5wwAAABx1yG_ft8eEAI99Wu1Tku1 +Path: news.012.net.il!seanews2.seabone.net!newsfeed.albacom.net!news.mailgate.org!newsfeed.stueberl.de!proxad.net!64.233.160.134.MISMATCH!postnews.google.com!o13g2000cwo.googlegroups.com!not-for-mail +Xref: news.012.net.il comp.lang.awk:21835 + +Thanks for your help there Michael. I wouldn't have thought of that one +myself without your help :-) + +Anyway - for those who must stick with Cygwin here's a method that +works using the mingw32 makefiles and some modifications: + +Basically you need to extract all exportable symbol names from the +gawk.exe file into a text file and then create a dummy library file +which we can link against on Cygwin. You then throw the library file +away because in reality we use the gawk.exe file as the provider of +those functions. + +1. First grab the gawk source, e.g. gawk-3.1.4.tar.bz2 and decompress +it. +2. Move to the gawk-3.1.4 directory you just created. +3. cp pc/* . (copy the pc directory into the main one) +4. edit makefile - uncomment lines "DYN_FLAGS", "DYN_EXP", "DYN_OBJ" +and "DYN_MAKEXP=$(DMEmingw32) +5. make mingw32 (make a gawk.exe) +6. run "gcc -o gawk.exe array.o builtin.o eval.o field.o gawkmisc.o +io.o main.o ext.o msg.o node.o profile.o re.o version.o dlfcn.o +gawk.exp awkgram.o getid.o popen.o getopt.o getopt1.o dfa.o regex.o +random.o" (i.e. remove the -s from the compile command from the +makefile so the symbols are left in gawk.exe) + +now export all symbols from gawk.exe into foo.def so that we can put +these in our library +7. echo EXPORTS > foo.def +8. nm gawk.exe | grep -E ' [TBD] _' | sed 's/.* [TBD] _//' >> foo.def +9. cp foo.def gawkw32.def + +build the new library with all symbols included +10. make mingw32 + +Now you will see a file "libgawk.a" which you can link against to +create extensions. For example to build an extension called "file" run: + +gcc -shared -dll -DHAVE_CONFIG_H -I . extension/file.c -o file.dll -L . +-lgawk + +Then you can load it in gawk using the expression: + +extension("./file.dll", "dlload"); + +You must use the gawk you compiled from source though. It won't work +with any other gawk unfortunately :-( But that's OK because the +stripped gawk is not too big in size. + +Cheers, +Dave. + +Michael Heiming wrote: +> In comp.lang.awk David Smith <courierdavid@hotmail.com>: +> > Has anyone managed to compile gawk extensions (such as "filefuncs") +> > under Cygwin? +> +> Solution is pretty simple, install a real OS, Linux/*BSD or any +> other unix and this and further problems won't happen. +> +> Good luck +> +> -- +> Michael Heiming (X-PGP-Sig > GPG-Key ID: EDD27B94) +> mail: echo zvpunry@urvzvat.qr | perl -pe 'y/a-z/n-za-m/' +> #bofh excuse 242: Software uses US measurements, but the OS +> is in metric... diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.hpux b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.hpux new file mode 100644 index 0000000..78e6f35 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.hpux @@ -0,0 +1,78 @@ +Wed Jul 28 16:28:42 IDT 2004 +============================ +As of gawk 3.1.4, configure should correctly handle HP-UX and +I18N issues. -- Arnold +-------------------------------------------------------------- +2003-12-10 15:19:38 EST +Michael Elizabeth Chastain <mec.gnu@mindspring.com> + +I built and tested gawk on hppa-hp-hpux11.11 and ia64-hp-hpux11.23. +All the tests in the test suite passed. + +I built with these compilers: + + gcc 3.3.2 + hp ansi C from /opt/ansic/bin + hp aCC from /opt/aCC/bin + +I ran into these problems: + + NLS does not work; configure with --disable-nls. + -D_XOPEN_SOURCE=500 does not work. + Multibyte support is not available. + +To get multibyte support, the following ugly hack might work: +--- gawk-3.1.3.orig/custom.h 2003-06-09 17:45:53.000000000 +0200 ++++ gawk-3.1.3/custom.h 2003-12-17 15:55:04.000000000 +0100 +@@ -101,4 +101,7 @@ + #undef HAVE_TZSET + #define HAVE_TZSET 1 + #define _TZSET 1 ++/* an ugly hack: */ ++#include <sys/_mbstate_t.h> ++#define HAVE_MBRTOWC 1 + #endif + +------------------------------- +Mon, 27 May 2002 17:55:46 +0800 + +The network support "|&" may not work under HP-UX 11. +An error message appears similar to this: +gawk: test_script.awk:3: fatal: get_a_record: iop->buf: can't allocate -61246 +bytes of memory (not enough space) + +Solution: +This is a bug in the fstat() call of HP-UX 11.00, please apply +the cumulative ARPA Transport patch PHNE_26771 to fix it. + +The following is the related description in PHNE_26771: + + Customer's application gets the wrong value from fstat(). + Resolution: + The value returned via st_blksize is now retrieved + from the same info as in 10.20. + +In case you cannot apply the HP patch, the attached patch to gawk source +might work. + +Xiang Zhao <xiangz@163.net> +Stepan Kasal <kasal@math.cas.cz> + +diff -ur gawk-3.1.3.a0/posix/gawkmisc.c gawk-3.1.3.a1/posix/gawkmisc.c +--- gawk-3.1.3.a0/posix/gawkmisc.c Sun May 25 15:26:19 2003 ++++ gawk-3.1.3.a1/posix/gawkmisc.c Fri Jul 11 08:56:03 2003 +@@ -126,7 +126,13 @@ + * meant for in the first place. + */ + #ifdef HAVE_ST_BLKSIZE +-#define DEFBLKSIZE (stb->st_blksize > 0 ? stb->st_blksize : BUFSIZ) ++ /* ++ * 100k must be enough for everybody, ++ * bigger number means probably a bug in fstat() ++ */ ++#define MAXBLKSIZE 102400 ++#define DEFBLKSIZE (stb->st_blksize > 0 && stb->st_blksize <= MAXBLKSIZE \ ++ ? stb->st_blksize : BUFSIZ) + #else + #define DEFBLKSIZE BUFSIZ + #endif diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.ia64 b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.ia64 new file mode 100644 index 0000000..844d6a6 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.ia64 @@ -0,0 +1,30 @@ +Tue Mar 11 13:19:45 IST 2003 +============================ + +On real Itanium systems, builds with GCC are fine. If you're using the +Intel compiler `ecc', you need: + + CC=ecc ./configure && make all check install CFLAGS='-g -Drestrict=' + +Tue Apr 16 13:55:15 IDT 2002 +============================ +The current version of the IA-64 environment builds gawk without any problems. + +Wed Apr 25 17:17:01 IDT 2001 +============================ + +The Intel IA-64 emulation environment that sits on top of 32-bit Linux +has problems. Gawk does not work on it. + +1. The `sgicc' compiler lies to `configure' and pretends it's gcc. But it +really isn't, and several things don't work. + +2. Even if used with gcc, the executable doesn't run; somehow quoted +strings don't stay as one argument to gawk, which is, of course, +disastrous. + +3. It's flaky; initially `configure' wouldn't even get past the getpgrp +test. Then later it would. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.macos b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.macos new file mode 100644 index 0000000..684e028 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.macos @@ -0,0 +1,32 @@ +Mon Jun 11 05:37:03 IDT 2007 +============================ + +The notes below no longer seem to apply. + +Mon Jul 4 09:55:22 IDT 2005 +============================ + +If you use GCC 4.0 under Mac OS X to compile gawk with optimization, +AND multibyte support is *disabled*, the `ignrcas2' test fails. This is +a compiler bug. Either compile it without optimization, or use gcc-3.3. + +All the other tests pass. + +Happily, the default is for the multibyte support to be enabled, so all +the tests pass by defualt. + + +Sun Dec 3 18:11:09 IST 2000 +============================ + +The `posix' test will fail because of output format differences but this +is apparently otherwise benign. + +Gawk uses the system's mktime(3) routine, even though Autoconf thinks +it's broken, so Caveat Emptor. + +If you ask me about either of these I will fuss at you for not having +done your homework. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.multibyte b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.multibyte new file mode 100644 index 0000000..135ba86 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.multibyte @@ -0,0 +1,29 @@ +Fri Jun 3 12:20:17 IDT 2005 +============================ + +As noted in the NEWS file, as of 3.1.5, gawk uses character values instead +of byte values for `index', `length', `substr' and `match'. This works +in multibyte and unicode locales. + +Wed Jun 18 16:47:31 IDT 2003 +============================ + +Multibyte locales can cause occasional weirdness, in particular with +ranges inside brackets: /[....]/. Something that works great for ASCII +will choke for, e.g., en_US.UTF-8. One such program is test/gsubtst5.awk. + +By default, the test suite runs with LC_ALL=C and LANG=C. You +can change this by doing (from a Bourne-style shell): + + $ GAWKLOCALE=some_locale make check + +Then the test suite will set LC_ALL and LANG to the given locale. + +As of this writing, this works for en_US.UTF-8, and all tests +pass except gsubtst5. + +For the normal case of RS = "\n", the locale is largely irrelevant. +For other single byte record separators, using LC_ALL=C will give you +much better performance when reading records. Otherwise, gawk has to +make several function calls, *per input character* to find the record +terminator. You have been warned. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pc b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pc new file mode 100644 index 0000000..9ee2f12 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pc @@ -0,0 +1,378 @@ +This is the README for GNU awk 3.1 under Windows32, OS/2, and DOS. + + Gawk has been compiled and tested under OS/2, DOS, and Windows32 using +the GNU development tools from DJ Delorie (DJGPP; DOS with special +support for long filenames under Win95), Eberhard Mattes (EMX; OS/2, +DOS, and Windows32 with rsxnt), and Jan-Jaap van der Heijden and Mumit Khan +(Mingw32; Windows32). Microsoft Visual C/C++ can be used to build a Windows32 +version for Windows 9x/NT, and MSC can be used to build 16-bit versions +for DOS and OS/2. (As of 3.1.2, the MSC version doesn't work, but the +maintainer for it is working on fixing it.) + + The cygwin environment (http://www.cygwin.com) may also be used +to compile and run gawk under Windows. For cygwin, building and +installation is the same as under Unix: + + tar -xvpzf gawk-3.1.x.tar.gz + cd gawk-3.1.x + ./configure && make + +The `configure' step takes a long time, but works otherwise. + +******************************** N O T E ********************************** +* The `|&' operator only works when gawk is compiled for cygwin. Neither * +* socket support nor two-way pipes work in any other Windows environment! * +*************************************************************************** + +Building gawk +------------- + +Building on DOS or Windows environments can be troublesome, in part due +to shell limitations, the long filename issue, and various Windows32 pipe +considerations. The situation is somewhat better on OS/2. The general +recommendation is to use tools (especially make) which are compatible +or built with the compiler to be used on gawk. + +Building versions which do not understand long filenames on systems +that offer long names is a special case. The maintainers unpack the +distribution and process using utilities (unzip, make, cmp) which do not +use long filenames. (For example, the djgpp tools will work if LFN=n is +set in the environment.) + +Copy the files in the `pc' directory (EXCEPT for `ChangeLog') to the +directory with the rest of the gawk sources. (The subdirectories of +`pc' need not be copied.) The makefile contains a configuration +section with comments, and may need to be edited in order to work +with your make utility. + +The "prefix" line in the Makefile is used during the install of gawk +(and in building igawk.bat and igawk.cmd). Since the libraries for +gawk will be installed under $(prefix)/lib/awk (e.g., /gnu/lib/awk), +it is convenient to have this directory in DEFPATH of config.h. + +The makefile contains a number of targets for building various DOS and +OS/2 versions. A list of targets will be printed if the make command is +given without a target. As an example, to build gawk using the djgpp +tools, enter "make djgpp". + + +Testing and installing gawk +--------------------------- + +The command "make test" (and possibly "make install") requires several +Unix-like tools, including an sh-like shell, sed, cp, and cmp. Only +dmake and GNU make are known to work on "make test". + +There are two methods for the install: Method 1 uses a typical Unix-like +approach and requires cat, cp, mkdir, sed, and sh; method 2 uses gawk +and batch files. See the configuration section of the makefile. + +The file test/Makefile will need some editing (especially for DOS). A +sample makefile with comments appears in pc/Makefile.tst, and can be +used to modify test/Makefile for your platform. In addition, some +files in the test directory may need to have their end-of-line markers +converted, as described in Makefile.tst. + +As with building gawk, the OS, shell, and long filename issues come into +play when testing, too. If you are testing gawk on a LFN aware system with +some LFN aware tools, you may have problems if the shell that you specify in +test/Makefile is not LFN aware. This problem will apply whether or not +you are building a LFN aware gawk. See the comments in pc/Makefile.tst +for more information on this. + +It is routine to install by hand, but note that the install target also +builds igawk.bat and igawk.cmd, which are used to add an include +facility to gawk (and which require sh). + + +Notes +----- + +1. Collections containing gawk and various utilities for OS/2 or DOS +include the GNUish Project, Rommel's OS/2 collection at LEO, and the +djgpp collection. + +The GNUish Project was designed to bring GNU-like programs to small +systems running OS/2 and DOS. Binary distributions of gawk are +maintained in GNUish, and include 16bit OS/2 and DOS, 32bit djgpp, +and Windows32 versions. Information on GNUish is available via + + http://www.simtel.net/simtel.net/ +or + ftp://ftp.simtel.net/simtelnet/gnu/gnuish + +Documentation appears in gnuish.htm (html) or gnuish.inf (info). + +Kai Uwe Rommel <rommel@leo.org> maintains a (mostly OS/2) collection at + + http://www.leo.org/archiv/os2 or ftp://ftp.leo.org + +It contains emx-compiled (32bit) versions of gawk for OS/2, DOS, and Windows32, +along with many OS/2 utilities. + +The djgpp collection at + + ftp://ftp.delorie.com/pub/djgpp/current/v2gnu/ + +contains a djgpp-compiled (32bit) version of gawk, along with many +djgpp-compiled utilities. + +The Mingw32 collection at http://www.mingw.org contains links to ported +software. The site by Jan-Jaap van der Heijden + + http://agnes.dida.physik.uni-essen.de/~janjaap/ + +is apparently no longer maintained, but it was accessible as of Jan 2001 +and may contain files of interest. + + +2. The following table illustrates some of the differences among the various +compiled versions of gawk. For example, the djgpp version runs on all the +systems, but with differing capabilities: it supports long filenames under +Win-9x but not under NT, and it runs as a DPMI application under OS/2 (which +translates into "works in the DOS-box under OS/2, but not as a true OS/2 +application"). + + DOS Win/WfW Win9x NT OS/2 + ------------------------------------------------------- + djgpp | DPMI DPMI DPMI DPMI,NoLFN DPMI + emx(1) | N N N N OS2 + emxbnd(2) | VCPI,DPMI DPMI DPMI,NoLFN DPMI,NoLFN DPMI,OS2 + emxnt(3) | N N Windows32 Windows32 N + msc(4) | 16 16 16,NoLFN 16,NoLFN 16,DOS + msc6bnd | 16 16 16,NoLFN 16,NoLFN 16,DOS,OS2 + msc6os2 | N N N N 16,OS2 + vcWin32 | N N Windows32 Windows32 N + mingw32 | N N Windows32 Windows32 N + + (1) Requires emxrt. + + (2) May run as a DPMI app in plain DOS and in a DOS-shell under OS/2 + or Windows, and as a true OS/2 application under OS/2. DPMI + requires rsxnt, and VCPI or use as an OS/2 app requires emxrt. + + (3) Requires rsxnt. + + (4) When compiling, MSC 8, when run in Windows 9x, will require that if + files are listed in #include statements with LFNs + (eg. <patchlevel.h>), that the file be named with the LFN. + + 16 16bit; limited capacity, especially under DOS. + + DOS Runs as a DOS application. + + DPMI Dos Protected Mode Interface; program runs as a DOS application. + Under plain DOS, a DPMI server (such as csdpmi from the djgpp + archives) is required. See also VCPI. + + emxrt The emx runtime, available from LEO. + + N Not supported. + + NoLFN No long filename support. + + OS2 Runs as an OS/2 application. + + rsxnt Runtimes for use with DPMI or Windows32. + + VCPI Virtual Control Program Interface; program runs as a DOS app. + Memory managers (such as emm386) may need adjustment. VCPI cannot + be used under OS/2, Win/WfW, Win-95, or NT. See also DPMI. + +Windows32 Uses/supports Windows32 features (such as long filenames). + +Reportedly, NTEmacs (another Windows32 program) can run programs such as +Windows32-gawk asynchronously. Similarly, as native OS/2 versions are a +plus under OS/2 even for command-line programs, native Windows32 versions +may be desired under NT and Win95. + +Users interested in Windows32 applications may also wish to examine the +Cygnus cygwin project at http://sources.redhat.com/cygwin/ or the +Mingw32 work at http://www.mingw.org. Windows32 gawk will often require +that utilities run from within gawk be Windows32 (e.g., the tests place this +requirement on the cat utility). + + +3. An sh-like shell may be useful for awk programming (and is essential +for running "make test"). Stewartson's sh (OS/2 and DOS) is a good +choice, and may be found in GNUish. + +Stewartson's shell uses a configuration file (see "Command Line Building" +in the sh manual page), and it may be necessary to edit the entry for +gawk. The following entries are suggested: + + -- $(EXTENDED_LINE) -- -- Comment only, not part of file -- + gawk = unix ignoretype # emxbnd + gawk = unix # djgpp; msc* with Stewartson's stdargv + # No entry for emx or for msc* without stdargv + gawk = ignoretype # if you want something which which always work + # --but without the use of @-include files. + +However, users of djgpp versions of gawk may prefer "dos" over "unix" +in the above, due to the way djgpp handles @-include files. Entries +for other other utilities (such as sed and wc) may need to be edited +in order to match your specific collection of programs. + +Daisuke Aoyama <jack@st.rim.or.jp> has ported Bash 1.14.7 to djgpp. +This version worked flawlessly in tests with djgpp gawk and make. bash +is now part of the djgpp collection; the older port may be found on + + http://www.neongenesis.com/~jack/djgpp-work/beta/index.html + +Under OS/2, bash should be a good choice; however, there has been some +trouble getting a solid version. As of Feb-95, there are two bash ports, +available at LEO under shells/gnu/. + +LEO also contains a Korn shell (ksh), tcsh, zsh, and a demo of +Hamilton's C shell, but these have not been tested with gawk by the +maintainers. Reports are welcomed. + +Users of the emx versions of gawk may wish to set EMXSHELL, which +overrides COMSPEC when running shells from emx programs. Similarly, +the djgpp version of gawk respects SHELL. + +Compatibility among shells and various utilities (including gawk) +continues to be a problem. Stewartson's shell may be the best choice +for emx-compiled programs (although djgpp-bash almost works with +emx on DOS). GNU make is recommended if using djgpp-bash. + +Beginning with 3.0.4, the MSC (DOS/Windows32) and Mingw32 versions write +pipe and system() commands to a temporary file, and then execute +with SHELL or COMSPEC. The current mechanism defaults to dos-style +shell conventions unless the shell is one of sh, bash, csh, tcsh, sh32, +sh16, or ksh. + + +4. GNU make is available at LEO for OS/2, in the djgpp collection +for DOS, and in the Mingw32 collection for Windows32. + +dmake is by Dennis Vadura (dvadura@watdragon.uwaterloo.ca), CS +Dept., University of Waterloo. OS/2 and DOS versions can be found as +part of the GNUish project. Note that DOS users will need the DOS-only +version (due to the swap requirement). + +Ndmake is by D.G. Kneller. This ShareWare program was later released +as Opus Make (which is available for OS/2 and DOS). Ndmake 4.5 is +available at + + ftp://ftp.simtel.net/simtelnet/msdos/c/ndmake45.zip + + +5. Stewartson's shell contains sources for a setargv-replacement +for MSC, which can add enhanced command-line processing capabilities +to gawk. See the makefile. Note that there is a fatal bug in +stdargv.c, triggered in the case of no closing quote. The following +patch treats this case as if a quote was inserted as the last +character on the command-line. + +478,479c478,482 +< else +< spos = &spos[strlen (cpos)]; +--- +> else { +> /* No matching quote. Fake it. */ +> spos = cpos + strlen (cpos) + 1; +> break; +> } + + +Known bugs +---------- + +1. DJGPP version 1 has known problems with signals, and in the way it +handles command-lines. Older versions of this file contain notes on +other bugs, and on a few bugs uncovered in the v2 betas. Testing of +gawk with DJGPP v1 ended with gawk-3.0. djgpp-2.01 and djgpp ports of +GNU make 3.75 or later are strongly preferred, in part due to enhanced +support for sh-like shells. + +2. emx does not support DST. On 2-Jan-96, Mattes writes: + + Quotation from ISO 9899-1990: + + 7.12.3.5 The strftime function + [...] + %Z is replaced by the time zone name or abbreviation, or by no + characters if no time zone is determinable. + + As emx does not yet support DST, it does not know which one of the two + time zones (with DST vs. without DST) applies. In consequence, `no + time zone is determinable'. + +As a workaround, it may be possible to edit do_strftime() of builtin.c +according to Mattes' recommendation: + + If you happen to know whether DST applies or not for a given struct + tm, just set its tm_isdst to a positive value or to zero, respectively. + Then, strftime() will replace %Z with the name of the time zone. + +However, this probably won't yield a generic solution given that the rules +for when DST starts and stops vary depending upon your location and the +rules have changed over time. Most versions of UNIX maintain this +information in a database (of sorts). In Solaris, for instance, it can be +found in /usr/share/zoneinfo/*. The setting of the TZ environment variable +(eg. TZ=US/Pacific) is then used to lookup the specifics for that locale. + +3. The 16-bit DOS version can exhaust memory on scripts such as Henry +Spencer's "awf". Use GNU C versions if possible. + +4. builtin.c of gawk-3.0.[1-6] triggers a bug in MSC 6.00A. The makefile +works around the bug by compiling builtin.c without optimizations (-Od). +In limited testing, it appears that inserting some dummy code in +builtin.c can provide a better solution than disabling optimizations. + +5. There are problems with system() when using the rsx package with emx +programs (rsx is used in DPMI environments such as MS-Win). The djgpp +versions are preferred in this case. + +6. In contrast to getpid() on UNIX, the getpid() in Microsoft C/C++ 1.52 +(AKA 8.0) sometimes returns negative numbers. The DOS Gawk developers felt +that it was best to use Microsoft's built-in function; but at the same time, +we are placing this warning here, because this behavior will undoubtably be +surprising to many. + +7. MSC 6 fails the strftlng test. The funstack test exhausts memory +on the 16bit DOS versions. + +8. Eli Zaretskii writes: "Make can crash with SIGFPE after finishing all +the tests. This happens on Windows 95 only, and Gawk 3.0.3 does that as +well (as do older versions of Make). The cause for this is the log(-1) +call in the last test. Based on some limited testing, I'd say that the +problem is in sloppy Windows handling of the FPU: it doesn't clean up the +FPU after a program exits, so if Make has SIGFPE unmasked, it crashes." + +9. gawk built from the mingw32 and vcWin32 targets continues to have +problems with pipes; in particular, the pipeio1 test fails. + +10. As mentioned above, `|&' only works with cygwin. + + +Gawk thanks +----------- + +The DOS maintainers wish to express their thanks to Eli Zaretskii +<eliz@is.elta.co.il> for his work and for the many conversations +concerning gawk, make, and djgpp. His FAQ for djgpp is essential +reading, and he was always willing to answer our questions (even when +we didn't read the relevant portions of the FAQ :). + +We are indebted to Juan Grigera <juan@biophnet.unlp.edu.ar> for the +Visual C++ target, and for additional help on changes for Windows32. + + +---- +If you have any problems with the DOS or OS/2 versions of Gawk, +please send bug reports (along with the version and compiler used) to + + Scott Deifik, scottd.mail@sbcglobal.net (DOS versions) +or + gawk-maintainer@unixos2.org (OS/2 version) + Darrel Hankerson, hankedr@mail.auburn.edu + +Support for Windows32 started in gawk-3.0.3. Reports on +the Visual C++ version (vcWin32) may be sent to + + Juan Grigera, juan@biophnet.unlp.edu.ar (Visual C++ version) + +with a copy to Scott Deifik. Other Windows32 reports may go to Darrel +Hankerson. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pcdynamic b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pcdynamic new file mode 100644 index 0000000..678206e --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pcdynamic @@ -0,0 +1,93 @@ +This is the README for dynamic extension support for GNU awk 3.1.2 under Windows32 +This part of the README is directed to the gawk maintainers. + +The implementation consists of + +pc/dlfcn.h +pc/dlfcn.c + An implementation of the POSIX dynamic loading functions for Windows32. + Bugs and limitations: + the RTLD_* flags are ignored + passing NULL as the module name is not really supported. + dlerror() doesn't always generate useful output. + +pc/w32dynamic.patch + A patch to pc/Makefile. This adds macros to allow dynamic loading + to be compiled in. The macros (DYN_EXP, DYN_OBJ, DYN_FLAGS, and + DYN_MAKEXP) are commented-out by default (which is the default on + Unix as well). I've added definitions only for MS VC and MinGW. + I also added support for pgawk under MS VC and MinGW. + +pc/gawkw32.def + A list of functions to export from gawk.exe. Every function used + in an extension DLL needs to be in this file. I've added the ones + required by the provided examples, but some thought should go into + determining a useful set of API functions. From a maintenance + perspective, it's important that the ordinals (the number following @) + never change. You can use an existing DLL with a gawk.exe which has + new exported functions, but if you change the ordinal of an existing + function, you have to recompile all the extensions that use it. + +extension/Makefile.pc + A make file which compiles a few of the extension examples. + Only readfile, ordchr, and arrayparm are built, since the + other functions didn't compile without sizeable modifications. + +extension/pcext.def + A module definition file which exports dlload. + +extension/w32dynamic.patch + A patch to readfile.c to have it open files in binary mode. Without + this, the bytes read doesn't always match the file size. + +w32dynamic.patch + A patch to awk.h. This makes the temporary variable _t static and + adds an attribute to some data declarations when WIN32_EXTENSION is + defined. The issue is that data imported from a separate module has + a different level of indirection from the same data in the + original module. The difference can be made transparent by adding + __declspec(dllimport)) to the declarations used in the importing module. + Since _t doesn't actually have to be shared, I've just made it + static to the extension module and avoided the problem. + +README_d/README.pcdynamic + This file. + +The remainder of the file is intended for people installing and using gawk +and probably ought to be added to README.pc +--- +To compile gawk with dynamic extension support, uncomment the +definitions of DYN_FLAGS, DYN_EXP, DYN_OBJ, and DYN_MAKEXP in the +configuration section of Makefile. There are two definitions for +DYN_MAKEXP -- pick the one that matches your target. + +To build some of the example extension libraries, cd to the extension +directory and copy Makefile.pc to Makefile. You can then build using the same +two targets. To run the example awk scripts, you'll need to either change the +call to the `extension' function to match the name of the library (for +instance, change "./ordchr.so" to "ordchr.dll" or simply "ordchr"), or rename +the library to match the call (for instance, rename ordchr.dll to ordchr.so). + +If you build gawk.exe with one compiler but want to build an extension library +with the other, you need to copy the import library. Visual C uses a library +called gawk.lib, while MinGW uses a library called libgawk.a. These files +are equivalent and will interoperate if you give them the correct name. +The resulting shared libraries are also interoperable. + +To create your own extension library, you can use the examples as models, but +you're essentially on your own. Post to comp.lang.awk or send e-mail to +ptjm@interlog.com if you have problems getting started. If you need to access +functions or variables which are not exported by gawk.exe, add them to +gawkw32.def and rebuild. You should also add ATTRIBUTE_EXPORTED to the +declaration in awk.h of any variables you add to gawkw32.def. + +Note that extension libraries have the name of the awk executable embedded in +them at link time, so they will work only with gawk.exe. In particular, they won't +work if you rename gawk.exe to awk.exe or if you try to use pgawk.exe. You can +perform profiling by temporarily renaming pgawk.exe to gawk.exe. You can resolve +this problem by changing the program name in the definition of DYN_MAKEXP for +your compiler. + +On Windows32, libraries are sought first in the current directory, then in the +directory containing gawk.exe, and finally through the PATH environment +variable. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sgi b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sgi new file mode 100644 index 0000000..5d754a8 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sgi @@ -0,0 +1,20 @@ +Tue Jan 30 10:51:39 IST 2001 + +There will be linker warnings on SGI Irix will be building gawk. +These are related to use of dlopen and the dynamic loading of +builtins. The warnings can be ignored. +====================================== +Tue May 2 11:40:54 IDT 2000 + +GCC and gawk often don't mix on SGI systems. Use the native C compiler to +compile gawk. `make test' should work ok, although the `tweakfld' test +may fail. That's ok; see README.ultrix for the details on that one. + +Note that the SGI compiler will complain about some constructs in +regex.c and dfa.c. It's ok to ignore those complaints. + +If you ask me about this, I will fuss at you for not having done +your homework! + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.solaris b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.solaris new file mode 100644 index 0000000..4b5affd --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.solaris @@ -0,0 +1,138 @@ +Solaris Problem #1: +=================== +From: carson@lehman.com +Date: Fri, 7 Feb 1997 01:05:58 -0500 +To: arnold@gnu.ai.mit.edu +Subject: Solaris 2.5.1 x86 bug in gawk-3.0.2 + +awktab.c has the following bogus logic: + +#ifndef alloca +#ifdef __GNUC__ +#define alloca __builtin_alloca +#else /* not GNU C. */ +#if (!defined (__STDC__) && defined (sparc)) || defined (__sparc__) || defined (__sparc) || defined (__sgi) +#include <alloca.h> +#else /* not sparc */ + +Solaris x86 obviously dosn't define sparc or __sparc. + +What you _meant_ to say was: + +if (defined(__sun) && defined(__SVR4)) + +(which identifies Solaris 2.x under both Sun's cc and gcc) + +-- +Carson Gaspar -- carson@cs.columbia.edu carson@lehman.com +http://www.cs.columbia.edu/~carson/home.html +<This is the boring business .sig - no outre sayings here> + + * * * * * * * + +Solution to Problem #1: +======================= +Tue Oct 20 21:25:11 IST 1998 + +This has been fixed in 3.1.0 with the bisonfix.sed script. + +Arnold Robbins +arnold@skeeve.com + +Solaris Problem #2: +=================== +Tue Apr 13 16:57:45 IDT 1999 + +There is a known problem in that the `manyfiles' test will fail under +Solaris if you set your soft limit on the number of file descriptors to +above 256. This is due to a "feature" of fdopen that an fd must be +less than 256 (see fdopen(3)). + +IMHO this is Sun's problem, not mine. + +Arnold Robbins +arnold@skeeve.com + +Solution (a) to Problem #2: +=========================== +Now fixed in the code via Paul Eggert's 2001-09-0 patch. See the +ChangeLog. + +Solution (b) to Problem #2: +=========================== +From: Paul Nevai <nevai@math.ohio-state.edu> +Subject: Re: gawk-3.0.4 +To: arnold@skeeve.com (Aharon Robbins) +Date: Tue, 6 Jul 1999 09:09:05 -0400 (EDT) + +Dear Aharon: + +Toda raba. Why don't you add something like that to README_d/README.solaris +file: + +for the SunOS do in + +/bin/sh: ulimit -n 256; ulimit -a; make test +/bin/tcsh: limit descriptors 256; ulimit -a; make test + +otherwise "make test" will fail + +Shalom, Paul + +Aharon Robbins wrote to Paul Nevai: +# >From the README_d/README.solaris file: +# +# Tue Apr 13 16:57:45 IDT 1999 +# +# There is a known problem in that the `manyfiles' test will fail under +# Solaris if you set your soft limit on the number of file descriptors to +# above 256. This is due to a "feature" of fdopen that an fd must be +# less than 256 (see fdopen(3)). +# +# IMHO this is Sun's problem, not mine. +# +# Arnold Robbins +# arnold@skeeve.com +# +# Double check your settings with ulimit; I suspect that this is +# your problem. +# +# Thanks, +# +# Arnold +# -- +# Aharon (Arnold) Robbins arnold@skeeve.com [ <<=== NOTE: NEW ADDRESS!! ] +# P.O. Box 354 Home Phone: +972 8 979-0381 Fax: +1 603 761-6761 +# Nof Ayalon Cell Phone: +972 51 297-545 (See www.efax.com) +# D.N. Shimshon 99784 Laundry increases exponentially in the +# ISRAEL number of children. -- Miriam Robbins +# +# + + + +Paul Nevai pali+@osu.edu +Department of Mathematics nevai@math.ohio-state.edu +The Ohio State University http://www.math.ohio-state.edu/~nevai/ +231 West Eighteenth Avenue http://www.math.ohio-state.edu/~jat/ +Columbus, Ohio 43210-1174 1-614-292-5310 (Office/Answering Device) +The United States of America 1-614-292-1479 (Math Dept Fax) + +Solaris Problem #3: +=================== +Sun Feb 9 10:35:51 IST 2003 + +Certain versions of Sun C give compilation errors under Solaris 5.5, 5.6 and +possibly later. Here's what I was told: + +> We have this version of cc here: +> cc -V +> cc: Sun WorkShop 6 update 1 C 5.2 2000/09/11 +> +> Probably, the others use different combinations of OS and CC. +> A quick fix was this (we use csh-syntax here): +> +> setenv CC "/opt/SUNWspro/bin/cc -Xc" +> ./configure +> make check + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sunos4 b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sunos4 new file mode 100644 index 0000000..7cef068 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sunos4 @@ -0,0 +1,24 @@ +Sun Jan 7 23:49:46 EST 1996 + +GCC and Autoconf disagree about the type of the array argument passed +to getgroups(2). You can thus ignore the warning that gcc will +generate under SunOS 4.1.x for io.c. + +If you send me email about this without having read this file, I will +fuss at you! + +Arnold Robbins +arnold@skeeve.com + +Tue Jan 30 07:01:39 EST 1996 + +The manyfiles test fails under SunOS 4.1.4. There appears to be some +bug in libc (shared and static) for SunOS 4.1.4. I got a working gawk +binary by linking in /usr/5lib/libc.a statically. + + +,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-, + Jim Farrell | phone 610-940-6020 | Platinum technology +Systems Administrator | vmail 800-526-9096 x7512 | 620 W. Germantown Pike + jwf@platinum.com | fax 610-940-6021 | Plymouth Meeting,Pa,19462 +'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~' diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tandem b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tandem new file mode 100644 index 0000000..3f7ba93 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tandem @@ -0,0 +1,33 @@ +The Tandem port was done on a Cyclone machine running D20. +The port is pretty clean and all facilities seem to work except for +some of the I/O piping stuff which is just too foreign a concept for +Tandem. + +Usage is as for UNIX except that D20 requires all "{" and "}" characters +to be escaped with "~" on the command line (not in script files) and the +standard Tandem syntax for "/in filename,out filename/" must be used +instead of the usual UNIX "<" and ">" for file redirection. (Redirection +options on getline, print etc are supported.) + +The -mr=val option has been "stolen" to enable Tandem users to +process fixed-length records with no "end-of-line" character. That +is, -mr=74 tells gawk to read the input file as fixed 74-byte +records. + +To build a Tandem executable from source, down-load all of the files +so that the file names on the Tandem box are, for example ARRAYC or +AWKH. That is, make all of the file names conform to the restrictions +of D20. The "totally Tandem-specific" files are in the tandem +"subvolume" and should be copied to the main src directory before +building gawk. + +The file compit can then be used to compile and bind an executable. +Sorry, no make and no autoconfig. + +This is my first UNIX port to Tandem so I may well have missed the best +way of doing things: I just desperately needed a working awk at a +Tandem shop. + +Cheers, +Stephen Davies +(scldad@sdc.com.au) diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tests b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tests new file mode 100644 index 0000000..4b3d74b --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tests @@ -0,0 +1,45 @@ +Date: Sat, 22 Apr 2000 06:07:06 -0600 (MDT) +From: "Nelson H. F. Beebe" <beebe@math.utah.edu> +Cc: beebe@math.utah.edu, sysstaff@math.utah.edu, othmer@math.utah.edu +Subject: gawk-3.0.4 and a GNU/Linux gotcha + +Yesterday, I was assisting a colleague install some software on his +GNU/Linux machine for which uname -r reports 2.2.14. + +A (mis)feature of this system, which I've never encountered before, +broke the build of one of my programs, and also of gawk-3.0.4. + +Namely, the kernel will not execute anything that resides in /tmp, +though it will if the same script is in /usr/tmp! + +% cat /tmp/foo.sh +#! /bin/sh +echo hello + +ls -l /tmp/foo.sh +-rwxr-xr-x 1 othmer math 22 Apr 21 10:34 /tmp/foo.sh* + +% /tmp/foo.sh +bash: /tmp/foo.sh: Permission denied + +% cp /tmp/foo.sh /usr/tmp + +% /usr/tmp/foo.sh +hello + +Thus, programs that do a temporary install in /tmp, as some of mine do +in order to run the validation suite, will fail. + +gawk-3.0.4, and likely other gawk versions, hits this problem too. It +fails because test/poundbang starts with + +#! /tmp/gawk -f + +I tracked down where it comes from: + +% grep /tmp /etc/fstab +/dev/hda3 /tmp ext2 rw,nosuid,noexec,nouser,auto,async,nodev 1 1 + !!!!!! + +Since this is done via a mount command, potentially ANY directory tree +could be mounted with noexec. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/README.card b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/README.card new file mode 100644 index 0000000..ef77cda --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/README.card @@ -0,0 +1,19 @@ +Mon Dec 9 12:45:48 EST 1996 + +The AWK reference card included here requires a modern version of troff +(ditroff). GNU Troff (groff) is known to work. + +If your troff is able to produce Postscript but does not know how to +properly use the macros from `colors' file then try to uncomment in +Makefile the defintion which sets AWKCARD to awkcard.nc (no colors). +This will definitely require changes to the TROFF macro and you have to +ensure that the tbl preprocessor is called. For example, the following +modifications on NeXT: + +TROFF = tbl +SEDME = ptroff -t | sed -e \ + "s/^level0 restore/level0 restore flashme 100 72 moveto\ + (Copyright `date`, FSF, Inc. (all)) show/" \ + -e "s/^\/level0 save def/\/level0 save def 30 -48 translate/" + +will produce a correctly formatted, albeit monochromatic, reference card. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawk.info b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawk.info new file mode 100644 index 0000000..98e33fb --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawk.info @@ -0,0 +1,24684 @@ +INFO-DIR-SECTION Text creation and manipulation +START-INFO-DIR-ENTRY +This is gawk.info, produced by makeinfo version 4.11 from gawk.texi. + +* Gawk: (gawk). A text scanning and processing language. +END-INFO-DIR-ENTRY +INFO-DIR-SECTION Individual utilities +START-INFO-DIR-ENTRY +* awk: (gawk)Invoking gawk. Text scanning and processing. +END-INFO-DIR-ENTRY + + Copyright (C) 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000, +2001, 2002, 2003, 2004, 2005, 2007 Free Software Foundation, Inc. + + + This is Edition 3 of `GAWK: Effective AWK Programming: A User's +Guide for GNU Awk', for the 3.1.6 (or later) version of the GNU +implementation of AWK. + + Permission is granted to copy, distribute and/or modify this document +under the terms of the GNU Free Documentation License, Version 1.2 or +any later version published by the Free Software Foundation; with the +Invariant Sections being "GNU General Public License", the Front-Cover +texts being (a) (see below), and with the Back-Cover Texts being (b) +(see below). A copy of the license is included in the section entitled +"GNU Free Documentation License". + + a. "A GNU Manual" + + b. "You have freedom to copy and modify this GNU Manual, like GNU + software. Copies published by the Free Software Foundation raise + funds for GNU development." + + +File: gawk.info, Node: Top, Next: Foreword, Up: (dir) + +General Introduction +******************** + +This file documents `awk', a program that you can use to select +particular records in a file and perform operations upon them. + + Copyright (C) 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000, +2001, 2002, 2003, 2004, 2005, 2007 Free Software Foundation, Inc. + + + This is Edition 3 of `GAWK: Effective AWK Programming: A User's +Guide for GNU Awk', for the 3.1.6 (or later) version of the GNU +implementation of AWK. + + Permission is granted to copy, distribute and/or modify this document +under the terms of the GNU Free Documentation License, Version 1.2 or +any later version published by the Free Software Foundation; with the +Invariant Sections being "GNU General Public License", the Front-Cover +texts being (a) (see below), and with the Back-Cover Texts being (b) +(see below). A copy of the license is included in the section entitled +"GNU Free Documentation License". + + a. "A GNU Manual" + + b. "You have freedom to copy and modify this GNU Manual, like GNU + software. Copies published by the Free Software Foundation raise + funds for GNU development." + +* Menu: + +* Foreword:: Some nice words about this + Info file. +* Preface:: What this Info file is about; brief + history and acknowledgments. +* Getting Started:: A basic introduction to using + `awk'. How to run an `awk' + program. Command-line syntax. +* Regexp:: All about matching things using regular + expressions. +* Reading Files:: How to read files and manipulate fields. +* Printing:: How to print using `awk'. Describes + the `print' and `printf' + statements. Also describes redirection of + output. +* Expressions:: Expressions are the basic building blocks + of statements. +* Patterns and Actions:: Overviews of patterns and actions. +* Arrays:: The description and use of arrays. Also + includes array-oriented control statements. +* Functions:: Built-in and user-defined functions. +* Internationalization:: Getting `gawk' to speak your + language. +* Advanced Features:: Stuff for advanced users, specific to + `gawk'. +* Invoking Gawk:: How to run `gawk'. +* Library Functions:: A Library of `awk' Functions. +* Sample Programs:: Many `awk' programs with complete + explanations. +* Language History:: The evolution of the `awk' + language. +* Installation:: Installing `gawk' under various + operating systems. +* Notes:: Notes about `gawk' extensions and + possible future work. +* Basic Concepts:: A very quick introduction to programming + concepts. +* Glossary:: An explanation of some unfamiliar terms. +* Copying:: Your right to copy and distribute + `gawk'. +* GNU Free Documentation License:: The license for this Info file. +* Index:: Concept and Variable Index. + +* History:: The history of `gawk' and + `awk'. +* Names:: What name to use to find `awk'. +* This Manual:: Using this Info file. Includes + sample input files that you can use. +* Conventions:: Typographical Conventions. +* Manual History:: Brief history of the GNU project and this + Info file. +* How To Contribute:: Helping to save the world. +* Acknowledgments:: Acknowledgments. +* Running gawk:: How to run `gawk' programs; + includes command-line syntax. +* One-shot:: Running a short throwaway `awk' + program. +* Read Terminal:: Using no input files (input from terminal + instead). +* Long:: Putting permanent `awk' programs in + files. +* Executable Scripts:: Making self-contained `awk' + programs. +* Comments:: Adding documentation to `gawk' + programs. +* Quoting:: More discussion of shell quoting issues. +* Sample Data Files:: Sample data files for use in the + `awk' programs illustrated in this + Info file. +* Very Simple:: A very simple example. +* Two Rules:: A less simple one-line example using two + rules. +* More Complex:: A more complex example. +* Statements/Lines:: Subdividing or combining statements into + lines. +* Other Features:: Other Features of `awk'. +* When:: When to use `gawk' and when to use + other things. +* Regexp Usage:: How to Use Regular Expressions. +* Escape Sequences:: How to write nonprinting characters. +* Regexp Operators:: Regular Expression Operators. +* Character Lists:: What can go between `[...]'. +* GNU Regexp Operators:: Operators specific to GNU software. +* Case-sensitivity:: How to do case-insensitive matching. +* Leftmost Longest:: How much text matches. +* Computed Regexps:: Using Dynamic Regexps. +* Locales:: How the locale affects things. +* Records:: Controlling how data is split into records. +* Fields:: An introduction to fields. +* Nonconstant Fields:: Nonconstant Field Numbers. +* Changing Fields:: Changing the Contents of a Field. +* Field Separators:: The field separator and how to change it. +* Regexp Field Splitting:: Using regexps as the field separator. +* Single Character Fields:: Making each character a separate field. +* Command Line Field Separator:: Setting `FS' from the command-line. +* Field Splitting Summary:: Some final points and a summary table. +* Constant Size:: Reading constant width data. +* Multiple Line:: Reading multi-line records. +* Getline:: Reading files under explicit program + control using the `getline' function. +* Plain Getline:: Using `getline' with no arguments. +* Getline/Variable:: Using `getline' into a variable. +* Getline/File:: Using `getline' from a file. +* Getline/Variable/File:: Using `getline' into a variable from a + file. +* Getline/Pipe:: Using `getline' from a pipe. +* Getline/Variable/Pipe:: Using `getline' into a variable from a + pipe. +* Getline/Coprocess:: Using `getline' from a coprocess. +* Getline/Variable/Coprocess:: Using `getline' into a variable from a + coprocess. +* Getline Notes:: Important things to know about + `getline'. +* Getline Summary:: Summary of `getline' Variants. +* Print:: The `print' statement. +* Print Examples:: Simple examples of `print' statements. +* Output Separators:: The output separators and how to change + them. +* OFMT:: Controlling Numeric Output With + `print'. +* Printf:: The `printf' statement. +* Basic Printf:: Syntax of the `printf' statement. +* Control Letters:: Format-control letters. +* Format Modifiers:: Format-specification modifiers. +* Printf Examples:: Several examples. +* Redirection:: How to redirect output to multiple files + and pipes. +* Special Files:: File name interpretation in `gawk'. + `gawk' allows access to inherited + file descriptors. +* Special FD:: Special files for I/O. +* Special Process:: Special files for process information. +* Special Network:: Special files for network communications. +* Special Caveats:: Things to watch out for. +* Close Files And Pipes:: Closing Input and Output Files and Pipes. +* Constants:: String, numeric and regexp constants. +* Scalar Constants:: Numeric and string constants. +* Nondecimal-numbers:: What are octal and hex numbers. +* Regexp Constants:: Regular Expression constants. +* Using Constant Regexps:: When and how to use a regexp constant. +* Variables:: Variables give names to values for later + use. +* Using Variables:: Using variables in your programs. +* Assignment Options:: Setting variables on the command-line and a + summary of command-line syntax. This is an + advanced method of input. +* Conversion:: The conversion of strings to numbers and + vice versa. +* Arithmetic Ops:: Arithmetic operations (`+', `-', + etc.) +* Concatenation:: Concatenating strings. +* Assignment Ops:: Changing the value of a variable or a + field. +* Increment Ops:: Incrementing the numeric value of a + variable. +* Truth Values:: What is ``true'' and what is ``false''. +* Typing and Comparison:: How variables acquire types and how this + affects comparison of numbers and strings + with `<', etc. +* Variable Typing:: String type versus numeric type. +* Comparison Operators:: The comparison operators. +* Boolean Ops:: Combining comparison expressions using + boolean operators `||' (``or''), + `&&' (``and'') and `!' (``not''). +* Conditional Exp:: Conditional expressions select between two + subexpressions under control of a third + subexpression. +* Function Calls:: A function call is an expression. +* Precedence:: How various operators nest. +* Pattern Overview:: What goes into a pattern. +* Regexp Patterns:: Using regexps as patterns. +* Expression Patterns:: Any expression can be used as a pattern. +* Ranges:: Pairs of patterns specify record ranges. +* BEGIN/END:: Specifying initialization and cleanup + rules. +* Using BEGIN/END:: How and why to use BEGIN/END rules. +* I/O And BEGIN/END:: I/O issues in BEGIN/END rules. +* Empty:: The empty pattern, which matches every + record. +* Using Shell Variables:: How to use shell variables with + `awk'. +* Action Overview:: What goes into an action. +* Statements:: Describes the various control statements in + detail. +* If Statement:: Conditionally execute some `awk' + statements. +* While Statement:: Loop until some condition is satisfied. +* Do Statement:: Do specified action while looping until + some condition is satisfied. +* For Statement:: Another looping statement, that provides + initialization and increment clauses. +* Switch Statement:: Switch/case evaluation for conditional + execution of statements based on a value. +* Break Statement:: Immediately exit the innermost enclosing + loop. +* Continue Statement:: Skip to the end of the innermost enclosing + loop. +* Next Statement:: Stop processing the current input record. +* Nextfile Statement:: Stop processing the current file. +* Exit Statement:: Stop execution of `awk'. +* Built-in Variables:: Summarizes the built-in variables. +* User-modified:: Built-in variables that you change to + control `awk'. +* Auto-set:: Built-in variables where `awk' + gives you information. +* ARGC and ARGV:: Ways to use `ARGC' and `ARGV'. +* Array Intro:: Introduction to Arrays +* Reference to Elements:: How to examine one element of an array. +* Assigning Elements:: How to change an element of an array. +* Array Example:: Basic Example of an Array +* Scanning an Array:: A variation of the `for' statement. It + loops through the indices of an array's + existing elements. +* Delete:: The `delete' statement removes an + element from an array. +* Numeric Array Subscripts:: How to use numbers as subscripts in + `awk'. +* Uninitialized Subscripts:: Using Uninitialized variables as + subscripts. +* Multi-dimensional:: Emulating multidimensional arrays in + `awk'. +* Multi-scanning:: Scanning multidimensional arrays. +* Array Sorting:: Sorting array values and indices. +* Built-in:: Summarizes the built-in functions. +* Calling Built-in:: How to call built-in functions. +* Numeric Functions:: Functions that work with numbers, including + `int', `sin' and `rand'. +* String Functions:: Functions for string manipulation, such as + `split', `match' and + `sprintf'. +* Gory Details:: More than you want to know about `\' + and `&' with `sub', `gsub', + and `gensub'. +* I/O Functions:: Functions for files and shell commands. +* Time Functions:: Functions for dealing with timestamps. +* Bitwise Functions:: Functions for bitwise operations. +* I18N Functions:: Functions for string translation. +* User-defined:: Describes User-defined functions in detail. +* Definition Syntax:: How to write definitions and what they + mean. +* Function Example:: An example function definition and what it + does. +* Function Caveats:: Things to watch out for. +* Return Statement:: Specifying the value a function returns. +* Dynamic Typing:: How variable types can change at runtime. +* I18N and L10N:: Internationalization and Localization. +* Explaining gettext:: How GNU `gettext' works. +* Programmer i18n:: Features for the programmer. +* Translator i18n:: Features for the translator. +* String Extraction:: Extracting marked strings. +* Printf Ordering:: Rearranging `printf' arguments. +* I18N Portability:: `awk'-level portability issues. +* I18N Example:: A simple i18n example. +* Gawk I18N:: `gawk' is also internationalized. +* Nondecimal Data:: Allowing nondecimal input data. +* Two-way I/O:: Two-way communications with another + process. +* TCP/IP Networking:: Using `gawk' for network + programming. +* Portal Files:: Using `gawk' with BSD portals. +* Profiling:: Profiling your `awk' programs. +* Command Line:: How to run `awk'. +* Options:: Command-line options and their meanings. +* Other Arguments:: Input file names and variable assignments. +* AWKPATH Variable:: Searching directories for `awk' + programs. +* Obsolete:: Obsolete Options and/or features. +* Undocumented:: Undocumented Options and Features. +* Known Bugs:: Known Bugs in `gawk'. +* Library Names:: How to best name private global variables + in library functions. +* General Functions:: Functions that are of general use. +* Nextfile Function:: Two implementations of a `nextfile' + function. +* Assert Function:: A function for assertions in `awk' + programs. +* Round Function:: A function for rounding if `sprintf' + does not do it correctly. +* Cliff Random Function:: The Cliff Random Number Generator. +* Ordinal Functions:: Functions for using characters as numbers + and vice versa. +* Join Function:: A function to join an array into a string. +* Gettimeofday Function:: A function to get formatted times. +* Data File Management:: Functions for managing command-line data + files. +* Filetrans Function:: A function for handling data file + transitions. +* Rewind Function:: A function for rereading the current file. +* File Checking:: Checking that data files are readable. +* Empty Files:: Checking for zero-length files. +* Ignoring Assigns:: Treating assignments as file names. +* Getopt Function:: A function for processing command-line + arguments. +* Passwd Functions:: Functions for getting user information. +* Group Functions:: Functions for getting group information. +* Running Examples:: How to run these examples. +* Clones:: Clones of common utilities. +* Cut Program:: The `cut' utility. +* Egrep Program:: The `egrep' utility. +* Id Program:: The `id' utility. +* Split Program:: The `split' utility. +* Tee Program:: The `tee' utility. +* Uniq Program:: The `uniq' utility. +* Wc Program:: The `wc' utility. +* Miscellaneous Programs:: Some interesting `awk' programs. +* Dupword Program:: Finding duplicated words in a document. +* Alarm Program:: An alarm clock. +* Translate Program:: A program similar to the `tr' + utility. +* Labels Program:: Printing mailing labels. +* Word Sorting:: A program to produce a word usage count. +* History Sorting:: Eliminating duplicate entries from a + history file. +* Extract Program:: Pulling out programs from Texinfo source + files. +* Simple Sed:: A Simple Stream Editor. +* Igawk Program:: A wrapper for `awk' that includes + files. +* V7/SVR3.1:: The major changes between V7 and System V + Release 3.1. +* SVR4:: Minor changes between System V Releases 3.1 + and 4. +* POSIX:: New features from the POSIX standard. +* BTL:: New features from the Bell Laboratories + version of `awk'. +* POSIX/GNU:: The extensions in `gawk' not in + POSIX `awk'. +* Contributors:: The major contributors to `gawk'. +* Gawk Distribution:: What is in the `gawk' distribution. +* Getting:: How to get the distribution. +* Extracting:: How to extract the distribution. +* Distribution contents:: What is in the distribution. +* Unix Installation:: Installing `gawk' under various + versions of Unix. +* Quick Installation:: Compiling `gawk' under Unix. +* Additional Configuration Options:: Other compile-time options. +* Configuration Philosophy:: How it's all supposed to work. +* Non-Unix Installation:: Installation on Other Operating Systems. +* Amiga Installation:: Installing `gawk' on an Amiga. +* BeOS Installation:: Installing `gawk' on BeOS. +* PC Installation:: Installing and Compiling `gawk' on + MS-DOS and OS/2. +* PC Binary Installation:: Installing a prepared distribution. +* PC Compiling:: Compiling `gawk' for MS-DOS, Windows32, + and OS/2. +* PC Using:: Running `gawk' on MS-DOS, Windows32 and + OS/2. +* PC Dynamic:: Compiling `gawk' for dynamic + libraries. +* Cygwin:: Building and running `gawk' for + Cygwin. +* VMS Installation:: Installing `gawk' on VMS. +* VMS Compilation:: How to compile `gawk' under VMS. +* VMS Installation Details:: How to install `gawk' under VMS. +* VMS Running:: How to run `gawk' under VMS. +* VMS POSIX:: Alternate instructions for VMS POSIX. +* VMS Old Gawk:: An old version comes with some VMS systems. +* Unsupported:: Systems whose ports are no longer + supported. +* Atari Installation:: Installing `gawk' on the Atari ST. +* Atari Compiling:: Compiling `gawk' on Atari. +* Atari Using:: Running `gawk' on Atari. +* Tandem Installation:: Installing `gawk' on a Tandem. +* Bugs:: Reporting Problems and Bugs. +* Other Versions:: Other freely available `awk' + implementations. +* Compatibility Mode:: How to disable certain `gawk' + extensions. +* Additions:: Making Additions To `gawk'. +* Adding Code:: Adding code to the main body of + `gawk'. +* New Ports:: Porting `gawk' to a new operating + system. +* Dynamic Extensions:: Adding new built-in functions to + `gawk'. +* Internals:: A brief look at some `gawk' + internals. +* Sample Library:: A example of new functions. +* Internal File Description:: What the new functions will do. +* Internal File Ops:: The code for internal file operations. +* Using Internal File Ops:: How to use an external extension. +* Future Extensions:: New features that may be implemented one + day. +* Basic High Level:: The high level view. +* Basic Data Typing:: A very quick intro to data types. +* Floating Point Issues:: Stuff to know about floating-point numbers. +* String Conversion Precision:: The String Value Can Lie. +* Unexpected Results:: Floating Point Numbers Are Not + Abstract Numbers. +* POSIX Floating Point Problems:: Standards Versus Existing Practice. + + To Miriam, for making me complete. + + To Chana, for the joy you bring us. + + To Rivka, for the exponential increase. + + To Nachum, for the added dimension. + + To Malka, for the new beginning. + +File: gawk.info, Node: Foreword, Next: Preface, Prev: Top, Up: Top + +Foreword +******** + +Arnold Robbins and I are good friends. We were introduced 11 years ago +by circumstances--and our favorite programming language, AWK. The +circumstances started a couple of years earlier. I was working at a new +job and noticed an unplugged Unix computer sitting in the corner. No +one knew how to use it, and neither did I. However, a couple of days +later it was running, and I was `root' and the one-and-only user. That +day, I began the transition from statistician to Unix programmer. + + On one of many trips to the library or bookstore in search of books +on Unix, I found the gray AWK book, a.k.a. Aho, Kernighan and +Weinberger, `The AWK Programming Language', Addison-Wesley, 1988. +AWK's simple programming paradigm--find a pattern in the input and then +perform an action--often reduced complex or tedious data manipulations +to few lines of code. I was excited to try my hand at programming in +AWK. + + Alas, the `awk' on my computer was a limited version of the +language described in the AWK book. I discovered that my computer had +"old `awk'" and the AWK book described "new `awk'." I learned that +this was typical; the old version refused to step aside or relinquish +its name. If a system had a new `awk', it was invariably called +`nawk', and few systems had it. The best way to get a new `awk' was to +`ftp' the source code for `gawk' from `prep.ai.mit.edu'. `gawk' was a +version of new `awk' written by David Trueman and Arnold, and available +under the GNU General Public License. + + (Incidentally, it's no longer difficult to find a new `awk'. `gawk' +ships with Linux, and you can download binaries or source code for +almost any system; my wife uses `gawk' on her VMS box.) + + My Unix system started out unplugged from the wall; it certainly was +not plugged into a network. So, oblivious to the existence of `gawk' +and the Unix community in general, and desiring a new `awk', I wrote my +own, called `mawk'. Before I was finished I knew about `gawk', but it +was too late to stop, so I eventually posted to a `comp.sources' +newsgroup. + + A few days after my posting, I got a friendly email from Arnold +introducing himself. He suggested we share design and algorithms and +attached a draft of the POSIX standard so that I could update `mawk' to +support language extensions added after publication of the AWK book. + + Frankly, if our roles had been reversed, I would not have been so +open and we probably would have never met. I'm glad we did meet. He +is an AWK expert's AWK expert and a genuinely nice person. Arnold +contributes significant amounts of his expertise and time to the Free +Software Foundation. + + This book is the `gawk' reference manual, but at its core it is a +book about AWK programming that will appeal to a wide audience. It is +a definitive reference to the AWK language as defined by the 1987 Bell +Labs release and codified in the 1992 POSIX Utilities standard. + + On the other hand, the novice AWK programmer can study a wealth of +practical programs that emphasize the power of AWK's basic idioms: data +driven control-flow, pattern matching with regular expressions, and +associative arrays. Those looking for something new can try out +`gawk''s interface to network protocols via special `/inet' files. + + The programs in this book make clear that an AWK program is +typically much smaller and faster to develop than a counterpart written +in C. Consequently, there is often a payoff to prototype an algorithm +or design in AWK to get it running quickly and expose problems early. +Often, the interpreted performance is adequate and the AWK prototype +becomes the product. + + The new `pgawk' (profiling `gawk'), produces program execution +counts. I recently experimented with an algorithm that for n lines of +input, exhibited ~ C n^2 performance, while theory predicted ~ C n log n +behavior. A few minutes poring over the `awkprof.out' profile +pinpointed the problem to a single line of code. `pgawk' is a welcome +addition to my programmer's toolbox. + + Arnold has distilled over a decade of experience writing and using +AWK programs, and developing `gawk', into this book. If you use AWK or +want to learn how, then read this book. + + Michael Brennan + Author of `mawk' + + +File: gawk.info, Node: Preface, Next: Getting Started, Prev: Foreword, Up: Top + +Preface +******* + +Several kinds of tasks occur repeatedly when working with text files. +You might want to extract certain lines and discard the rest. Or you +may need to make changes wherever certain patterns appear, but leave +the rest of the file alone. Writing single-use programs for these +tasks in languages such as C, C++, or Pascal is time-consuming and +inconvenient. Such jobs are often easier with `awk'. The `awk' +utility interprets a special-purpose programming language that makes it +easy to handle simple data-reformatting jobs. + + The GNU implementation of `awk' is called `gawk'; it is fully +compatible with the System V Release 4 version of `awk'. `gawk' is +also compatible with the POSIX specification of the `awk' language. +This means that all properly written `awk' programs should work with +`gawk'. Thus, we usually don't distinguish between `gawk' and other +`awk' implementations. + + Using `awk' allows you to: + + * Manage small, personal databases + + * Generate reports + + * Validate data + + * Produce indexes and perform other document preparation tasks + + * Experiment with algorithms that you can adapt later to other + computer languages + + In addition, `gawk' provides facilities that make it easy to: + + * Extract bits and pieces of data for processing + + * Sort data + + * Perform simple network communications + + This Info file teaches you about the `awk' language and how you can +use it effectively. You should already be familiar with basic system +commands, such as `cat' and `ls',(1) as well as basic shell facilities, +such as input/output (I/O) redirection and pipes. + + Implementations of the `awk' language are available for many +different computing environments. This Info file, while describing the +`awk' language in general, also describes the particular implementation +of `awk' called `gawk' (which stands for "GNU awk"). `gawk' runs on a +broad range of Unix systems, ranging from 80386 PC-based computers up +through large-scale systems, such as Crays. `gawk' has also been ported +to Mac OS X, MS-DOS, Microsoft Windows (all versions) and OS/2 PCs, +Atari and Amiga microcomputers, BeOS, Tandem D20, and VMS. + +* Menu: + +* History:: The history of `gawk' and + `awk'. +* Names:: What name to use to find `awk'. +* This Manual:: Using this Info file. Includes sample + input files that you can use. +* Conventions:: Typographical Conventions. +* Manual History:: Brief history of the GNU project and this + Info file. +* How To Contribute:: Helping to save the world. +* Acknowledgments:: Acknowledgments. + + ---------- Footnotes ---------- + + (1) These commands are available on POSIX-compliant systems, as well +as on traditional Unix-based systems. If you are using some other +operating system, you still need to be familiar with the ideas of I/O +redirection and pipes. + + +File: gawk.info, Node: History, Next: Names, Up: Preface + +History of `awk' and `gawk' +=========================== + + Recipe For A Programming Language + + 1 part `egrep' 1 part `snobol' + 2 parts `ed' 3 parts C + + Blend all parts well using `lex' and `yacc'. Document minimally + and release. + + After eight years, add another part `egrep' and two more parts C. + Document very well and release. + + The name `awk' comes from the initials of its designers: Alfred V. +Aho, Peter J. Weinberger and Brian W. Kernighan. The original version +of `awk' was written in 1977 at AT&T Bell Laboratories. In 1985, a new +version made the programming language more powerful, introducing +user-defined functions, multiple input streams, and computed regular +expressions. This new version became widely available with Unix System +V Release 3.1 (SVR3.1). The version in SVR4 added some new features +and cleaned up the behavior in some of the "dark corners" of the +language. The specification for `awk' in the POSIX Command Language +and Utilities standard further clarified the language. Both the `gawk' +designers and the original Bell Laboratories `awk' designers provided +feedback for the POSIX specification. + + Paul Rubin wrote the GNU implementation, `gawk', in 1986. Jay +Fenlason completed it, with advice from Richard Stallman. John Woods +contributed parts of the code as well. In 1988 and 1989, David +Trueman, with help from me, thoroughly reworked `gawk' for compatibility +with the newer `awk'. Circa 1995, I became the primary maintainer. +Current development focuses on bug fixes, performance improvements, +standards compliance, and occasionally, new features. + + In May of 1997, Ju"rgen Kahrs felt the need for network access from +`awk', and with a little help from me, set about adding features to do +this for `gawk'. At that time, he also wrote the bulk of `TCP/IP +Internetworking with `gawk'' (a separate document, available as part of +the `gawk' distribution). His code finally became part of the main +`gawk' distribution with `gawk' version 3.1. + + *Note Contributors::, for a complete list of those who made +important contributions to `gawk'. + + +File: gawk.info, Node: Names, Next: This Manual, Prev: History, Up: Preface + +A Rose by Any Other Name +======================== + +The `awk' language has evolved over the years. Full details are +provided in *note Language History::. The language described in this +Info file is often referred to as "new `awk'" (`nawk'). + + Because of this, many systems have multiple versions of `awk'. Some +systems have an `awk' utility that implements the original version of +the `awk' language and a `nawk' utility for the new version. Others +have an `oawk' version for the "old `awk'" language and plain `awk' for +the new one. Still others only have one version, which is usually the +new one.(1) + + All in all, this makes it difficult for you to know which version of +`awk' you should run when writing your programs. The best advice I can +give here is to check your local documentation. Look for `awk', `oawk', +and `nawk', as well as for `gawk'. It is likely that you already have +some version of new `awk' on your system, which is what you should use +when running your programs. (Of course, if you're reading this Info +file, chances are good that you have `gawk'!) + + Throughout this Info file, whenever we refer to a language feature +that should be available in any complete implementation of POSIX `awk', +we simply use the term `awk'. When referring to a feature that is +specific to the GNU implementation, we use the term `gawk'. + + ---------- Footnotes ---------- + + (1) Often, these systems use `gawk' for their `awk' implementation! + + +File: gawk.info, Node: This Manual, Next: Conventions, Prev: Names, Up: Preface + +Using This Book +=============== + +The term `awk' refers to a particular program as well as to the +language you use to tell this program what to do. When we need to be +careful, we call the language "the `awk' language," and the program +"the `awk' utility." This Info file explains both the `awk' language +and how to run the `awk' utility. The term "`awk' program" refers to a +program written by you in the `awk' programming language. + + Primarily, this Info file explains the features of `awk', as defined +in the POSIX standard. It does so in the context of the `gawk' +implementation. While doing so, it also attempts to describe important +differences between `gawk' and other `awk' implementations.(1) Finally, +any `gawk' features that are not in the POSIX standard for `awk' are +noted. + + There are subsections labelled as *Advanced Notes* scattered +throughout the Info file. They add a more complete explanation of +points that are relevant, but not likely to be of interest on first +reading. All appear in the index, under the heading "advanced +features." + + Most of the time, the examples use complete `awk' programs. In some +of the more advanced sections, only the part of the `awk' program that +illustrates the concept currently being described is shown. + + While this Info file is aimed principally at people who have not been +exposed to `awk', there is a lot of information here that even the `awk' +expert should find useful. In particular, the description of POSIX +`awk' and the example programs in *note Library Functions::, and in +*note Sample Programs::, should be of interest. + + *note Getting Started::, provides the essentials you need to know to +begin using `awk'. + + *note Regexp::, introduces regular expressions in general, and in +particular the flavors supported by POSIX `awk' and `gawk'. + + *note Reading Files::, describes how `awk' reads your data. It +introduces the concepts of records and fields, as well as the `getline' +command. I/O redirection is first described here. + + *note Printing::, describes how `awk' programs can produce output +with `print' and `printf'. + + *note Expressions::, describes expressions, which are the basic +building blocks for getting most things done in a program. + + *note Patterns and Actions::, describes how to write patterns for +matching records, actions for doing something when a record is matched, +and the built-in variables `awk' and `gawk' use. + + *note Arrays::, covers `awk''s one-and-only data structure: +associative arrays. Deleting array elements and whole arrays is also +described, as well as sorting arrays in `gawk'. + + *note Functions::, describes the built-in functions `awk' and `gawk' +provide, as well as how to define your own functions. + + *note Internationalization::, describes special features in `gawk' +for translating program messages into different languages at runtime. + + *note Advanced Features::, describes a number of `gawk'-specific +advanced features. Of particular note are the abilities to have +two-way communications with another process, perform TCP/IP networking, +and profile your `awk' programs. + + *note Invoking Gawk::, describes how to run `gawk', the meaning of +its command-line options, and how it finds `awk' program source files. + + *note Library Functions::, and *note Sample Programs::, provide many +sample `awk' programs. Reading them allows you to see `awk' solving +real problems. + + *note Language History::, describes how the `awk' language has +evolved since first release to present. It also describes how `gawk' +has acquired features over time. + + *note Installation::, describes how to get `gawk', how to compile it +under Unix, and how to compile and use it on different non-Unix +systems. It also describes how to report bugs in `gawk' and where to +get three other freely available implementations of `awk'. + + *note Notes::, describes how to disable `gawk''s extensions, as well +as how to contribute new code to `gawk', how to write extension +libraries, and some possible future directions for `gawk' development. + + *note Basic Concepts::, provides some very cursory background +material for those who are completely unfamiliar with computer +programming. Also centralized there is a discussion of some of the +issues surrounding floating-point numbers. + + The *note Glossary::, defines most, if not all, the significant +terms used throughout the book. If you find terms that you aren't +familiar with, try looking them up here. + + *note Copying::, and *note GNU Free Documentation License::, present +the licenses that cover the `gawk' source code and this Info file, +respectively. + + ---------- Footnotes ---------- + + (1) All such differences appear in the index under the entry +"differences in `awk' and `gawk'." + + +File: gawk.info, Node: Conventions, Next: Manual History, Prev: This Manual, Up: Preface + +Typographical Conventions +========================= + +This Info file is written using Texinfo, the GNU documentation +formatting language. A single Texinfo source file is used to produce +both the printed and online versions of the documentation. This minor +node briefly documents the typographical conventions used in Texinfo. + + Examples you would type at the command-line are preceded by the +common shell primary and secondary prompts, `$' and `>'. Output from +the command is preceded by the glyph "-|". This typically represents +the command's standard output. Error messages, and other output on the +command's standard error, are preceded by the glyph "error-->". For +example: + + $ echo hi on stdout + -| hi on stdout + $ echo hello on stderr 1>&2 + error--> hello on stderr + + Characters that you type at the keyboard look `like this'. In +particular, there are special characters called "control characters." +These are characters that you type by holding down both the `CONTROL' +key and another key, at the same time. For example, a `Ctrl-d' is typed +by first pressing and holding the `CONTROL' key, next pressing the `d' +key and finally releasing both keys. + +Dark Corners +............ + + Dark corners are basically fractal -- no matter how much you + illuminate, there's always a smaller but darker one. + Brian Kernighan + + Until the POSIX standard (and `The Gawk Manual'), many features of +`awk' were either poorly documented or not documented at all. +Descriptions of such features (often called "dark corners") are noted +in this Info file with "(d.c.)". They also appear in the index under +the heading "dark corner." + + As noted by the opening quote, though, any coverage of dark corners +is, by definition, something that is incomplete. + + +File: gawk.info, Node: Manual History, Next: How To Contribute, Prev: Conventions, Up: Preface + +The GNU Project and This Book +============================= + +The Free Software Foundation (FSF) is a nonprofit organization dedicated +to the production and distribution of freely distributable software. +It was founded by Richard M. Stallman, the author of the original Emacs +editor. GNU Emacs is the most widely used version of Emacs today. + + The GNU(1) Project is an ongoing effort on the part of the Free +Software Foundation to create a complete, freely distributable, +POSIX-compliant computing environment. The FSF uses the "GNU General +Public License" (GPL) to ensure that their software's source code is +always available to the end user. A copy of the GPL is included for +your reference (*note Copying::). The GPL applies to the C language +source code for `gawk'. To find out more about the FSF and the GNU +Project online, see the GNU Project's home page (http://www.gnu.org). +This Info file may also be read from their web site +(http://www.gnu.org/software/gawk/manual/). + + A shell, an editor (Emacs), highly portable optimizing C, C++, and +Objective-C compilers, a symbolic debugger and dozens of large and +small utilities (such as `gawk'), have all been completed and are +freely available. The GNU operating system kernel (the HURD), has been +released but is still in an early stage of development. + + Until the GNU operating system is more fully developed, you should +consider using GNU/Linux, a freely distributable, Unix-like operating +system for Intel 80386, DEC Alpha, Sun SPARC, IBM S/390, and other +systems.(2) There are many books on GNU/Linux. One that is freely +available is `Linux Installation and Getting Started', by Matt Welsh. +Many GNU/Linux distributions are often available in computer stores or +bundled on CD-ROMs with books about Linux. (There are three other +freely available, Unix-like operating systems for 80386 and other +systems: NetBSD, FreeBSD, and OpenBSD. All are based on the 4.4-Lite +Berkeley Software Distribution, and they use recent versions of `gawk' +for their versions of `awk'.) + + The Info file itself has gone through a number of previous editions. +Paul Rubin wrote the very first draft of `The GAWK Manual'; it was +around 40 pages in size. Diane Close and Richard Stallman improved it, +yielding a version that was around 90 pages long and barely described +the original, "old" version of `awk'. + + I started working with that version in the fall of 1988. As work on +it progressed, the FSF published several preliminary versions (numbered +0.X). In 1996, Edition 1.0 was released with `gawk' 3.0.0. The FSF +published the first two editions under the title `The GNU Awk User's +Guide'. + + This edition maintains the basic structure of Edition 1.0, but with +significant additional material, reflecting the host of new features in +`gawk' version 3.1. Of particular note is *note Array Sorting::, as +well as *note Bitwise Functions::, *note Internationalization::, and +also *note Advanced Features::, and *note Dynamic Extensions::. + + `GAWK: Effective AWK Programming' will undoubtedly continue to +evolve. An electronic version comes with the `gawk' distribution from +the FSF. If you find an error in this Info file, please report it! +*Note Bugs::, for information on submitting problem reports +electronically, or write to me in care of the publisher. + + ---------- Footnotes ---------- + + (1) GNU stands for "GNU's not Unix." + + (2) The terminology "GNU/Linux" is explained in the *note Glossary::. + + +File: gawk.info, Node: How To Contribute, Next: Acknowledgments, Prev: Manual History, Up: Preface + +How to Contribute +================= + +As the maintainer of GNU `awk', I am starting a collection of publicly +available `awk' programs. For more information, see +`ftp://ftp.freefriends.org/arnold/Awkstuff'. If you have written an +interesting `awk' program, or have written a `gawk' extension that you +would like to share with the rest of the world, please contact me +(<arnold@skeeve.com>). Making things available on the Internet helps +keep the `gawk' distribution down to manageable size. + + +File: gawk.info, Node: Acknowledgments, Prev: How To Contribute, Up: Preface + +Acknowledgments +=============== + +The initial draft of `The GAWK Manual' had the following +acknowledgments: + + Many people need to be thanked for their assistance in producing + this manual. Jay Fenlason contributed many ideas and sample + programs. Richard Mlynarik and Robert Chassell gave helpful + comments on drafts of this manual. The paper `A Supplemental + Document for `awk'' by John W. Pierce of the Chemistry Department + at UC San Diego, pinpointed several issues relevant both to `awk' + implementation and to this manual, that would otherwise have + escaped us. + + I would like to acknowledge Richard M. Stallman, for his vision of a +better world and for his courage in founding the FSF and starting the +GNU Project. + + The following people (in alphabetical order) provided helpful +comments on various versions of this book, up to and including this +edition. Rick Adams, Nelson H.F. Beebe, Karl Berry, Dr. Michael +Brennan, Rich Burridge, Claire Cloutier, Diane Close, Scott Deifik, +Christopher ("Topher") Eliot, Jeffrey Friedl, Dr. Darrel Hankerson, +Michal Jaegermann, Dr. Richard J. LeBlanc, Michael Lijewski, Pat Rankin, +Miriam Robbins, Mary Sheehan, and Chuck Toporek. + + Robert J. Chassell provided much valuable advice on the use of +Texinfo. He also deserves special thanks for convincing me _not_ to +title this Info file `How To Gawk Politely'. Karl Berry helped +significantly with the TeX part of Texinfo. + + I would like to thank Marshall and Elaine Hartholz of Seattle and +Dr. Bert and Rita Schreiber of Detroit for large amounts of quiet +vacation time in their homes, which allowed me to make significant +progress on this Info file and on `gawk' itself. + + Phil Hughes of SSC contributed in a very important way by loaning me +his laptop GNU/Linux system, not once, but twice, which allowed me to +do a lot of work while away from home. + + David Trueman deserves special credit; he has done a yeoman job of +evolving `gawk' so that it performs well and without bugs. Although he +is no longer involved with `gawk', working with him on this project was +a significant pleasure. + + The intrepid members of the GNITS mailing list, and most notably +Ulrich Drepper, provided invaluable help and feedback for the design of +the internationalization features. + + Nelson Beebe, Martin Brown, Andreas Buening, Scott Deifik, Darrel +Hankerson, Isamu Hasegawa, Michal Jaegermann, Ju"rgen Kahrs, Pat Rankin, +Kai Uwe Rommel, and Eli Zaretskii (in alphabetical order) make up the +`gawk' "crack portability team." Without their hard work and help, +`gawk' would not be nearly the fine program it is today. It has been +and continues to be a pleasure working with this team of fine people. + + David and I would like to thank Brian Kernighan of Bell Laboratories +for invaluable assistance during the testing and debugging of `gawk', +and for help in clarifying numerous points about the language. We +could not have done nearly as good a job on either `gawk' or its +documentation without his help. + + Chuck Toporek, Mary Sheehan, and Claire Coutier of O'Reilly & +Associates contributed significant editorial help for this Info file +for the 3.1 release of `gawk'. + + I must thank my wonderful wife, Miriam, for her patience through the +many versions of this project, for her proofreading, and for sharing me +with the computer. I would like to thank my parents for their love, +and for the grace with which they raised and educated me. Finally, I +also must acknowledge my gratitude to G-d, for the many opportunities +He has sent my way, as well as for the gifts He has given me with which +to take advantage of those opportunities. + + +Arnold Robbins +Nof Ayalon +ISRAEL +March, 2001 + + +File: gawk.info, Node: Getting Started, Next: Regexp, Prev: Preface, Up: Top + +1 Getting Started with `awk' +**************************** + +The basic function of `awk' is to search files for lines (or other +units of text) that contain certain patterns. When a line matches one +of the patterns, `awk' performs specified actions on that line. `awk' +keeps processing input lines in this way until it reaches the end of +the input files. + + Programs in `awk' are different from programs in most other +languages, because `awk' programs are "data-driven"; that is, you +describe the data you want to work with and then what to do when you +find it. Most other languages are "procedural"; you have to describe, +in great detail, every step the program is to take. When working with +procedural languages, it is usually much harder to clearly describe the +data your program will process. For this reason, `awk' programs are +often refreshingly easy to read and write. + + When you run `awk', you specify an `awk' "program" that tells `awk' +what to do. The program consists of a series of "rules". (It may also +contain "function definitions", an advanced feature that we will ignore +for now. *Note User-defined::.) Each rule specifies one pattern to +search for and one action to perform upon finding the pattern. + + Syntactically, a rule consists of a pattern followed by an action. +The action is enclosed in curly braces to separate it from the pattern. +Newlines usually separate rules. Therefore, an `awk' program looks +like this: + + PATTERN { ACTION } + PATTERN { ACTION } + ... + +* Menu: + +* Running gawk:: How to run `gawk' programs; includes + command-line syntax. +* Sample Data Files:: Sample data files for use in the `awk' + programs illustrated in this Info file. +* Very Simple:: A very simple example. +* Two Rules:: A less simple one-line example using two + rules. +* More Complex:: A more complex example. +* Statements/Lines:: Subdividing or combining statements into + lines. +* Other Features:: Other Features of `awk'. +* When:: When to use `gawk' and when to use + other things. + + +File: gawk.info, Node: Running gawk, Next: Sample Data Files, Up: Getting Started + +1.1 How to Run `awk' Programs +============================= + +There are several ways to run an `awk' program. If the program is +short, it is easiest to include it in the command that runs `awk', like +this: + + awk 'PROGRAM' INPUT-FILE1 INPUT-FILE2 ... + + When the program is long, it is usually more convenient to put it in +a file and run it with a command like this: + + awk -f PROGRAM-FILE INPUT-FILE1 INPUT-FILE2 ... + + This minor node discusses both mechanisms, along with several +variations of each. + +* Menu: + +* One-shot:: Running a short throwaway `awk' + program. +* Read Terminal:: Using no input files (input from terminal + instead). +* Long:: Putting permanent `awk' programs in + files. +* Executable Scripts:: Making self-contained `awk' programs. +* Comments:: Adding documentation to `gawk' + programs. +* Quoting:: More discussion of shell quoting issues. + + +File: gawk.info, Node: One-shot, Next: Read Terminal, Up: Running gawk + +1.1.1 One-Shot Throwaway `awk' Programs +--------------------------------------- + +Once you are familiar with `awk', you will often type in simple +programs the moment you want to use them. Then you can write the +program as the first argument of the `awk' command, like this: + + awk 'PROGRAM' INPUT-FILE1 INPUT-FILE2 ... + +where PROGRAM consists of a series of PATTERNS and ACTIONS, as +described earlier. + + This command format instructs the "shell", or command interpreter, +to start `awk' and use the PROGRAM to process records in the input +file(s). There are single quotes around PROGRAM so the shell won't +interpret any `awk' characters as special shell characters. The quotes +also cause the shell to treat all of PROGRAM as a single argument for +`awk', and allow PROGRAM to be more than one line long. + + This format is also useful for running short or medium-sized `awk' +programs from shell scripts, because it avoids the need for a separate +file for the `awk' program. A self-contained shell script is more +reliable because there are no other files to misplace. + + *note Very Simple::, presents several short, self-contained programs. + + +File: gawk.info, Node: Read Terminal, Next: Long, Prev: One-shot, Up: Running gawk + +1.1.2 Running `awk' Without Input Files +--------------------------------------- + +You can also run `awk' without any input files. If you type the +following command line: + + awk 'PROGRAM' + +`awk' applies the PROGRAM to the "standard input", which usually means +whatever you type on the terminal. This continues until you indicate +end-of-file by typing `Ctrl-d'. (On other operating systems, the +end-of-file character may be different. For example, on OS/2 and +MS-DOS, it is `Ctrl-z'.) + + As an example, the following program prints a friendly piece of +advice (from Douglas Adams's `The Hitchhiker's Guide to the Galaxy'), +to keep you from worrying about the complexities of computer programming +(`BEGIN' is a feature we haven't discussed yet): + + $ awk "BEGIN { print \"Don't Panic!\" }" + -| Don't Panic! + + This program does not read any input. The `\' before each of the +inner double quotes is necessary because of the shell's quoting +rules--in particular because it mixes both single quotes and double +quotes.(1) + + This next simple `awk' program emulates the `cat' utility; it copies +whatever you type on the keyboard to its standard output (why this +works is explained shortly). + + $ awk '{ print }' + Now is the time for all good men + -| Now is the time for all good men + to come to the aid of their country. + -| to come to the aid of their country. + Four score and seven years ago, ... + -| Four score and seven years ago, ... + What, me worry? + -| What, me worry? + Ctrl-d + + ---------- Footnotes ---------- + + (1) Although we generally recommend the use of single quotes around +the program text, double quotes are needed here in order to put the +single quote into the message. + + +File: gawk.info, Node: Long, Next: Executable Scripts, Prev: Read Terminal, Up: Running gawk + +1.1.3 Running Long Programs +--------------------------- + +Sometimes your `awk' programs can be very long. In this case, it is +more convenient to put the program into a separate file. In order to +tell `awk' to use that file for its program, you type: + + awk -f SOURCE-FILE INPUT-FILE1 INPUT-FILE2 ... + + The `-f' instructs the `awk' utility to get the `awk' program from +the file SOURCE-FILE. Any file name can be used for SOURCE-FILE. For +example, you could put the program: + + BEGIN { print "Don't Panic!" } + +into the file `advice'. Then this command: + + awk -f advice + +does the same thing as this one: + + awk "BEGIN { print \"Don't Panic!\" }" + +This was explained earlier (*note Read Terminal::). Note that you +don't usually need single quotes around the file name that you specify +with `-f', because most file names don't contain any of the shell's +special characters. Notice that in `advice', the `awk' program did not +have single quotes around it. The quotes are only needed for programs +that are provided on the `awk' command line. + + If you want to identify your `awk' program files clearly as such, +you can add the extension `.awk' to the file name. This doesn't affect +the execution of the `awk' program but it does make "housekeeping" +easier. + + +File: gawk.info, Node: Executable Scripts, Next: Comments, Prev: Long, Up: Running gawk + +1.1.4 Executable `awk' Programs +------------------------------- + +Once you have learned `awk', you may want to write self-contained `awk' +scripts, using the `#!' script mechanism. You can do this on many Unix +systems(1) as well as on the GNU system. For example, you could update +the file `advice' to look like this: + + #! /bin/awk -f + + BEGIN { print "Don't Panic!" } + +After making this file executable (with the `chmod' utility), simply +type `advice' at the shell and the system arranges to run `awk'(2) as +if you had typed `awk -f advice': + + $ chmod +x advice + $ advice + -| Don't Panic! + +(We assume you have the current directory in your shell's search path +variable (typically `$PATH'). If not, you may need to type `./advice' +at the shell.) + + Self-contained `awk' scripts are useful when you want to write a +program that users can invoke without their having to know that the +program is written in `awk'. + +Advanced Notes: Portability Issues with `#!' +-------------------------------------------- + +Some systems limit the length of the interpreter name to 32 characters. +Often, this can be dealt with by using a symbolic link. + + You should not put more than one argument on the `#!' line after the +path to `awk'. It does not work. The operating system treats the rest +of the line as a single argument and passes it to `awk'. Doing this +leads to confusing behavior--most likely a usage diagnostic of some +sort from `awk'. + + Finally, the value of `ARGV[0]' (*note Built-in Variables::) varies +depending upon your operating system. Some systems put `awk' there, +some put the full pathname of `awk' (such as `/bin/awk'), and some put +the name of your script (`advice'). Don't rely on the value of +`ARGV[0]' to provide your script name. + + ---------- Footnotes ---------- + + (1) The `#!' mechanism works on Linux systems, systems derived from +the 4.4-Lite Berkeley Software Distribution, and most commercial Unix +systems. + + (2) The line beginning with `#!' lists the full file name of an +interpreter to run and an optional initial command-line argument to +pass to that interpreter. The operating system then runs the +interpreter with the given argument and the full argument list of the +executed program. The first argument in the list is the full file name +of the `awk' program. The rest of the argument list contains either +options to `awk', or data files, or both. + + +File: gawk.info, Node: Comments, Next: Quoting, Prev: Executable Scripts, Up: Running gawk + +1.1.5 Comments in `awk' Programs +-------------------------------- + +A "comment" is some text that is included in a program for the sake of +human readers; it is not really an executable part of the program. +Comments can explain what the program does and how it works. Nearly all +programming languages have provisions for comments, as programs are +typically hard to understand without them. + + In the `awk' language, a comment starts with the sharp sign +character (`#') and continues to the end of the line. The `#' does not +have to be the first character on the line. The `awk' language ignores +the rest of a line following a sharp sign. For example, we could have +put the following into `advice': + + # This program prints a nice friendly message. It helps + # keep novice users from being afraid of the computer. + BEGIN { print "Don't Panic!" } + + You can put comment lines into keyboard-composed throwaway `awk' +programs, but this usually isn't very useful; the purpose of a comment +is to help you or another person understand the program when reading it +at a later time. + + *Caution:* As mentioned in *note One-shot::, you can enclose small +to medium programs in single quotes, in order to keep your shell +scripts self-contained. When doing so, _don't_ put an apostrophe +(i.e., a single quote) into a comment (or anywhere else in your +program). The shell interprets the quote as the closing quote for the +entire program. As a result, usually the shell prints a message about +mismatched quotes, and if `awk' actually runs, it will probably print +strange messages about syntax errors. For example, look at the +following: + + $ awk '{ print "hello" } # let's be cute' + > + + The shell sees that the first two quotes match, and that a new +quoted object begins at the end of the command line. It therefore +prompts with the secondary prompt, waiting for more input. With Unix +`awk', closing the quoted string produces this result: + + $ awk '{ print "hello" } # let's be cute' + > ' + error--> awk: can't open file be + error--> source line number 1 + + Putting a backslash before the single quote in `let's' wouldn't help, +since backslashes are not special inside single quotes. The next +node describes the shell's quoting rules. + + +File: gawk.info, Node: Quoting, Prev: Comments, Up: Running gawk + +1.1.6 Shell-Quoting Issues +-------------------------- + +For short to medium length `awk' programs, it is most convenient to +enter the program on the `awk' command line. This is best done by +enclosing the entire program in single quotes. This is true whether +you are entering the program interactively at the shell prompt, or +writing it as part of a larger shell script: + + awk 'PROGRAM TEXT' INPUT-FILE1 INPUT-FILE2 ... + + Once you are working with the shell, it is helpful to have a basic +knowledge of shell quoting rules. The following rules apply only to +POSIX-compliant, Bourne-style shells (such as `bash', the GNU +Bourne-Again Shell). If you use `csh', you're on your own. + + * Quoted items can be concatenated with nonquoted items as well as + with other quoted items. The shell turns everything into one + argument for the command. + + * Preceding any single character with a backslash (`\') quotes that + character. The shell removes the backslash and passes the quoted + character on to the command. + + * Single quotes protect everything between the opening and closing + quotes. The shell does no interpretation of the quoted text, + passing it on verbatim to the command. It is _impossible_ to + embed a single quote inside single-quoted text. Refer back to + *note Comments::, for an example of what happens if you try. + + * Double quotes protect most things between the opening and closing + quotes. The shell does at least variable and command substitution + on the quoted text. Different shells may do additional kinds of + processing on double-quoted text. + + Since certain characters within double-quoted text are processed + by the shell, they must be "escaped" within the text. Of note are + the characters `$', ``', `\', and `"', all of which must be + preceded by a backslash within double-quoted text if they are to + be passed on literally to the program. (The leading backslash is + stripped first.) Thus, the example seen in *note Read Terminal::, + is applicable: + + $ awk "BEGIN { print \"Don't Panic!\" }" + -| Don't Panic! + + Note that the single quote is not special within double quotes. + + * Null strings are removed when they occur as part of a non-null + command-line argument, while explicit non-null objects are kept. + For example, to specify that the field separator `FS' should be + set to the null string, use: + + awk -F "" 'PROGRAM' FILES # correct + + Don't use this: + + awk -F"" 'PROGRAM' FILES # wrong! + + In the second case, `awk' will attempt to use the text of the + program as the value of `FS', and the first file name as the text + of the program! This results in syntax errors at best, and + confusing behavior at worst. + + Mixing single and double quotes is difficult. You have to resort to +shell quoting tricks, like this: + + $ awk 'BEGIN { print "Here is a single quote <'"'"'>" }' + -| Here is a single quote <'> + +This program consists of three concatenated quoted strings. The first +and the third are single-quoted, the second is double-quoted. + + This can be "simplified" to: + + $ awk 'BEGIN { print "Here is a single quote <'\''>" }' + -| Here is a single quote <'> + +Judge for yourself which of these two is the more readable. + + Another option is to use double quotes, escaping the embedded, +`awk'-level double quotes: + + $ awk "BEGIN { print \"Here is a single quote <'>\" }" + -| Here is a single quote <'> + +This option is also painful, because double quotes, backslashes, and +dollar signs are very common in `awk' programs. + + A third option is to use the octal escape sequence equivalents for +the single- and double-quote characters, like so: + + $ awk 'BEGIN { print "Here is a single quote <\47>" }' + -| Here is a single quote <'> + $ awk 'BEGIN { print "Here is a double quote <\42>" }' + -| Here is a double quote <"> + +This works nicely, except that you should comment clearly what the +escapes mean. + + A fourth option is to use command-line variable assignment, like +this: + + $ awk -v sq="'" 'BEGIN { print "Here is a single quote <" sq ">" }' + -| Here is a single quote <'> + + If you really need both single and double quotes in your `awk' +program, it is probably best to move it into a separate file, where the +shell won't be part of the picture, and you can say what you mean. + + +File: gawk.info, Node: Sample Data Files, Next: Very Simple, Prev: Running gawk, Up: Getting Started + +1.2 Data Files for the Examples +=============================== + +Many of the examples in this Info file take their input from two sample +data files. The first, `BBS-list', represents a list of computer +bulletin board systems together with information about those systems. +The second data file, called `inventory-shipped', contains information +about monthly shipments. In both files, each line is considered to be +one "record". + + In the data file `BBS-list', each record contains the name of a +computer bulletin board, its phone number, the board's baud rate(s), +and a code for the number of hours it is operational. An `A' in the +last column means the board operates 24 hours a day. A `B' in the last +column means the board only operates on evening and weekend hours. A +`C' means the board operates only on weekends: + + aardvark 555-5553 1200/300 B + alpo-net 555-3412 2400/1200/300 A + barfly 555-7685 1200/300 A + bites 555-1675 2400/1200/300 A + camelot 555-0542 300 C + core 555-2912 1200/300 C + fooey 555-1234 2400/1200/300 B + foot 555-6699 1200/300 B + macfoo 555-6480 1200/300 A + sdace 555-3430 2400/1200/300 A + sabafoo 555-2127 1200/300 C + + The data file `inventory-shipped' represents information about +shipments during the year. Each record contains the month, the number +of green crates shipped, the number of red boxes shipped, the number of +orange bags shipped, and the number of blue packages shipped, +respectively. There are 16 entries, covering the 12 months of last year +and the first four months of the current year. + + Jan 13 25 15 115 + Feb 15 32 24 226 + Mar 15 24 34 228 + Apr 31 52 63 420 + May 16 34 29 208 + Jun 31 42 75 492 + Jul 24 34 67 436 + Aug 15 34 47 316 + Sep 13 55 37 277 + Oct 29 54 68 525 + Nov 20 87 82 577 + Dec 17 35 61 401 + + Jan 21 36 64 620 + Feb 26 58 80 652 + Mar 24 75 70 495 + Apr 21 70 74 514 + + If you are reading this in GNU Emacs using Info, you can copy the +regions of text showing these sample files into your own test files. +This way you can try out the examples shown in the remainder of this +document. You do this by using the command `M-x write-region' to copy +text from the Info file into a file for use with `awk' (*Note +Miscellaneous File Operations: (emacs)Misc File Ops, for more +information). Using this information, create your own `BBS-list' and +`inventory-shipped' files and practice what you learn in this Info file. + + If you are using the stand-alone version of Info, see *note Extract +Program::, for an `awk' program that extracts these data files from +`gawk.texi', the Texinfo source file for this Info file. + + +File: gawk.info, Node: Very Simple, Next: Two Rules, Prev: Sample Data Files, Up: Getting Started + +1.3 Some Simple Examples +======================== + +The following command runs a simple `awk' program that searches the +input file `BBS-list' for the character string `foo' (a grouping of +characters is usually called a "string"; the term "string" is based on +similar usage in English, such as "a string of pearls," or "a string of +cars in a train"): + + awk '/foo/ { print $0 }' BBS-list + +When lines containing `foo' are found, they are printed because +`print $0' means print the current line. (Just `print' by itself means +the same thing, so we could have written that instead.) + + You will notice that slashes (`/') surround the string `foo' in the +`awk' program. The slashes indicate that `foo' is the pattern to +search for. This type of pattern is called a "regular expression", +which is covered in more detail later (*note Regexp::). The pattern is +allowed to match parts of words. There are single quotes around the +`awk' program so that the shell won't interpret any of it as special +shell characters. + + Here is what this program prints: + + $ awk '/foo/ { print $0 }' BBS-list + -| fooey 555-1234 2400/1200/300 B + -| foot 555-6699 1200/300 B + -| macfoo 555-6480 1200/300 A + -| sabafoo 555-2127 1200/300 C + + In an `awk' rule, either the pattern or the action can be omitted, +but not both. If the pattern is omitted, then the action is performed +for _every_ input line. If the action is omitted, the default action +is to print all lines that match the pattern. + + Thus, we could leave out the action (the `print' statement and the +curly braces) in the previous example and the result would be the same: +all lines matching the pattern `foo' are printed. By comparison, +omitting the `print' statement but retaining the curly braces makes an +empty action that does nothing (i.e., no lines are printed). + + Many practical `awk' programs are just a line or two. Following is a +collection of useful, short programs to get you started. Some of these +programs contain constructs that haven't been covered yet. (The +description of the program will give you a good idea of what is going +on, but please read the rest of the Info file to become an `awk' +expert!) Most of the examples use a data file named `data'. This is +just a placeholder; if you use these programs yourself, substitute your +own file names for `data'. For future reference, note that there is +often more than one way to do things in `awk'. At some point, you may +want to look back at these examples and see if you can come up with +different ways to do the same things shown here: + + * Print the length of the longest input line: + + awk '{ if (length($0) > max) max = length($0) } + END { print max }' data + + * Print every line that is longer than 80 characters: + + awk 'length($0) > 80' data + + The sole rule has a relational expression as its pattern and it + has no action--so the default action, printing the record, is used. + + * Print the length of the longest line in `data': + + expand data | awk '{ if (x < length()) x = length() } + END { print "maximum line length is " x }' + + The input is processed by the `expand' utility to change tabs into + spaces, so the widths compared are actually the right-margin + columns. + + * Print every line that has at least one field: + + awk 'NF > 0' data + + This is an easy way to delete blank lines from a file (or rather, + to create a new file similar to the old file but from which the + blank lines have been removed). + + * Print seven random numbers from 0 to 100, inclusive: + + awk 'BEGIN { for (i = 1; i <= 7; i++) + print int(101 * rand()) }' + + * Print the total number of bytes used by FILES: + + ls -l FILES | awk '{ x += $5 } + END { print "total bytes: " x }' + + * Print the total number of kilobytes used by FILES: + + ls -l FILES | awk '{ x += $5 } + END { print "total K-bytes: " (x + 1023)/1024 }' + + * Print a sorted list of the login names of all users: + + awk -F: '{ print $1 }' /etc/passwd | sort + + * Count the lines in a file: + + awk 'END { print NR }' data + + * Print the even-numbered lines in the data file: + + awk 'NR % 2 == 0' data + + If you use the expression `NR % 2 == 1' instead, the program would + print the odd-numbered lines. + + +File: gawk.info, Node: Two Rules, Next: More Complex, Prev: Very Simple, Up: Getting Started + +1.4 An Example with Two Rules +============================= + +The `awk' utility reads the input files one line at a time. For each +line, `awk' tries the patterns of each of the rules. If several +patterns match, then several actions are run in the order in which they +appear in the `awk' program. If no patterns match, then no actions are +run. + + After processing all the rules that match the line (and perhaps +there are none), `awk' reads the next line. (However, *note Next +Statement::, and also *note Nextfile Statement::). This continues +until the program reaches the end of the file. For example, the +following `awk' program contains two rules: + + /12/ { print $0 } + /21/ { print $0 } + +The first rule has the string `12' as the pattern and `print $0' as the +action. The second rule has the string `21' as the pattern and also +has `print $0' as the action. Each rule's action is enclosed in its +own pair of braces. + + This program prints every line that contains the string `12' _or_ +the string `21'. If a line contains both strings, it is printed twice, +once by each rule. + + This is what happens if we run this program on our two sample data +files, `BBS-list' and `inventory-shipped': + + $ awk '/12/ { print $0 } + > /21/ { print $0 }' BBS-list inventory-shipped + -| aardvark 555-5553 1200/300 B + -| alpo-net 555-3412 2400/1200/300 A + -| barfly 555-7685 1200/300 A + -| bites 555-1675 2400/1200/300 A + -| core 555-2912 1200/300 C + -| fooey 555-1234 2400/1200/300 B + -| foot 555-6699 1200/300 B + -| macfoo 555-6480 1200/300 A + -| sdace 555-3430 2400/1200/300 A + -| sabafoo 555-2127 1200/300 C + -| sabafoo 555-2127 1200/300 C + -| Jan 21 36 64 620 + -| Apr 21 70 74 514 + +Note how the line beginning with `sabafoo' in `BBS-list' was printed +twice, once for each rule. + + +File: gawk.info, Node: More Complex, Next: Statements/Lines, Prev: Two Rules, Up: Getting Started + +1.5 A More Complex Example +========================== + +Now that we've mastered some simple tasks, let's look at what typical +`awk' programs do. This example shows how `awk' can be used to +summarize, select, and rearrange the output of another utility. It uses +features that haven't been covered yet, so don't worry if you don't +understand all the details: + + ls -l | awk '$6 == "Nov" { sum += $5 } + END { print sum }' + + This command prints the total number of bytes in all the files in the +current directory that were last modified in November (of any year). +(1) The `ls -l' part of this example is a system command that gives you +a listing of the files in a directory, including each file's size and +the date the file was last modified. Its output looks like this: + + -rw-r--r-- 1 arnold user 1933 Nov 7 13:05 Makefile + -rw-r--r-- 1 arnold user 10809 Nov 7 13:03 awk.h + -rw-r--r-- 1 arnold user 983 Apr 13 12:14 awk.tab.h + -rw-r--r-- 1 arnold user 31869 Jun 15 12:20 awkgram.y + -rw-r--r-- 1 arnold user 22414 Nov 7 13:03 awk1.c + -rw-r--r-- 1 arnold user 37455 Nov 7 13:03 awk2.c + -rw-r--r-- 1 arnold user 27511 Dec 9 13:07 awk3.c + -rw-r--r-- 1 arnold user 7989 Nov 7 13:03 awk4.c + +The first field contains read-write permissions, the second field +contains the number of links to the file, and the third field +identifies the owner of the file. The fourth field identifies the group +of the file. The fifth field contains the size of the file in bytes. +The sixth, seventh, and eighth fields contain the month, day, and time, +respectively, that the file was last modified. Finally, the ninth field +contains the name of the file.(2) + + The `$6 == "Nov"' in our `awk' program is an expression that tests +whether the sixth field of the output from `ls -l' matches the string +`Nov'. Each time a line has the string `Nov' for its sixth field, the +action `sum += $5' is performed. This adds the fifth field (the file's +size) to the variable `sum'. As a result, when `awk' has finished +reading all the input lines, `sum' is the total of the sizes of the +files whose lines matched the pattern. (This works because `awk' +variables are automatically initialized to zero.) + + After the last line of output from `ls' has been processed, the +`END' rule executes and prints the value of `sum'. In this example, +the value of `sum' is 80600. + + These more advanced `awk' techniques are covered in later sections +(*note Action Overview::). Before you can move on to more advanced +`awk' programming, you have to know how `awk' interprets your input and +displays your output. By manipulating fields and using `print' +statements, you can produce some very useful and impressive-looking +reports. + + ---------- Footnotes ---------- + + (1) In the C shell (`csh'), you need to type a semicolon and then a +backslash at the end of the first line; see *note Statements/Lines::, +for an explanation. In a POSIX-compliant shell, such as the Bourne +shell or `bash', you can type the example as shown. If the command +`echo $path' produces an empty output line, you are most likely using a +POSIX-compliant shell. Otherwise, you are probably using the C shell +or a shell derived from it. + + (2) On some very old systems, you may need to use `ls -lg' to get +this output. + + +File: gawk.info, Node: Statements/Lines, Next: Other Features, Prev: More Complex, Up: Getting Started + +1.6 `awk' Statements Versus Lines +================================= + +Most often, each line in an `awk' program is a separate statement or +separate rule, like this: + + awk '/12/ { print $0 } + /21/ { print $0 }' BBS-list inventory-shipped + + However, `gawk' ignores newlines after any of the following symbols +and keywords: + + , { ? : || && do else + +A newline at any other point is considered the end of the statement.(1) + + If you would like to split a single statement into two lines at a +point where a newline would terminate it, you can "continue" it by +ending the first line with a backslash character (`\'). The backslash +must be the final character on the line in order to be recognized as a +continuation character. A backslash is allowed anywhere in the +statement, even in the middle of a string or regular expression. For +example: + + awk '/This regular expression is too long, so continue it\ + on the next line/ { print $1 }' + +We have generally not used backslash continuation in the sample programs +in this Info file. In `gawk', there is no limit on the length of a +line, so backslash continuation is never strictly necessary; it just +makes programs more readable. For this same reason, as well as for +clarity, we have kept most statements short in the sample programs +presented throughout the Info file. Backslash continuation is most +useful when your `awk' program is in a separate source file instead of +entered from the command line. You should also note that many `awk' +implementations are more particular about where you may use backslash +continuation. For example, they may not allow you to split a string +constant using backslash continuation. Thus, for maximum portability +of your `awk' programs, it is best not to split your lines in the +middle of a regular expression or a string. + + *Caution:* _Backslash continuation does not work as described with +the C shell._ It works for `awk' programs in files and for one-shot +programs, _provided_ you are using a POSIX-compliant shell, such as the +Unix Bourne shell or `bash'. But the C shell behaves differently! +There, you must use two backslashes in a row, followed by a newline. +Note also that when using the C shell, _every_ newline in your awk +program must be escaped with a backslash. To illustrate: + + % awk 'BEGIN { \ + ? print \\ + ? "hello, world" \ + ? }' + -| hello, world + +Here, the `%' and `?' are the C shell's primary and secondary prompts, +analogous to the standard shell's `$' and `>'. + + Compare the previous example to how it is done with a +POSIX-compliant shell: + + $ awk 'BEGIN { + > print \ + > "hello, world" + > }' + -| hello, world + + `awk' is a line-oriented language. Each rule's action has to begin +on the same line as the pattern. To have the pattern and action on +separate lines, you _must_ use backslash continuation; there is no +other option. + + Another thing to keep in mind is that backslash continuation and +comments do not mix. As soon as `awk' sees the `#' that starts a +comment, it ignores _everything_ on the rest of the line. For example: + + $ gawk 'BEGIN { print "dont panic" # a friendly \ + > BEGIN rule + > }' + error--> gawk: cmd. line:2: BEGIN rule + error--> gawk: cmd. line:2: ^ parse error + +In this case, it looks like the backslash would continue the comment +onto the next line. However, the backslash-newline combination is never +even noticed because it is "hidden" inside the comment. Thus, the +`BEGIN' is noted as a syntax error. + + When `awk' statements within one rule are short, you might want to +put more than one of them on a line. This is accomplished by +separating the statements with a semicolon (`;'). This also applies to +the rules themselves. Thus, the program shown at the start of this +minor node could also be written this way: + + /12/ { print $0 } ; /21/ { print $0 } + + NOTE: The requirement that states that rules on the same line must + be separated with a semicolon was not in the original `awk' + language; it was added for consistency with the treatment of + statements within an action. + + ---------- Footnotes ---------- + + (1) The `?' and `:' referred to here is the three-operand +conditional expression described in *note Conditional Exp::. Splitting +lines after `?' and `:' is a minor `gawk' extension; if `--posix' is +specified (*note Options::), then this extension is disabled. + + +File: gawk.info, Node: Other Features, Next: When, Prev: Statements/Lines, Up: Getting Started + +1.7 Other Features of `awk' +=========================== + +The `awk' language provides a number of predefined, or "built-in", +variables that your programs can use to get information from `awk'. +There are other variables your program can set as well to control how +`awk' processes your data. + + In addition, `awk' provides a number of built-in functions for doing +common computational and string-related operations. `gawk' provides +built-in functions for working with timestamps, performing bit +manipulation, and for runtime string translation. + + As we develop our presentation of the `awk' language, we introduce +most of the variables and many of the functions. They are defined +systematically in *note Built-in Variables::, and *note Built-in::. + + +File: gawk.info, Node: When, Prev: Other Features, Up: Getting Started + +1.8 When to Use `awk' +===================== + +Now that you've seen some of what `awk' can do, you might wonder how +`awk' could be useful for you. By using utility programs, advanced +patterns, field separators, arithmetic statements, and other selection +criteria, you can produce much more complex output. The `awk' language +is very useful for producing reports from large amounts of raw data, +such as summarizing information from the output of other utility +programs like `ls'. (*Note More Complex::.) + + Programs written with `awk' are usually much smaller than they would +be in other languages. This makes `awk' programs easy to compose and +use. Often, `awk' programs can be quickly composed at your terminal, +used once, and thrown away. Because `awk' programs are interpreted, you +can avoid the (usually lengthy) compilation part of the typical +edit-compile-test-debug cycle of software development. + + Complex programs have been written in `awk', including a complete +retargetable assembler for eight-bit microprocessors (*note Glossary::, +for more information), and a microcode assembler for a special-purpose +Prolog computer. More recently, `gawk' was used for writing a Wiki +clone.(1) While the original `awk''s capabilities were strained by tasks +of such complexity, modern versions are more capable. Even the Bell +Labs version of `awk' has fewer predefined limits, and those that it +has are much larger than they used to be. + + If you find yourself writing `awk' scripts of more than, say, a few +hundred lines, you might consider using a different programming +language. Emacs Lisp is a good choice if you need sophisticated string +or pattern matching capabilities. The shell is also good at string and +pattern matching; in addition, it allows powerful use of the system +utilities. More conventional languages, such as C, C++, and Java, offer +better facilities for system programming and for managing the complexity +of large programs. Programs in these languages may require more lines +of source code than the equivalent `awk' programs, but they are easier +to maintain and usually run more efficiently. + + ---------- Footnotes ---------- + + (1) Yet Another Wiki Clone +(http://www.awk-scripting.de/cgi-bin/wiki.cgi/yawk/). + + +File: gawk.info, Node: Regexp, Next: Reading Files, Prev: Getting Started, Up: Top + +2 Regular Expressions +********************* + +A "regular expression", or "regexp", is a way of describing a set of +strings. Because regular expressions are such a fundamental part of +`awk' programming, their format and use deserve a separate major node. + + A regular expression enclosed in slashes (`/') is an `awk' pattern +that matches every input record whose text belongs to that set. The +simplest regular expression is a sequence of letters, numbers, or both. +Such a regexp matches any string that contains that sequence. Thus, +the regexp `foo' matches any string containing `foo'. Therefore, the +pattern `/foo/' matches any input record containing the three +characters `foo' _anywhere_ in the record. Other kinds of regexps let +you specify more complicated classes of strings. + +* Menu: + +* Regexp Usage:: How to Use Regular Expressions. +* Escape Sequences:: How to write nonprinting characters. +* Regexp Operators:: Regular Expression Operators. +* Character Lists:: What can go between `[...]'. +* GNU Regexp Operators:: Operators specific to GNU software. +* Case-sensitivity:: How to do case-insensitive matching. +* Leftmost Longest:: How much text matches. +* Computed Regexps:: Using Dynamic Regexps. +* Locales:: How the locale affects things. + + +File: gawk.info, Node: Regexp Usage, Next: Escape Sequences, Up: Regexp + +2.1 How to Use Regular Expressions +================================== + +A regular expression can be used as a pattern by enclosing it in +slashes. Then the regular expression is tested against the entire text +of each record. (Normally, it only needs to match some part of the +text in order to succeed.) For example, the following prints the +second field of each record that contains the string `foo' anywhere in +it: + + $ awk '/foo/ { print $2 }' BBS-list + -| 555-1234 + -| 555-6699 + -| 555-6480 + -| 555-2127 + + `~' (tilde), `~' operator Regular expressions can also be used in +matching expressions. These expressions allow you to specify the +string to match against; it need not be the entire current input +record. The two operators `~' and `!~' perform regular expression +comparisons. Expressions using these operators can be used as +patterns, or in `if', `while', `for', and `do' statements. (*Note +Statements::.) For example: + + EXP ~ /REGEXP/ + +is true if the expression EXP (taken as a string) matches REGEXP. The +following example matches, or selects, all input records with the +uppercase letter `J' somewhere in the first field: + + $ awk '$1 ~ /J/' inventory-shipped + -| Jan 13 25 15 115 + -| Jun 31 42 75 492 + -| Jul 24 34 67 436 + -| Jan 21 36 64 620 + + So does this: + + awk '{ if ($1 ~ /J/) print }' inventory-shipped + + This next example is true if the expression EXP (taken as a +character string) does _not_ match REGEXP: + + EXP !~ /REGEXP/ + + The following example matches, or selects, all input records whose +first field _does not_ contain the uppercase letter `J': + + $ awk '$1 !~ /J/' inventory-shipped + -| Feb 15 32 24 226 + -| Mar 15 24 34 228 + -| Apr 31 52 63 420 + -| May 16 34 29 208 + ... + + When a regexp is enclosed in slashes, such as `/foo/', we call it a +"regexp constant", much like `5.27' is a numeric constant and `"foo"' +is a string constant. + + +File: gawk.info, Node: Escape Sequences, Next: Regexp Operators, Prev: Regexp Usage, Up: Regexp + +2.2 Escape Sequences +==================== + +Some characters cannot be included literally in string constants +(`"foo"') or regexp constants (`/foo/'). Instead, they should be +represented with "escape sequences", which are character sequences +beginning with a backslash (`\'). One use of an escape sequence is to +include a double-quote character in a string constant. Because a plain +double quote ends the string, you must use `\"' to represent an actual +double-quote character as a part of the string. For example: + + $ awk 'BEGIN { print "He said \"hi!\" to her." }' + -| He said "hi!" to her. + + The backslash character itself is another character that cannot be +included normally; you must write `\\' to put one backslash in the +string or regexp. Thus, the string whose contents are the two +characters `"' and `\' must be written `"\"\\"'. + + Backslash also represents unprintable characters such as TAB or +newline. While there is nothing to stop you from entering most +unprintable characters directly in a string constant or regexp constant, +they may look ugly. + + The following table lists all the escape sequences used in `awk' and +what they represent. Unless noted otherwise, all these escape sequences +apply to both string constants and regexp constants: + +`\\' + A literal backslash, `\'. + +`\a' + The "alert" character, `Ctrl-g', ASCII code 7 (BEL). (This + usually makes some sort of audible noise.) + +`\b' + Backspace, `Ctrl-h', ASCII code 8 (BS). + +`\f' + Formfeed, `Ctrl-l', ASCII code 12 (FF). + +`\n' + Newline, `Ctrl-j', ASCII code 10 (LF). + +`\r' + Carriage return, `Ctrl-m', ASCII code 13 (CR). + +`\t' + Horizontal TAB, `Ctrl-i', ASCII code 9 (HT). + +`\v' + Vertical tab, `Ctrl-k', ASCII code 11 (VT). + +`\NNN' + The octal value NNN, where NNN stands for 1 to 3 digits between + `0' and `7'. For example, the code for the ASCII ESC (escape) + character is `\033'. + +`\xHH...' + The hexadecimal value HH, where HH stands for a sequence of + hexadecimal digits (`0'-`9', and either `A'-`F' or `a'-`f'). Like + the same construct in ISO C, the escape sequence continues until + the first nonhexadecimal digit is seen. However, using more than + two hexadecimal digits produces undefined results. (The `\x' + escape sequence is not allowed in POSIX `awk'.) + +`\/' + A literal slash (necessary for regexp constants only). This + expression is used when you want to write a regexp constant that + contains a slash. Because the regexp is delimited by slashes, you + need to escape the slash that is part of the pattern, in order to + tell `awk' to keep processing the rest of the regexp. + +`\"' + A literal double quote (necessary for string constants only). + This expression is used when you want to write a string constant + that contains a double quote. Because the string is delimited by + double quotes, you need to escape the quote that is part of the + string, in order to tell `awk' to keep processing the rest of the + string. + + In `gawk', a number of additional two-character sequences that begin +with a backslash have special meaning in regexps. *Note GNU Regexp +Operators::. + + In a regexp, a backslash before any character that is not in the +previous list and not listed in *note GNU Regexp Operators::, means +that the next character should be taken literally, even if it would +normally be a regexp operator. For example, `/a\+b/' matches the three +characters `a+b'. + + For complete portability, do not use a backslash before any +character not shown in the previous list. + + To summarize: + + * The escape sequences in the table above are always processed first, + for both string constants and regexp constants. This happens very + early, as soon as `awk' reads your program. + + * `gawk' processes both regexp constants and dynamic regexps (*note + Computed Regexps::), for the special operators listed in *note GNU + Regexp Operators::. + + * A backslash before any other character means to treat that + character literally. + +Advanced Notes: Backslash Before Regular Characters +--------------------------------------------------- + +If you place a backslash in a string constant before something that is +not one of the characters previously listed, POSIX `awk' purposely +leaves what happens as undefined. There are two choices: + +Strip the backslash out + This is what Unix `awk' and `gawk' both do. For example, `"a\qc"' + is the same as `"aqc"'. (Because this is such an easy bug both to + introduce and to miss, `gawk' warns you about it.) Consider `FS = + "[ \t]+\|[ \t]+"' to use vertical bars surrounded by whitespace as + the field separator. There should be two backslashes in the string + `FS = "[ \t]+\\|[ \t]+"'.) + +Leave the backslash alone + Some other `awk' implementations do this. In such + implementations, typing `"a\qc"' is the same as typing `"a\\qc"'. + +Advanced Notes: Escape Sequences for Metacharacters +--------------------------------------------------- + +Suppose you use an octal or hexadecimal escape to represent a regexp +metacharacter. (See *note Regexp Operators::.) Does `awk' treat the +character as a literal character or as a regexp operator? + + Historically, such characters were taken literally. (d.c.) +However, the POSIX standard indicates that they should be treated as +real metacharacters, which is what `gawk' does. In compatibility mode +(*note Options::), `gawk' treats the characters represented by octal +and hexadecimal escape sequences literally when used in regexp +constants. Thus, `/a\52b/' is equivalent to `/a\*b/'. + + +File: gawk.info, Node: Regexp Operators, Next: Character Lists, Prev: Escape Sequences, Up: Regexp + +2.3 Regular Expression Operators +================================ + +You can combine regular expressions with special characters, called +"regular expression operators" or "metacharacters", to increase the +power and versatility of regular expressions. + + The escape sequences described in *note Escape Sequences::, are +valid inside a regexp. They are introduced by a `\' and are recognized +and converted into corresponding real characters as the very first step +in processing regexps. + + Here is a list of metacharacters. All characters that are not escape +sequences and that are not listed in the table stand for themselves: + +`\' + This is used to suppress the special meaning of a character when + matching. For example, `\$' matches the character `$'. + +`^' + This matches the beginning of a string. For example, `^@chapter' + matches `@chapter' at the beginning of a string and can be used to + identify chapter beginnings in Texinfo source files. The `^' is + known as an "anchor", because it anchors the pattern to match only + at the beginning of the string. + + It is important to realize that `^' does not match the beginning of + a line embedded in a string. The condition is not true in the + following example: + + if ("line1\nLINE 2" ~ /^L/) ... + +`$' + This is similar to `^', but it matches only at the end of a string. + For example, `p$' matches a record that ends with a `p'. The `$' + is an anchor and does not match the end of a line embedded in a + string. The condition in the following example is not true: + + if ("line1\nLINE 2" ~ /1$/) ... + +`.' + This matches any single character, _including_ the newline + character. For example, `.P' matches any single character + followed by a `P' in a string. Using concatenation, we can make a + regular expression such as `U.A', which matches any + three-character sequence that begins with `U' and ends with `A'. + + In strict POSIX mode (*note Options::), `.' does not match the NUL + character, which is a character with all bits equal to zero. + Otherwise, NUL is just another character. Other versions of `awk' + may not be able to match the NUL character. + +`[...]' + This is called a "character list".(1) It matches any _one_ of the + characters that are enclosed in the square brackets. For example, + `[MVX]' matches any one of the characters `M', `V', or `X' in a + string. A full discussion of what can be inside the square + brackets of a character list is given in *note Character Lists::. + +`[^ ...]' + This is a "complemented character list". The first character after + the `[' _must_ be a `^'. It matches any characters _except_ those + in the square brackets. For example, `[^awk]' matches any + character that is not an `a', `w', or `k'. + +`|' + This is the "alternation operator" and it is used to specify + alternatives. The `|' has the lowest precedence of all the regular + expression operators. For example, `^P|[[:digit:]]' matches any + string that matches either `^P' or `[[:digit:]]'. This means it + matches any string that starts with `P' or contains a digit. + + The alternation applies to the largest possible regexps on either + side. + +`(...)' + Parentheses are used for grouping in regular expressions, as in + arithmetic. They can be used to concatenate regular expressions + containing the alternation operator, `|'. For example, + `@(samp|code)\{[^}]+\}' matches both `@code{foo}' and `@samp{bar}'. + (These are Texinfo formatting control sequences. The `+' is + explained further on in this list.) + +`*' + This symbol means that the preceding regular expression should be + repeated as many times as necessary to find a match. For example, + `ph*' applies the `*' symbol to the preceding `h' and looks for + matches of one `p' followed by any number of `h's. This also + matches just `p' if no `h's are present. + + The `*' repeats the _smallest_ possible preceding expression. + (Use parentheses if you want to repeat a larger expression.) It + finds as many repetitions as possible. For example, `awk + '/\(c[ad][ad]*r x\)/ { print }' sample' prints every record in + `sample' containing a string of the form `(car x)', `(cdr x)', + `(cadr x)', and so on. Notice the escaping of the parentheses by + preceding them with backslashes. + +`+' + This symbol is similar to `*', except that the preceding + expression must be matched at least once. This means that `wh+y' + would match `why' and `whhy', but not `wy', whereas `wh*y' would + match all three of these strings. The following is a simpler way + of writing the last `*' example: + + awk '/\(c[ad]+r x\)/ { print }' sample + +`?' + This symbol is similar to `*', except that the preceding + expression can be matched either once or not at all. For example, + `fe?d' matches `fed' and `fd', but nothing else. + +`{N}' +`{N,}' +`{N,M}' + One or two numbers inside braces denote an "interval expression". + If there is one number in the braces, the preceding regexp is + repeated N times. If there are two numbers separated by a comma, + the preceding regexp is repeated N to M times. If there is one + number followed by a comma, then the preceding regexp is repeated + at least N times: + + `wh{3}y' + Matches `whhhy', but not `why' or `whhhhy'. + + `wh{3,5}y' + Matches `whhhy', `whhhhy', or `whhhhhy', only. + + `wh{2,}y' + Matches `whhy' or `whhhy', and so on. + + Interval expressions were not traditionally available in `awk'. + They were added as part of the POSIX standard to make `awk' and + `egrep' consistent with each other. + + However, because old programs may use `{' and `}' in regexp + constants, by default `gawk' does _not_ match interval expressions + in regexps. If either `--posix' or `--re-interval' are specified + (*note Options::), then interval expressions are allowed in + regexps. + + For new programs that use `{' and `}' in regexp constants, it is + good practice to always escape them with a backslash. Then the + regexp constants are valid and work the way you want them to, using + any version of `awk'.(2) + + In regular expressions, the `*', `+', and `?' operators, as well as +the braces `{' and `}', have the highest precedence, followed by +concatenation, and finally by `|'. As in arithmetic, parentheses can +change how operators are grouped. + + In POSIX `awk' and `gawk', the `*', `+', and `?' operators stand for +themselves when there is nothing in the regexp that precedes them. For +example, `/+/' matches a literal plus sign. However, many other +versions of `awk' treat such a usage as a syntax error. + + If `gawk' is in compatibility mode (*note Options::), POSIX +character classes and interval expressions are not available in regular +expressions. + + ---------- Footnotes ---------- + + (1) In other literature, you may see a character list referred to as +either a "character set", a "character class", or a "bracket +expression". + + (2) Use two backslashes if you're using a string constant with a +regexp operator or function. + + +File: gawk.info, Node: Character Lists, Next: GNU Regexp Operators, Prev: Regexp Operators, Up: Regexp + +2.4 Using Character Lists +========================= + +Within a character list, a "range expression" consists of two +characters separated by a hyphen. It matches any single character that +sorts between the two characters, using the locale's collating sequence +and character set. For example, in the default C locale, `[a-dx-z]' is +equivalent to `[abcdxyz]'. Many locales sort characters in dictionary +order, and in these locales, `[a-dx-z]' is typically not equivalent to +`[abcdxyz]'; instead it might be equivalent to `[aBbCcDdxXyYz]', for +example. To obtain the traditional interpretation of bracket +expressions, you can use the C locale by setting the `LC_ALL' +environment variable to the value `C'. + + To include one of the characters `\', `]', `-', or `^' in a +character list, put a `\' in front of it. For example: + + [d\]] + +matches either `d' or `]'. + + This treatment of `\' in character lists is compatible with other +`awk' implementations and is also mandated by POSIX. The regular +expressions in `awk' are a superset of the POSIX specification for +Extended Regular Expressions (EREs). POSIX EREs are based on the +regular expressions accepted by the traditional `egrep' utility. + + "Character classes" are a new feature introduced in the POSIX +standard. A character class is a special notation for describing lists +of characters that have a specific attribute, but the actual characters +can vary from country to country and/or from character set to character +set. For example, the notion of what is an alphabetic character +differs between the United States and France. + + A character class is only valid in a regexp _inside_ the brackets of +a character list. Character classes consist of `[:', a keyword +denoting the class, and `:]'. *note table-char-classes:: lists the +character classes defined by the POSIX standard. + +Class Meaning +-------------------------------------------------------------------------- +`[:alnum:]' Alphanumeric characters. +`[:alpha:]' Alphabetic characters. +`[:blank:]' Space and TAB characters. +`[:cntrl:]' Control characters. +`[:digit:]' Numeric characters. +`[:graph:]' Characters that are both printable and visible. (A space is + printable but not visible, whereas an `a' is both.) +`[:lower:]' Lowercase alphabetic characters. +`[:print:]' Printable characters (characters that are not control + characters). +`[:punct:]' Punctuation characters (characters that are not letters, + digits, control characters, or space characters). +`[:space:]' Space characters (such as space, TAB, and formfeed, to name + a few). +`[:upper:]' Uppercase alphabetic characters. +`[:xdigit:]'Characters that are hexadecimal digits. + +Table 2.1: POSIX Character Classes + + For example, before the POSIX standard, you had to write +`/[A-Za-z0-9]/' to match alphanumeric characters. If your character +set had other alphabetic characters in it, this would not match them, +and if your character set collated differently from ASCII, this might +not even match the ASCII alphanumeric characters. With the POSIX +character classes, you can write `/[[:alnum:]]/' to match the alphabetic +and numeric characters in your character set. + + Two additional special sequences can appear in character lists. +These apply to non-ASCII character sets, which can have single symbols +(called "collating elements") that are represented with more than one +character. They can also have several characters that are equivalent for +"collating", or sorting, purposes. (For example, in French, a plain "e" +and a grave-accented "e`" are equivalent.) These sequences are: + +Collating symbols + Multicharacter collating elements enclosed between `[.' and `.]'. + For example, if `ch' is a collating element, then `[[.ch.]]' is a + regexp that matches this collating element, whereas `[ch]' is a + regexp that matches either `c' or `h'. + +Equivalence classes + Locale-specific names for a list of characters that are equal. The + name is enclosed between `[=' and `=]'. For example, the name `e' + might be used to represent all of "e," "e`," and "e'." In this + case, `[[=e=]]' is a regexp that matches any of `e', `e'', or `e`'. + + These features are very valuable in non-English-speaking locales. + + *Caution:* The library functions that `gawk' uses for regular +expression matching currently recognize only POSIX character classes; +they do not recognize collating symbols or equivalence classes. + + +File: gawk.info, Node: GNU Regexp Operators, Next: Case-sensitivity, Prev: Character Lists, Up: Regexp + +2.5 `gawk'-Specific Regexp Operators +==================================== + +GNU software that deals with regular expressions provides a number of +additional regexp operators. These operators are described in this +minor node and are specific to `gawk'; they are not available in other +`awk' implementations. Most of the additional operators deal with word +matching. For our purposes, a "word" is a sequence of one or more +letters, digits, or underscores (`_'): + +`\w' + Matches any word-constituent character--that is, it matches any + letter, digit, or underscore. Think of it as shorthand for + `[[:alnum:]_]'. + +`\W' + Matches any character that is not word-constituent. Think of it + as shorthand for `[^[:alnum:]_]'. + +`\<' + Matches the empty string at the beginning of a word. For example, + `/\<away/' matches `away' but not `stowaway'. + +`\>' + Matches the empty string at the end of a word. For example, + `/stow\>/' matches `stow' but not `stowaway'. + +`\y' + Matches the empty string at either the beginning or the end of a + word (i.e., the word boundar*y*). For example, `\yballs?\y' + matches either `ball' or `balls', as a separate word. + +`\B' + Matches the empty string that occurs between two word-constituent + characters. For example, `/\Brat\B/' matches `crate' but it does + not match `dirty rat'. `\B' is essentially the opposite of `\y'. + + There are two other operators that work on buffers. In Emacs, a +"buffer" is, naturally, an Emacs buffer. For other programs, `gawk''s +regexp library routines consider the entire string to match as the +buffer. The operators are: + +`\`' + Matches the empty string at the beginning of a buffer (string). + +`\'' + Matches the empty string at the end of a buffer (string). + + Because `^' and `$' always work in terms of the beginning and end of +strings, these operators don't add any new capabilities for `awk'. +They are provided for compatibility with other GNU software. + + In other GNU software, the word-boundary operator is `\b'. However, +that conflicts with the `awk' language's definition of `\b' as +backspace, so `gawk' uses a different letter. An alternative method +would have been to require two backslashes in the GNU operators, but +this was deemed too confusing. The current method of using `\y' for the +GNU `\b' appears to be the lesser of two evils. + + The various command-line options (*note Options::) control how +`gawk' interprets characters in regexps: + +No options + In the default case, `gawk' provides all the facilities of POSIX + regexps and the GNU regexp operators described in *note Regexp + Operators::. However, interval expressions are not supported. + +`--posix' + Only POSIX regexps are supported; the GNU operators are not special + (e.g., `\w' matches a literal `w'). Interval expressions are + allowed. + +`--traditional' + Traditional Unix `awk' regexps are matched. The GNU operators are + not special, interval expressions are not available, nor are the + POSIX character classes (`[[:alnum:]]', etc.). Characters + described by octal and hexadecimal escape sequences are treated + literally, even if they represent regexp metacharacters. Also, + `gawk' silently skips directories named on the command line. + +`--re-interval' + Allow interval expressions in regexps, even if `--traditional' has + been provided. (`--posix' automatically enables interval + expressions, so `--re-interval' is redundant when `--posix' is is + used.) + + +File: gawk.info, Node: Case-sensitivity, Next: Leftmost Longest, Prev: GNU Regexp Operators, Up: Regexp + +2.6 Case Sensitivity in Matching +================================ + +Case is normally significant in regular expressions, both when matching +ordinary characters (i.e., not metacharacters) and inside character +sets. Thus, a `w' in a regular expression matches only a lowercase `w' +and not an uppercase `W'. + + The simplest way to do a case-independent match is to use a character +list--for example, `[Ww]'. However, this can be cumbersome if you need +to use it often, and it can make the regular expressions harder to +read. There are two alternatives that you might prefer. + + One way to perform a case-insensitive match at a particular point in +the program is to convert the data to a single case, using the +`tolower' or `toupper' built-in string functions (which we haven't +discussed yet; *note String Functions::). For example: + + tolower($1) ~ /foo/ { ... } + +converts the first field to lowercase before matching against it. This +works in any POSIX-compliant `awk'. + + Another method, specific to `gawk', is to set the variable +`IGNORECASE' to a nonzero value (*note Built-in Variables::). When +`IGNORECASE' is not zero, _all_ regexp and string operations ignore +case. Changing the value of `IGNORECASE' dynamically controls the +case-sensitivity of the program as it runs. Case is significant by +default because `IGNORECASE' (like most variables) is initialized to +zero: + + x = "aB" + if (x ~ /ab/) ... # this test will fail + + IGNORECASE = 1 + if (x ~ /ab/) ... # now it will succeed + + In general, you cannot use `IGNORECASE' to make certain rules +case-insensitive and other rules case-sensitive, because there is no +straightforward way to set `IGNORECASE' just for the pattern of a +particular rule.(1) To do this, use either character lists or +`tolower'. However, one thing you can do with `IGNORECASE' only is +dynamically turn case-sensitivity on or off for all the rules at once. + + `IGNORECASE' can be set on the command line or in a `BEGIN' rule +(*note Other Arguments::; also *note Using BEGIN/END::). Setting +`IGNORECASE' from the command line is a way to make a program +case-insensitive without having to edit it. + + Prior to `gawk' 3.0, the value of `IGNORECASE' affected regexp +operations only. It did not affect string comparison with `==', `!=', +and so on. Beginning with version 3.0, both regexp and string +comparison operations are also affected by `IGNORECASE'. + + Beginning with `gawk' 3.0, the equivalences between upper- and +lowercase characters are based on the ISO-8859-1 (ISO Latin-1) +character set. This character set is a superset of the traditional 128 +ASCII characters, which also provides a number of characters suitable +for use with European languages. + + As of `gawk' 3.1.4, the case equivalences are fully locale-aware. +They are based on the C `<ctype.h>' facilities, such as `isalpha()' and +`toupper()'. + + The value of `IGNORECASE' has no effect if `gawk' is in +compatibility mode (*note Options::). Case is always significant in +compatibility mode. + + ---------- Footnotes ---------- + + (1) Experienced C and C++ programmers will note that it is possible, +using something like `IGNORECASE = 1 && /foObAr/ { ... }' and +`IGNORECASE = 0 || /foobar/ { ... }'. However, this is somewhat +obscure and we don't recommend it. + + +File: gawk.info, Node: Leftmost Longest, Next: Computed Regexps, Prev: Case-sensitivity, Up: Regexp + +2.7 How Much Text Matches? +========================== + +Consider the following: + + echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }' + + This example uses the `sub' function (which we haven't discussed yet; +*note String Functions::) to make a change to the input record. Here, +the regexp `/a+/' indicates "one or more `a' characters," and the +replacement text is `<A>'. + + The input contains four `a' characters. `awk' (and POSIX) regular +expressions always match the leftmost, _longest_ sequence of input +characters that can match. Thus, all four `a' characters are replaced +with `<A>' in this example: + + $ echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }' + -| <A>bcd + + For simple match/no-match tests, this is not so important. But when +doing text matching and substitutions with the `match', `sub', `gsub', +and `gensub' functions, it is very important. *Note String Functions::, +for more information on these functions. Understanding this principle +is also important for regexp-based record and field splitting (*note +Records::, and also *note Field Separators::). + + +File: gawk.info, Node: Computed Regexps, Next: Locales, Prev: Leftmost Longest, Up: Regexp + +2.8 Using Dynamic Regexps +========================= + +The righthand side of a `~' or `!~' operator need not be a regexp +constant (i.e., a string of characters between slashes). It may be any +expression. The expression is evaluated and converted to a string if +necessary; the contents of the string are used as the regexp. A regexp +that is computed in this way is called a "dynamic regexp": + + BEGIN { digits_regexp = "[[:digit:]]+" } + $0 ~ digits_regexp { print } + +This sets `digits_regexp' to a regexp that describes one or more digits, +and tests whether the input record matches this regexp. + + *Caution:* When using the `~' and `!~' operators, there is a +difference between a regexp constant enclosed in slashes and a string +constant enclosed in double quotes. If you are going to use a string +constant, you have to understand that the string is, in essence, +scanned _twice_: the first time when `awk' reads your program, and the +second time when it goes to match the string on the lefthand side of +the operator with the pattern on the right. This is true of any +string-valued expression (such as `digits_regexp', shown previously), +not just string constants. + + What difference does it make if the string is scanned twice? The +answer has to do with escape sequences, and particularly with +backslashes. To get a backslash into a regular expression inside a +string, you have to type two backslashes. + + For example, `/\*/' is a regexp constant for a literal `*'. Only +one backslash is needed. To do the same thing with a string, you have +to type `"\\*"'. The first backslash escapes the second one so that +the string actually contains the two characters `\' and `*'. + + Given that you can use both regexp and string constants to describe +regular expressions, which should you use? The answer is "regexp +constants," for several reasons: + + * String constants are more complicated to write and more difficult + to read. Using regexp constants makes your programs less + error-prone. Not understanding the difference between the two + kinds of constants is a common source of errors. + + * It is more efficient to use regexp constants. `awk' can note that + you have supplied a regexp and store it internally in a form that + makes pattern matching more efficient. When using a string + constant, `awk' must first convert the string into this internal + form and then perform the pattern matching. + + * Using regexp constants is better form; it shows clearly that you + intend a regexp match. + +Advanced Notes: Using `\n' in Character Lists of Dynamic Regexps +---------------------------------------------------------------- + +Some commercial versions of `awk' do not allow the newline character to +be used inside a character list for a dynamic regexp: + + $ awk '$0 ~ "[ \t\n]"' + error--> awk: newline in character class [ + error--> ]... + error--> source line number 1 + error--> context is + error--> >>> <<< + + But a newline in a regexp constant works with no problem: + + $ awk '$0 ~ /[ \t\n]/' + here is a sample line + -| here is a sample line + Ctrl-d + + `gawk' does not have this problem, and it isn't likely to occur +often in practice, but it's worth noting for future reference. + + +File: gawk.info, Node: Locales, Prev: Computed Regexps, Up: Regexp + +2.9 Where You Are Makes A Difference +==================================== + +Modern systems support the notion of "locales": a way to tell the +system about the local character set and language. The current locale +setting can affect the way regexp matching works, often in surprising +ways. In particular, many locales do case-insensitive matching, even +when you may have specified characters of only one particular case. + + The following example uses the `sub' function, which does text +replacement (*note String Functions::). Here, the intent is to remove +trailing uppercase characters: + + $ echo something1234abc | gawk '{ sub("[A-Z]*$", ""); print }' + -| something1234 + +This output is unexpected, since the `abc' at the end of +`something1234abc' should not normally match `[A-Z]*'. This result is +due to the locale setting (and thus you may not see it on your system). +There are two fixes. The first is to use the POSIX character class +`[[:upper:]]', instead of `[A-Z]'. (This is preferred, since then your +program will work everywhere.) The second is to change the locale +setting in the environment, before running `gawk', by using the shell +statements: + + LANG=C LC_ALL=C + export LANG LC_ALL + + The setting `C' forces `gawk' to behave in the traditional Unix +manner, where case distinctions do matter. You may wish to put these +statements into your shell startup file, e.g., `$HOME/.profile'. + + Similar considerations apply to other ranges. For example, `["-/]' +is perfectly valid in ASCII, but is not valid in many Unicode locales, +such as `en_US.UTF-8'. (In general, such ranges should be avoided; +either list the characters individually, or use a POSIX character class +such as `[[:punct:]]'.) + + For the normal case of `RS = "\n"', the locale is largely irrelevant. +For other single-character record separators, using `LC_ALL=C' will +give you much better performance when reading records. Otherwise, +`gawk' has to make several function calls, _per input character_ to +find the record terminator. + + Finally, the locale affects the value of the decimal point character +used when `gawk' parses input data. This is discussed in detail in +*note Conversion::. + + +File: gawk.info, Node: Reading Files, Next: Printing, Prev: Regexp, Up: Top + +3 Reading Input Files +********************* + +In the typical `awk' program, all input is read either from the +standard input (by default, this is the keyboard, but often it is a +pipe from another command) or from files whose names you specify on the +`awk' command line. If you specify input files, `awk' reads them in +order, processing all the data from one before going on to the next. +The name of the current input file can be found in the built-in variable +`FILENAME' (*note Built-in Variables::). + + The input is read in units called "records", and is processed by the +rules of your program one record at a time. By default, each record is +one line. Each record is automatically split into chunks called +"fields". This makes it more convenient for programs to work on the +parts of a record. + + On rare occasions, you may need to use the `getline' command. The +`getline' command is valuable, both because it can do explicit input +from any number of files, and because the files used with it do not +have to be named on the `awk' command line (*note Getline::). + +* Menu: + +* Records:: Controlling how data is split into records. +* Fields:: An introduction to fields. +* Nonconstant Fields:: Nonconstant Field Numbers. +* Changing Fields:: Changing the Contents of a Field. +* Field Separators:: The field separator and how to change it. +* Constant Size:: Reading constant width data. +* Multiple Line:: Reading multi-line records. +* Getline:: Reading files under explicit program control + using the `getline' function. + + +File: gawk.info, Node: Records, Next: Fields, Up: Reading Files + +3.1 How Input Is Split into Records +=================================== + +The `awk' utility divides the input for your `awk' program into records +and fields. `awk' keeps track of the number of records that have been +read so far from the current input file. This value is stored in a +built-in variable called `FNR'. It is reset to zero when a new file is +started. Another built-in variable, `NR', is the total number of input +records read so far from all data files. It starts at zero, but is +never automatically reset to zero. + + Records are separated by a character called the "record separator". +By default, the record separator is the newline character. This is why +records are, by default, single lines. A different character can be +used for the record separator by assigning the character to the +built-in variable `RS'. + + Like any other variable, the value of `RS' can be changed in the +`awk' program with the assignment operator, `=' (*note Assignment +Ops::). The new record-separator character should be enclosed in +quotation marks, which indicate a string constant. Often the right +time to do this is at the beginning of execution, before any input is +processed, so that the very first record is read with the proper +separator. To do this, use the special `BEGIN' pattern (*note +BEGIN/END::). For example: + + awk 'BEGIN { RS = "/" } + { print $0 }' BBS-list + +changes the value of `RS' to `"/"', before reading any input. This is +a string whose first character is a slash; as a result, records are +separated by slashes. Then the input file is read, and the second rule +in the `awk' program (the action with no pattern) prints each record. +Because each `print' statement adds a newline at the end of its output, +this `awk' program copies the input with each slash changed to a +newline. Here are the results of running the program on `BBS-list': + + $ awk 'BEGIN { RS = "/" } + > { print $0 }' BBS-list + -| aardvark 555-5553 1200 + -| 300 B + -| alpo-net 555-3412 2400 + -| 1200 + -| 300 A + -| barfly 555-7685 1200 + -| 300 A + -| bites 555-1675 2400 + -| 1200 + -| 300 A + -| camelot 555-0542 300 C + -| core 555-2912 1200 + -| 300 C + -| fooey 555-1234 2400 + -| 1200 + -| 300 B + -| foot 555-6699 1200 + -| 300 B + -| macfoo 555-6480 1200 + -| 300 A + -| sdace 555-3430 2400 + -| 1200 + -| 300 A + -| sabafoo 555-2127 1200 + -| 300 C + -| + +Note that the entry for the `camelot' BBS is not split. In the +original data file (*note Sample Data Files::), the line looks like +this: + + camelot 555-0542 300 C + +It has one baud rate only, so there are no slashes in the record, +unlike the others which have two or more baud rates. In fact, this +record is treated as part of the record for the `core' BBS; the newline +separating them in the output is the original newline in the data file, +not the one added by `awk' when it printed the record! + + Another way to change the record separator is on the command line, +using the variable-assignment feature (*note Other Arguments::): + + awk '{ print $0 }' RS="/" BBS-list + +This sets `RS' to `/' before processing `BBS-list'. + + Using an unusual character such as `/' for the record separator +produces correct behavior in the vast majority of cases. However, the +following (extreme) pipeline prints a surprising `1': + + $ echo | awk 'BEGIN { RS = "a" } ; { print NF }' + -| 1 + + There is one field, consisting of a newline. The value of the +built-in variable `NF' is the number of fields in the current record. + + Reaching the end of an input file terminates the current input +record, even if the last character in the file is not the character in +`RS'. (d.c.) + + The empty string `""' (a string without any characters) has a +special meaning as the value of `RS'. It means that records are +separated by one or more blank lines and nothing else. *Note Multiple +Line::, for more details. + + If you change the value of `RS' in the middle of an `awk' run, the +new value is used to delimit subsequent records, but the record +currently being processed, as well as records already processed, are not +affected. + + After the end of the record has been determined, `gawk' sets the +variable `RT' to the text in the input that matched `RS'. When using +`gawk', the value of `RS' is not limited to a one-character string. It +can be any regular expression (*note Regexp::). In general, each record +ends at the next string that matches the regular expression; the next +record starts at the end of the matching string. This general rule is +actually at work in the usual case, where `RS' contains just a newline: +a record ends at the beginning of the next matching string (the next +newline in the input), and the following record starts just after the +end of this string (at the first character of the following line). The +newline, because it matches `RS', is not part of either record. + + When `RS' is a single character, `RT' contains the same single +character. However, when `RS' is a regular expression, `RT' contains +the actual input text that matched the regular expression. + + The following example illustrates both of these features. It sets +`RS' equal to a regular expression that matches either a newline or a +series of one or more uppercase letters with optional leading and/or +trailing whitespace: + + $ echo record 1 AAAA record 2 BBBB record 3 | + > gawk 'BEGIN { RS = "\n|( *[[:upper:]]+ *)" } + > { print "Record =", $0, "and RT =", RT }' + -| Record = record 1 and RT = AAAA + -| Record = record 2 and RT = BBBB + -| Record = record 3 and RT = + -| + +The final line of output has an extra blank line. This is because the +value of `RT' is a newline, and the `print' statement supplies its own +terminating newline. *Note Simple Sed::, for a more useful example of +`RS' as a regexp and `RT'. + + If you set `RS' to a regular expression that allows optional +trailing text, such as `RS = "abc(XYZ)?"' it is possible, due to +implementation constraints, that `gawk' may match the leading part of +the regular expression, but not the trailing part, particularly if the +input text that could match the trailing part is fairly long. `gawk' +attempts to avoid this problem, but currently, there's no guarantee +that this will never happen. + + NOTE: Remember that in `awk', the `^' and `$' anchor + metacharacters match the beginning and end of a _string_, and not + the beginning and end of a _line_. As a result, something like + `RS = "^[[:upper:]]"' can only match at the beginning of a file. + This is because `gawk' views the input file as one long string + that happens to contain newline characters in it. It is thus best + to avoid anchor characters in the value of `RS'. + + The use of `RS' as a regular expression and the `RT' variable are +`gawk' extensions; they are not available in compatibility mode (*note +Options::). In compatibility mode, only the first character of the +value of `RS' is used to determine the end of the record. + +Advanced Notes: `RS = "\0"' Is Not Portable +------------------------------------------- + +There are times when you might want to treat an entire data file as a +single record. The only way to make this happen is to give `RS' a +value that you know doesn't occur in the input file. This is hard to +do in a general way, such that a program always works for arbitrary +input files. + + You might think that for text files, the NUL character, which +consists of a character with all bits equal to zero, is a good value to +use for `RS' in this case: + + BEGIN { RS = "\0" } # whole file becomes one record? + + `gawk' in fact accepts this, and uses the NUL character for the +record separator. However, this usage is _not_ portable to other `awk' +implementations. + + All other `awk' implementations(1) store strings internally as +C-style strings. C strings use the NUL character as the string +terminator. In effect, this means that `RS = "\0"' is the same as `RS += ""'. (d.c.) + + The best way to treat a whole file as a single record is to simply +read the file in, one record at a time, concatenating each record onto +the end of the previous ones. + + ---------- Footnotes ---------- + + (1) At least that we know about. + + +File: gawk.info, Node: Fields, Next: Nonconstant Fields, Prev: Records, Up: Reading Files + +3.2 Examining Fields +==================== + +When `awk' reads an input record, the record is automatically "parsed" +or separated by the interpreter into chunks called "fields". By +default, fields are separated by "whitespace", like words in a line. +Whitespace in `awk' means any string of one or more spaces, tabs, or +newlines;(1) other characters, such as formfeed, vertical tab, etc. +that are considered whitespace by other languages, are _not_ considered +whitespace by `awk'. + + The purpose of fields is to make it more convenient for you to refer +to these pieces of the record. You don't have to use them--you can +operate on the whole record if you want--but fields are what make +simple `awk' programs so powerful. + + A dollar-sign (`$') is used to refer to a field in an `awk' program, +followed by the number of the field you want. Thus, `$1' refers to the +first field, `$2' to the second, and so on. (Unlike the Unix shells, +the field numbers are not limited to single digits. `$127' is the one +hundred twenty-seventh field in the record.) For example, suppose the +following is a line of input: + + This seems like a pretty nice example. + +Here the first field, or `$1', is `This', the second field, or `$2', is +`seems', and so on. Note that the last field, `$7', is `example.'. +Because there is no space between the `e' and the `.', the period is +considered part of the seventh field. + + `NF' is a built-in variable whose value is the number of fields in +the current record. `awk' automatically updates the value of `NF' each +time it reads a record. No matter how many fields there are, the last +field in a record can be represented by `$NF'. So, `$NF' is the same +as `$7', which is `example.'. If you try to reference a field beyond +the last one (such as `$8' when the record has only seven fields), you +get the empty string. (If used in a numeric operation, you get zero.) + + The use of `$0', which looks like a reference to the "zero-th" +field, is a special case: it represents the whole input record when you +are not interested in specific fields. Here are some more examples: + + $ awk '$1 ~ /foo/ { print $0 }' BBS-list + -| fooey 555-1234 2400/1200/300 B + -| foot 555-6699 1200/300 B + -| macfoo 555-6480 1200/300 A + -| sabafoo 555-2127 1200/300 C + +This example prints each record in the file `BBS-list' whose first +field contains the string `foo'. The operator `~' is called a +"matching operator" (*note Regexp Usage::); it tests whether a string +(here, the field `$1') matches a given regular expression. + + By contrast, the following example looks for `foo' in _the entire +record_ and prints the first field and the last field for each matching +input record: + + $ awk '/foo/ { print $1, $NF }' BBS-list + -| fooey B + -| foot B + -| macfoo A + -| sabafoo C + + ---------- Footnotes ---------- + + (1) In POSIX `awk', newlines are not considered whitespace for +separating fields. + + +File: gawk.info, Node: Nonconstant Fields, Next: Changing Fields, Prev: Fields, Up: Reading Files + +3.3 Nonconstant Field Numbers +============================= + +The number of a field does not need to be a constant. Any expression in +the `awk' language can be used after a `$' to refer to a field. The +value of the expression specifies the field number. If the value is a +string, rather than a number, it is converted to a number. Consider +this example: + + awk '{ print $NR }' + +Recall that `NR' is the number of records read so far: one in the first +record, two in the second, etc. So this example prints the first field +of the first record, the second field of the second record, and so on. +For the twentieth record, field number 20 is printed; most likely, the +record has fewer than 20 fields, so this prints a blank line. Here is +another example of using expressions as field numbers: + + awk '{ print $(2*2) }' BBS-list + + `awk' evaluates the expression `(2*2)' and uses its value as the +number of the field to print. The `*' sign represents multiplication, +so the expression `2*2' evaluates to four. The parentheses are used so +that the multiplication is done before the `$' operation; they are +necessary whenever there is a binary operator in the field-number +expression. This example, then, prints the hours of operation (the +fourth field) for every line of the file `BBS-list'. (All of the `awk' +operators are listed, in order of decreasing precedence, in *note +Precedence::.) + + If the field number you compute is zero, you get the entire record. +Thus, `$(2-2)' has the same value as `$0'. Negative field numbers are +not allowed; trying to reference one usually terminates the program. +(The POSIX standard does not define what happens when you reference a +negative field number. `gawk' notices this and terminates your +program. Other `awk' implementations may behave differently.) + + As mentioned in *note Fields::, `awk' stores the current record's +number of fields in the built-in variable `NF' (also *note Built-in +Variables::). The expression `$NF' is not a special feature--it is the +direct consequence of evaluating `NF' and using its value as a field +number. + + +File: gawk.info, Node: Changing Fields, Next: Field Separators, Prev: Nonconstant Fields, Up: Reading Files + +3.4 Changing the Contents of a Field +==================================== + +The contents of a field, as seen by `awk', can be changed within an +`awk' program; this changes what `awk' perceives as the current input +record. (The actual input is untouched; `awk' _never_ modifies the +input file.) Consider the following example and its output: + + $ awk '{ nboxes = $3 ; $3 = $3 - 10 + > print nboxes, $3 }' inventory-shipped + -| 25 15 + -| 32 22 + -| 24 14 + ... + +The program first saves the original value of field three in the +variable `nboxes'. The `-' sign represents subtraction, so this +program reassigns field three, `$3', as the original value of field +three minus ten: `$3 - 10'. (*Note Arithmetic Ops::.) Then it prints +the original and new values for field three. (Someone in the warehouse +made a consistent mistake while inventorying the red boxes.) + + For this to work, the text in field `$3' must make sense as a +number; the string of characters must be converted to a number for the +computer to do arithmetic on it. The number resulting from the +subtraction is converted back to a string of characters that then +becomes field three. *Note Conversion::. + + When the value of a field is changed (as perceived by `awk'), the +text of the input record is recalculated to contain the new field where +the old one was. In other words, `$0' changes to reflect the altered +field. Thus, this program prints a copy of the input file, with 10 +subtracted from the second field of each line: + + $ awk '{ $2 = $2 - 10; print $0 }' inventory-shipped + -| Jan 3 25 15 115 + -| Feb 5 32 24 226 + -| Mar 5 24 34 228 + ... + + It is also possible to also assign contents to fields that are out +of range. For example: + + $ awk '{ $6 = ($5 + $4 + $3 + $2) + > print $6 }' inventory-shipped + -| 168 + -| 297 + -| 301 + ... + +We've just created `$6', whose value is the sum of fields `$2', `$3', +`$4', and `$5'. The `+' sign represents addition. For the file +`inventory-shipped', `$6' represents the total number of parcels +shipped for a particular month. + + Creating a new field changes `awk''s internal copy of the current +input record, which is the value of `$0'. Thus, if you do `print $0' +after adding a field, the record printed includes the new field, with +the appropriate number of field separators between it and the previously +existing fields. + + This recomputation affects and is affected by `NF' (the number of +fields; *note Fields::). For example, the value of `NF' is set to the +number of the highest field you create. The exact format of `$0' is +also affected by a feature that has not been discussed yet: the "output +field separator", `OFS', used to separate the fields (*note Output +Separators::). + + Note, however, that merely _referencing_ an out-of-range field does +_not_ change the value of either `$0' or `NF'. Referencing an +out-of-range field only produces an empty string. For example: + + if ($(NF+1) != "") + print "can't happen" + else + print "everything is normal" + +should print `everything is normal', because `NF+1' is certain to be +out of range. (*Note If Statement::, for more information about +`awk''s `if-else' statements. *Note Typing and Comparison::, for more +information about the `!=' operator.) + + It is important to note that making an assignment to an existing +field changes the value of `$0' but does not change the value of `NF', +even when you assign the empty string to a field. For example: + + $ echo a b c d | awk '{ OFS = ":"; $2 = "" + > print $0; print NF }' + -| a::c:d + -| 4 + +The field is still there; it just has an empty value, denoted by the +two colons between `a' and `c'. This example shows what happens if you +create a new field: + + $ echo a b c d | awk '{ OFS = ":"; $2 = ""; $6 = "new" + > print $0; print NF }' + -| a::c:d::new + -| 6 + +The intervening field, `$5', is created with an empty value (indicated +by the second pair of adjacent colons), and `NF' is updated with the +value six. + + Decrementing `NF' throws away the values of the fields after the new +value of `NF' and recomputes `$0'. (d.c.) Here is an example: + + $ echo a b c d e f | awk '{ print "NF =", NF; + > NF = 3; print $0 }' + -| NF = 6 + -| a b c + + *Caution:* Some versions of `awk' don't rebuild `$0' when `NF' is +decremented. Caveat emptor. + + Finally, there are times when it is convenient to force `awk' to +rebuild the entire record, using the current value of the fields and +`OFS'. To do this, use the seemingly innocuous assignment: + + $1 = $1 # force record to be reconstituted + print $0 # or whatever else with $0 + +This forces `awk' rebuild the record. It does help to add a comment, +as we've shown here. + + There is a flip side to the relationship between `$0' and the +fields. Any assignment to `$0' causes the record to be reparsed into +fields using the _current_ value of `FS'. This also applies to any +built-in function that updates `$0', such as `sub' and `gsub' (*note +String Functions::). + + +File: gawk.info, Node: Field Separators, Next: Constant Size, Prev: Changing Fields, Up: Reading Files + +3.5 Specifying How Fields Are Separated +======================================= + +* Menu: + +* Regexp Field Splitting:: Using regexps as the field separator. +* Single Character Fields:: Making each character a separate field. +* Command Line Field Separator:: Setting `FS' from the command-line. +* Field Splitting Summary:: Some final points and a summary table. + + The "field separator", which is either a single character or a +regular expression, controls the way `awk' splits an input record into +fields. `awk' scans the input record for character sequences that +match the separator; the fields themselves are the text between the +matches. + + In the examples that follow, we use the bullet symbol (*) to +represent spaces in the output. If the field separator is `oo', then +the following line: + + moo goo gai pan + +is split into three fields: `m', `*g', and `*gai*pan'. Note the +leading spaces in the values of the second and third fields. + + The field separator is represented by the built-in variable `FS'. +Shell programmers take note: `awk' does _not_ use the name `IFS' that +is used by the POSIX-compliant shells (such as the Unix Bourne shell, +`sh', or `bash'). + + The value of `FS' can be changed in the `awk' program with the +assignment operator, `=' (*note Assignment Ops::). Often the right +time to do this is at the beginning of execution before any input has +been processed, so that the very first record is read with the proper +separator. To do this, use the special `BEGIN' pattern (*note +BEGIN/END::). For example, here we set the value of `FS' to the string +`","': + + awk 'BEGIN { FS = "," } ; { print $2 }' + +Given the input line: + + John Q. Smith, 29 Oak St., Walamazoo, MI 42139 + +this `awk' program extracts and prints the string `*29*Oak*St.'. + + Sometimes the input data contains separator characters that don't +separate fields the way you thought they would. For instance, the +person's name in the example we just used might have a title or suffix +attached, such as: + + John Q. Smith, LXIX, 29 Oak St., Walamazoo, MI 42139 + +The same program would extract `*LXIX', instead of `*29*Oak*St.'. If +you were expecting the program to print the address, you would be +surprised. The moral is to choose your data layout and separator +characters carefully to prevent such problems. (If the data is not in +a form that is easy to process, perhaps you can massage it first with a +separate `awk' program.) + + Fields are normally separated by whitespace sequences (spaces, tabs, +and newlines), not by single spaces. Two spaces in a row do not +delimit an empty field. The default value of the field separator `FS' +is a string containing a single space, `" "'. If `awk' interpreted +this value in the usual way, each space character would separate +fields, so two spaces in a row would make an empty field between them. +The reason this does not happen is that a single space as the value of +`FS' is a special case--it is taken to specify the default manner of +delimiting fields. + + If `FS' is any other single character, such as `","', then each +occurrence of that character separates two fields. Two consecutive +occurrences delimit an empty field. If the character occurs at the +beginning or the end of the line, that too delimits an empty field. The +space character is the only single character that does not follow these +rules. + + +File: gawk.info, Node: Regexp Field Splitting, Next: Single Character Fields, Up: Field Separators + +3.5.1 Using Regular Expressions to Separate Fields +-------------------------------------------------- + +The previous node discussed the use of single characters or simple +strings as the value of `FS'. More generally, the value of `FS' may be +a string containing any regular expression. In this case, each match +in the record for the regular expression separates fields. For +example, the assignment: + + FS = ", \t" + +makes every area of an input line that consists of a comma followed by a +space and a TAB into a field separator. (`\t' is an "escape sequence" +that stands for a TAB; *note Escape Sequences::, for the complete list +of similar escape sequences.) + + For a less trivial example of a regular expression, try using single +spaces to separate fields the way single commas are used. `FS' can be +set to `"[ ]"' (left bracket, space, right bracket). This regular +expression matches a single space and nothing else (*note Regexp::). + + There is an important difference between the two cases of `FS = " "' +(a single space) and `FS = "[ \t\n]+"' (a regular expression matching +one or more spaces, tabs, or newlines). For both values of `FS', +fields are separated by "runs" (multiple adjacent occurrences) of +spaces, tabs, and/or newlines. However, when the value of `FS' is +`" "', `awk' first strips leading and trailing whitespace from the +record and then decides where the fields are. For example, the +following pipeline prints `b': + + $ echo ' a b c d ' | awk '{ print $2 }' + -| b + +However, this pipeline prints `a' (note the extra spaces around each +letter): + + $ echo ' a b c d ' | awk 'BEGIN { FS = "[ \t\n]+" } + > { print $2 }' + -| a + +In this case, the first field is "null" or empty. + + The stripping of leading and trailing whitespace also comes into +play whenever `$0' is recomputed. For instance, study this pipeline: + + $ echo ' a b c d' | awk '{ print; $2 = $2; print }' + -| a b c d + -| a b c d + +The first `print' statement prints the record as it was read, with +leading whitespace intact. The assignment to `$2' rebuilds `$0' by +concatenating `$1' through `$NF' together, separated by the value of +`OFS'. Because the leading whitespace was ignored when finding `$1', +it is not part of the new `$0'. Finally, the last `print' statement +prints the new `$0'. + + +File: gawk.info, Node: Single Character Fields, Next: Command Line Field Separator, Prev: Regexp Field Splitting, Up: Field Separators + +3.5.2 Making Each Character a Separate Field +-------------------------------------------- + +There are times when you may want to examine each character of a record +separately. This can be done in `gawk' by simply assigning the null +string (`""') to `FS'. In this case, each individual character in the +record becomes a separate field. For example: + + $ echo a b | gawk 'BEGIN { FS = "" } + > { + > for (i = 1; i <= NF; i = i + 1) + > print "Field", i, "is", $i + > }' + -| Field 1 is a + -| Field 2 is + -| Field 3 is b + + Traditionally, the behavior of `FS' equal to `""' was not defined. +In this case, most versions of Unix `awk' simply treat the entire record +as only having one field. (d.c.) In compatibility mode (*note +Options::), if `FS' is the null string, then `gawk' also behaves this +way. + + +File: gawk.info, Node: Command Line Field Separator, Next: Field Splitting Summary, Prev: Single Character Fields, Up: Field Separators + +3.5.3 Setting `FS' from the Command Line +---------------------------------------- + +`FS' can be set on the command line. Use the `-F' option to do so. +For example: + + awk -F, 'PROGRAM' INPUT-FILES + +sets `FS' to the `,' character. Notice that the option uses an +uppercase `F' instead of a lowercase `f'. The latter option (`-f') +specifies a file containing an `awk' program. Case is significant in +command-line options: the `-F' and `-f' options have nothing to do with +each other. You can use both options at the same time to set the `FS' +variable _and_ get an `awk' program from a file. + + The value used for the argument to `-F' is processed in exactly the +same way as assignments to the built-in variable `FS'. Any special +characters in the field separator must be escaped appropriately. For +example, to use a `\' as the field separator on the command line, you +would have to type: + + # same as FS = "\\" + awk -F\\\\ '...' files ... + +Because `\' is used for quoting in the shell, `awk' sees `-F\\'. Then +`awk' processes the `\\' for escape characters (*note Escape +Sequences::), finally yielding a single `\' to use for the field +separator. + + As a special case, in compatibility mode (*note Options::), if the +argument to `-F' is `t', then `FS' is set to the TAB character. If you +type `-F\t' at the shell, without any quotes, the `\' gets deleted, so +`awk' figures that you really want your fields to be separated with +tabs and not `t's. Use `-v FS="t"' or `-F"[t]"' on the command line if +you really do want to separate your fields with `t's. + + For example, let's use an `awk' program file called `baud.awk' that +contains the pattern `/300/' and the action `print $1': + + /300/ { print $1 } + + Let's also set `FS' to be the `-' character and run the program on +the file `BBS-list'. The following command prints a list of the names +of the bulletin boards that operate at 300 baud and the first three +digits of their phone numbers: + + $ awk -F- -f baud.awk BBS-list + -| aardvark 555 + -| alpo + -| barfly 555 + -| bites 555 + -| camelot 555 + -| core 555 + -| fooey 555 + -| foot 555 + -| macfoo 555 + -| sdace 555 + -| sabafoo 555 + +Note the second line of output. The second line in the original file +looked like this: + + alpo-net 555-3412 2400/1200/300 A + + The `-' as part of the system's name was used as the field +separator, instead of the `-' in the phone number that was originally +intended. This demonstrates why you have to be careful in choosing +your field and record separators. + + Perhaps the most common use of a single character as the field +separator occurs when processing the Unix system password file. On +many Unix systems, each user has a separate entry in the system password +file, one line per user. The information in these lines is separated +by colons. The first field is the user's login name and the second is +the user's (encrypted or shadow) password. A password file entry might +look like this: + + arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/bash + + The following program searches the system password file and prints +the entries for users who have no password: + + awk -F: '$2 == ""' /etc/passwd + + +File: gawk.info, Node: Field Splitting Summary, Prev: Command Line Field Separator, Up: Field Separators + +3.5.4 Field-Splitting Summary +----------------------------- + +It is important to remember that when you assign a string constant as +the value of `FS', it undergoes normal `awk' string processing. For +example, with Unix `awk' and `gawk', the assignment `FS = "\.."' +assigns the character string `".."' to `FS' (the backslash is +stripped). This creates a regexp meaning "fields are separated by +occurrences of any two characters." If instead you want fields to be +separated by a literal period followed by any single character, use `FS += "\\.."'. + + The following table summarizes how fields are split, based on the +value of `FS' (`==' means "is equal to"): + +`FS == " "' + Fields are separated by runs of whitespace. Leading and trailing + whitespace are ignored. This is the default. + +`FS == ANY OTHER SINGLE CHARACTER' + Fields are separated by each occurrence of the character. Multiple + successive occurrences delimit empty fields, as do leading and + trailing occurrences. The character can even be a regexp + metacharacter; it does not need to be escaped. + +`FS == REGEXP' + Fields are separated by occurrences of characters that match + REGEXP. Leading and trailing matches of REGEXP delimit empty + fields. + +`FS == ""' + Each individual character in the record becomes a separate field. + (This is a `gawk' extension; it is not specified by the POSIX + standard.) + +Advanced Notes: Changing `FS' Does Not Affect the Fields +-------------------------------------------------------- + +According to the POSIX standard, `awk' is supposed to behave as if each +record is split into fields at the time it is read. In particular, +this means that if you change the value of `FS' after a record is read, +the value of the fields (i.e., how they were split) should reflect the +old value of `FS', not the new one. + + However, many implementations of `awk' do not work this way. +Instead, they defer splitting the fields until a field is actually +referenced. The fields are split using the _current_ value of `FS'! +(d.c.) This behavior can be difficult to diagnose. The following +example illustrates the difference between the two methods. (The +`sed'(1) command prints just the first line of `/etc/passwd'.) + + sed 1q /etc/passwd | awk '{ FS = ":" ; print $1 }' + +which usually prints: + + root + +on an incorrect implementation of `awk', while `gawk' prints something +like: + + root:nSijPlPhZZwgE:0:0:Root:/: + +Advanced Notes: `FS' and `IGNORECASE' +------------------------------------- + +The `IGNORECASE' variable (*note User-modified::) affects field +splitting _only_ when the value of `FS' is a regexp. It has no effect +when `FS' is a single character, even if that character is a letter. +Thus, in the following code: + + FS = "c" + IGNORECASE = 1 + $0 = "aCa" + print $1 + +The output is `aCa'. If you really want to split fields on an +alphabetic character while ignoring case, use a regexp that will do it +for you. E.g., `FS = "[c]"'. In this case, `IGNORECASE' will take +effect. + + ---------- Footnotes ---------- + + (1) The `sed' utility is a "stream editor." Its behavior is also +defined by the POSIX standard. + + +File: gawk.info, Node: Constant Size, Next: Multiple Line, Prev: Field Separators, Up: Reading Files + +3.6 Reading Fixed-Width Data +============================ + +(This minor node discusses an advanced feature of `awk'. If you are a +novice `awk' user, you might want to skip it on the first reading.) + +`gawk' version 2.13 introduced a facility for dealing with fixed-width +fields with no distinctive field separator. For example, data of this +nature arises in the input for old Fortran programs where numbers are +run together, or in the output of programs that did not anticipate the +use of their output as input for other programs. + + An example of the latter is a table where all the columns are lined +up by the use of a variable number of spaces and _empty fields are just +spaces_. Clearly, `awk''s normal field splitting based on `FS' does +not work well in this case. Although a portable `awk' program can use +a series of `substr' calls on `$0' (*note String Functions::), this is +awkward and inefficient for a large number of fields. + + The splitting of an input record into fixed-width fields is +specified by assigning a string containing space-separated numbers to +the built-in variable `FIELDWIDTHS'. Each number specifies the width +of the field, _including_ columns between fields. If you want to +ignore the columns between fields, you can specify the width as a +separate field that is subsequently ignored. It is a fatal error to +supply a field width that is not a positive number. The following data +is the output of the Unix `w' utility. It is useful to illustrate the +use of `FIELDWIDTHS': + + 10:06pm up 21 days, 14:04, 23 users + User tty login idle JCPU PCPU what + hzuo ttyV0 8:58pm 9 5 vi p24.tex + hzang ttyV3 6:37pm 50 -csh + eklye ttyV5 9:53pm 7 1 em thes.tex + dportein ttyV6 8:17pm 1:47 -csh + gierd ttyD3 10:00pm 1 elm + dave ttyD4 9:47pm 4 4 w + brent ttyp0 26Jun91 4:46 26:46 4:41 bash + dave ttyq4 26Jun9115days 46 46 wnewmail + + The following program takes the above input, converts the idle time +to number of seconds, and prints out the first two fields and the +calculated idle time: + + NOTE: This program uses a number of `awk' features that haven't + been introduced yet. + + BEGIN { FIELDWIDTHS = "9 6 10 6 7 7 35" } + NR > 2 { + idle = $4 + sub(/^ */, "", idle) # strip leading spaces + if (idle == "") + idle = 0 + if (idle ~ /:/) { + split(idle, t, ":") + idle = t[1] * 60 + t[2] + } + if (idle ~ /days/) + idle *= 24 * 60 * 60 + + print $1, $2, idle + } + + Running the program on the data produces the following results: + + hzuo ttyV0 0 + hzang ttyV3 50 + eklye ttyV5 0 + dportein ttyV6 107 + gierd ttyD3 1 + dave ttyD4 0 + brent ttyp0 286 + dave ttyq4 1296000 + + Another (possibly more practical) example of fixed-width input data +is the input from a deck of balloting cards. In some parts of the +United States, voters mark their choices by punching holes in computer +cards. These cards are then processed to count the votes for any +particular candidate or on any particular issue. Because a voter may +choose not to vote on some issue, any column on the card may be empty. +An `awk' program for processing such data could use the `FIELDWIDTHS' +feature to simplify reading the data. (Of course, getting `gawk' to +run on a system with card readers is another story!) + + Assigning a value to `FS' causes `gawk' to use `FS' for field +splitting again. Use `FS = FS' to make this happen, without having to +know the current value of `FS'. In order to tell which kind of field +splitting is in effect, use `PROCINFO["FS"]' (*note Auto-set::). The +value is `"FS"' if regular field splitting is being used, or it is +`"FIELDWIDTHS"' if fixed-width field splitting is being used: + + if (PROCINFO["FS"] == "FS") + REGULAR FIELD SPLITTING ... + else + FIXED-WIDTH FIELD SPLITTING ... + + This information is useful when writing a function that needs to +temporarily change `FS' or `FIELDWIDTHS', read some records, and then +restore the original settings (*note Passwd Functions::, for an example +of such a function). + + +File: gawk.info, Node: Multiple Line, Next: Getline, Prev: Constant Size, Up: Reading Files + +3.7 Multiple-Line Records +========================= + +In some databases, a single line cannot conveniently hold all the +information in one entry. In such cases, you can use multiline +records. The first step in doing this is to choose your data format. + + One technique is to use an unusual character or string to separate +records. For example, you could use the formfeed character (written +`\f' in `awk', as in C) to separate them, making each record a page of +the file. To do this, just set the variable `RS' to `"\f"' (a string +containing the formfeed character). Any other character could equally +well be used, as long as it won't be part of the data in a record. + + Another technique is to have blank lines separate records. By a +special dispensation, an empty string as the value of `RS' indicates +that records are separated by one or more blank lines. When `RS' is set +to the empty string, each record always ends at the first blank line +encountered. The next record doesn't start until the first nonblank +line that follows. No matter how many blank lines appear in a row, they +all act as one record separator. (Blank lines must be completely +empty; lines that contain only whitespace do not count.) + + You can achieve the same effect as `RS = ""' by assigning the string +`"\n\n+"' to `RS'. This regexp matches the newline at the end of the +record and one or more blank lines after the record. In addition, a +regular expression always matches the longest possible sequence when +there is a choice (*note Leftmost Longest::). So the next record +doesn't start until the first nonblank line that follows--no matter how +many blank lines appear in a row, they are considered one record +separator. + + There is an important difference between `RS = ""' and `RS = +"\n\n+"'. In the first case, leading newlines in the input data file +are ignored, and if a file ends without extra blank lines after the +last record, the final newline is removed from the record. In the +second case, this special processing is not done. (d.c.) + + Now that the input is separated into records, the second step is to +separate the fields in the record. One way to do this is to divide each +of the lines into fields in the normal manner. This happens by default +as the result of a special feature. When `RS' is set to the empty +string, _and_ `FS' is set to a single character, the newline character +_always_ acts as a field separator. This is in addition to whatever +field separations result from `FS'.(1) + + The original motivation for this special exception was probably to +provide useful behavior in the default case (i.e., `FS' is equal to +`" "'). This feature can be a problem if you really don't want the +newline character to separate fields, because there is no way to +prevent it. However, you can work around this by using the `split' +function to break up the record manually (*note String Functions::). +If you have a single character field separator, you can work around the +special feature in a different way, by making `FS' into a regexp for +that single character. For example, if the field separator is a +percent character, instead of `FS = "%"', use `FS = "[%]"'. + + Another way to separate fields is to put each field on a separate +line: to do this, just set the variable `FS' to the string `"\n"'. +(This single character separator matches a single newline.) A +practical example of a data file organized this way might be a mailing +list, where each entry is separated by blank lines. Consider a mailing +list in a file named `addresses', which looks like this: + + Jane Doe + 123 Main Street + Anywhere, SE 12345-6789 + + John Smith + 456 Tree-lined Avenue + Smallville, MW 98765-4321 + ... + +A simple program to process this file is as follows: + + # addrs.awk --- simple mailing list program + + # Records are separated by blank lines. + # Each line is one field. + BEGIN { RS = "" ; FS = "\n" } + + { + print "Name is:", $1 + print "Address is:", $2 + print "City and State are:", $3 + print "" + } + + Running the program produces the following output: + + $ awk -f addrs.awk addresses + -| Name is: Jane Doe + -| Address is: 123 Main Street + -| City and State are: Anywhere, SE 12345-6789 + -| + -| Name is: John Smith + -| Address is: 456 Tree-lined Avenue + -| City and State are: Smallville, MW 98765-4321 + -| + ... + + *Note Labels Program::, for a more realistic program that deals with +address lists. The following table summarizes how records are split, +based on the value of `RS'. (`==' means "is equal to.") + +`RS == "\n"' + Records are separated by the newline character (`\n'). In effect, + every line in the data file is a separate record, including blank + lines. This is the default. + +`RS == ANY SINGLE CHARACTER' + Records are separated by each occurrence of the character. + Multiple successive occurrences delimit empty records. + +`RS == ""' + Records are separated by runs of blank lines. When `FS' is a + single character, then the newline character always serves as a + field separator, in addition to whatever value `FS' may have. + Leading and trailing newlines in a file are ignored. + +`RS == REGEXP' + Records are separated by occurrences of characters that match + REGEXP. Leading and trailing matches of REGEXP delimit empty + records. (This is a `gawk' extension; it is not specified by the + POSIX standard.) + + In all cases, `gawk' sets `RT' to the input text that matched the +value specified by `RS'. + + ---------- Footnotes ---------- + + (1) When `FS' is the null string (`""') or a regexp, this special +feature of `RS' does not apply. It does apply to the default field +separator of a single space: `FS = " "'. + + +File: gawk.info, Node: Getline, Prev: Multiple Line, Up: Reading Files + +3.8 Explicit Input with `getline' +================================= + +So far we have been getting our input data from `awk''s main input +stream--either the standard input (usually your terminal, sometimes the +output from another program) or from the files specified on the command +line. The `awk' language has a special built-in command called +`getline' that can be used to read input under your explicit control. + + The `getline' command is used in several different ways and should +_not_ be used by beginners. The examples that follow the explanation +of the `getline' command include material that has not been covered +yet. Therefore, come back and study the `getline' command _after_ you +have reviewed the rest of this Info file and have a good knowledge of +how `awk' works. + + The `getline' command returns one if it finds a record and zero if +it encounters the end of the file. If there is some error in getting a +record, such as a file that cannot be opened, then `getline' returns +-1. In this case, `gawk' sets the variable `ERRNO' to a string +describing the error that occurred. + + In the following examples, COMMAND stands for a string value that +represents a shell command. + +* Menu: + +* Plain Getline:: Using `getline' with no arguments. +* Getline/Variable:: Using `getline' into a variable. +* Getline/File:: Using `getline' from a file. +* Getline/Variable/File:: Using `getline' into a variable from a + file. +* Getline/Pipe:: Using `getline' from a pipe. +* Getline/Variable/Pipe:: Using `getline' into a variable from a + pipe. +* Getline/Coprocess:: Using `getline' from a coprocess. +* Getline/Variable/Coprocess:: Using `getline' into a variable from a + coprocess. +* Getline Notes:: Important things to know about `getline'. +* Getline Summary:: Summary of `getline' Variants. + + +File: gawk.info, Node: Plain Getline, Next: Getline/Variable, Up: Getline + +3.8.1 Using `getline' with No Arguments +--------------------------------------- + +The `getline' command can be used without arguments to read input from +the current input file. All it does in this case is read the next +input record and split it up into fields. This is useful if you've +finished processing the current record, but want to do some special +processing on the next record _right now_. For example: + + { + if ((t = index($0, "/*")) != 0) { + # value of `tmp' will be "" if t is 1 + tmp = substr($0, 1, t - 1) + u = index(substr($0, t + 2), "*/") + while (u == 0) { + if (getline <= 0) { + m = "unexpected EOF or error" + m = (m ": " ERRNO) + print m > "/dev/stderr" + exit + } + u = index($0, "*/") + } + # substr expression will be "" if */ + # occurred at end of line + $0 = tmp substr($0, u + 2) + } + print $0 + } + + This `awk' program deletes C-style comments (`/* ... */') from the +input. By replacing the `print $0' with other statements, you could +perform more complicated processing on the decommented input, such as +searching for matches of a regular expression. (This program has a +subtle problem--it does not work if one comment ends and another begins +on the same line.) + + This form of the `getline' command sets `NF', `NR', `FNR', and the +value of `$0'. + + NOTE: The new value of `$0' is used to test the patterns of any + subsequent rules. The original value of `$0' that triggered the + rule that executed `getline' is lost. By contrast, the `next' + statement reads a new record but immediately begins processing it + normally, starting with the first rule in the program. *Note Next + Statement::. + + +File: gawk.info, Node: Getline/Variable, Next: Getline/File, Prev: Plain Getline, Up: Getline + +3.8.2 Using `getline' into a Variable +------------------------------------- + +You can use `getline VAR' to read the next record from `awk''s input +into the variable VAR. No other processing is done. For example, +suppose the next line is a comment or a special string, and you want to +read it without triggering any rules. This form of `getline' allows +you to read that line and store it in a variable so that the main +read-a-line-and-check-each-rule loop of `awk' never sees it. The +following example swaps every two lines of input: + + { + if ((getline tmp) > 0) { + print tmp + print $0 + } else + print $0 + } + +It takes the following list: + + wan + tew + free + phore + +and produces these results: + + tew + wan + phore + free + + The `getline' command used in this way sets only the variables `NR' +and `FNR' (and of course, VAR). The record is not split into fields, +so the values of the fields (including `$0') and the value of `NF' do +not change. + + +File: gawk.info, Node: Getline/File, Next: Getline/Variable/File, Prev: Getline/Variable, Up: Getline + +3.8.3 Using `getline' from a File +--------------------------------- + +Use `getline < FILE' to read the next record from FILE. Here FILE is a +string-valued expression that specifies the file name. `< FILE' is +called a "redirection" because it directs input to come from a +different place. For example, the following program reads its input +record from the file `secondary.input' when it encounters a first field +with a value equal to 10 in the current input file: + + { + if ($1 == 10) { + getline < "secondary.input" + print + } else + print + } + + Because the main input stream is not used, the values of `NR' and +`FNR' are not changed. However, the record it reads is split into +fields in the normal manner, so the values of `$0' and the other fields +are changed, resulting in a new value of `NF'. + + According to POSIX, `getline < EXPRESSION' is ambiguous if +EXPRESSION contains unparenthesized operators other than `$'; for +example, `getline < dir "/" file' is ambiguous because the +concatenation operator is not parenthesized. You should write it as +`getline < (dir "/" file)' if you want your program to be portable to +other `awk' implementations. + + +File: gawk.info, Node: Getline/Variable/File, Next: Getline/Pipe, Prev: Getline/File, Up: Getline + +3.8.4 Using `getline' into a Variable from a File +------------------------------------------------- + +Use `getline VAR < FILE' to read input from the file FILE, and put it +in the variable VAR. As above, FILE is a string-valued expression that +specifies the file from which to read. + + In this version of `getline', none of the built-in variables are +changed and the record is not split into fields. The only variable +changed is VAR. For example, the following program copies all the +input files to the output, except for records that say +`@include FILENAME'. Such a record is replaced by the contents of the +file FILENAME: + + { + if (NF == 2 && $1 == "@include") { + while ((getline line < $2) > 0) + print line + close($2) + } else + print + } + + Note here how the name of the extra input file is not built into the +program; it is taken directly from the data, specifically from the +second field on the `@include' line. + + The `close' function is called to ensure that if two identical +`@include' lines appear in the input, the entire specified file is +included twice. *Note Close Files And Pipes::. + + One deficiency of this program is that it does not process nested +`@include' statements (i.e., `@include' statements in included files) +the way a true macro preprocessor would. *Note Igawk Program::, for a +program that does handle nested `@include' statements. + + +File: gawk.info, Node: Getline/Pipe, Next: Getline/Variable/Pipe, Prev: Getline/Variable/File, Up: Getline + +3.8.5 Using `getline' from a Pipe +--------------------------------- + +The output of a command can also be piped into `getline', using +`COMMAND | getline'. In this case, the string COMMAND is run as a +shell command and its output is piped into `awk' to be used as input. +This form of `getline' reads one record at a time from the pipe. For +example, the following program copies its input to its output, except +for lines that begin with `@execute', which are replaced by the output +produced by running the rest of the line as a shell command: + + { + if ($1 == "@execute") { + tmp = substr($0, 10) + while ((tmp | getline) > 0) + print + close(tmp) + } else + print + } + +The `close' function is called to ensure that if two identical +`@execute' lines appear in the input, the command is run for each one. +*Note Close Files And Pipes::. Given the input: + + foo + bar + baz + @execute who + bletch + +the program might produce: + + foo + bar + baz + arnold ttyv0 Jul 13 14:22 + miriam ttyp0 Jul 13 14:23 (murphy:0) + bill ttyp1 Jul 13 14:23 (murphy:0) + bletch + +Notice that this program ran the command `who' and printed the previous +result. (If you try this program yourself, you will of course get +different results, depending upon who is logged in on your system.) + + This variation of `getline' splits the record into fields, sets the +value of `NF', and recomputes the value of `$0'. The values of `NR' +and `FNR' are not changed. + + According to POSIX, `EXPRESSION | getline' is ambiguous if +EXPRESSION contains unparenthesized operators other than `$'--for +example, `"echo " "date" | getline' is ambiguous because the +concatenation operator is not parenthesized. You should write it as +`("echo " "date") | getline' if you want your program to be portable to +other `awk' implementations. + + NOTE: Unfortunately, `gawk' has not been consistent in its + treatment of a construct like `"echo " "date" | getline'. Up to + and including version 3.1.1 of `gawk', it was treated as `("echo " + "date") | getline'. (This how Unix `awk' behaves.) From 3.1.2 + through 3.1.5, it was treated as `"echo " ("date" | getline)'. + (This is how `mawk' behaves.) Starting with version 3.1.6, the + earlier behavior was reinstated. In short, _always_ use explicit + parentheses, and then you won't have to worry. + + +File: gawk.info, Node: Getline/Variable/Pipe, Next: Getline/Coprocess, Prev: Getline/Pipe, Up: Getline + +3.8.6 Using `getline' into a Variable from a Pipe +------------------------------------------------- + +When you use `COMMAND | getline VAR', the output of COMMAND is sent +through a pipe to `getline' and into the variable VAR. For example, the +following program reads the current date and time into the variable +`current_time', using the `date' utility, and then prints it: + + BEGIN { + "date" | getline current_time + close("date") + print "Report printed on " current_time + } + + In this version of `getline', none of the built-in variables are +changed and the record is not split into fields. + + According to POSIX, `EXPRESSION | getline VAR' is ambiguous if +EXPRESSION contains unparenthesized operators other than `$'; for +example, `"echo " "date" | getline VAR' is ambiguous because the +concatenation operator is not parenthesized. You should write it as +`("echo " "date") | getline VAR' if you want your program to be +portable to other `awk' implementations. + + +File: gawk.info, Node: Getline/Coprocess, Next: Getline/Variable/Coprocess, Prev: Getline/Variable/Pipe, Up: Getline + +3.8.7 Using `getline' from a Coprocess +-------------------------------------- + +Input into `getline' from a pipe is a one-way operation. The command +that is started with `COMMAND | getline' only sends data _to_ your +`awk' program. + + On occasion, you might want to send data to another program for +processing and then read the results back. `gawk' allows you to start +a "coprocess", with which two-way communications are possible. This is +done with the `|&' operator. Typically, you write data to the +coprocess first and then read results back, as shown in the following: + + print "SOME QUERY" |& "db_server" + "db_server" |& getline + +which sends a query to `db_server' and then reads the results. + + The values of `NR' and `FNR' are not changed, because the main input +stream is not used. However, the record is split into fields in the +normal manner, thus changing the values of `$0', of the other fields, +and of `NF'. + + Coprocesses are an advanced feature. They are discussed here only +because this is the minor node on `getline'. *Note Two-way I/O::, +where coprocesses are discussed in more detail. + + +File: gawk.info, Node: Getline/Variable/Coprocess, Next: Getline Notes, Prev: Getline/Coprocess, Up: Getline + +3.8.8 Using `getline' into a Variable from a Coprocess +------------------------------------------------------ + +When you use `COMMAND |& getline VAR', the output from the coprocess +COMMAND is sent through a two-way pipe to `getline' and into the +variable VAR. + + In this version of `getline', none of the built-in variables are +changed and the record is not split into fields. The only variable +changed is VAR. + + Coprocesses are an advanced feature. They are discussed here only +because this is the minor node on `getline'. *Note Two-way I/O::, +where coprocesses are discussed in more detail. + + +File: gawk.info, Node: Getline Notes, Next: Getline Summary, Prev: Getline/Variable/Coprocess, Up: Getline + +3.8.9 Points to Remember About `getline' +---------------------------------------- + +Here are some miscellaneous points about `getline' that you should bear +in mind: + + * When `getline' changes the value of `$0' and `NF', `awk' does + _not_ automatically jump to the start of the program and start + testing the new record against every pattern. However, the new + record is tested against any subsequent rules. + + * Many `awk' implementations limit the number of pipelines that an + `awk' program may have open to just one. In `gawk', there is no + such limit. You can open as many pipelines (and coprocesses) as + the underlying operating system permits. + + * An interesting side effect occurs if you use `getline' without a + redirection inside a `BEGIN' rule. Because an unredirected + `getline' reads from the command-line data files, the first + `getline' command causes `awk' to set the value of `FILENAME'. + Normally, `FILENAME' does not have a value inside `BEGIN' rules, + because you have not yet started to process the command-line data + files. (d.c.) (*Note BEGIN/END::, also *note Auto-set::.) + + * Using `FILENAME' with `getline' (`getline < FILENAME') is likely + to be a source for confusion. `awk' opens a separate input stream + from the current input file. However, by not using a variable, + `$0' and `NR' are still updated. If you're doing this, it's + probably by accident, and you should reconsider what it is you're + trying to accomplish. + + +File: gawk.info, Node: Getline Summary, Prev: Getline Notes, Up: Getline + +3.8.10 Summary of `getline' Variants +------------------------------------ + +*note table-getline-variants:: summarizes the eight variants of +`getline', listing which built-in variables are set by each one. + +Variant Effect +-------------------------------------------------------------------------- +`getline' Sets `$0', `NF', `FNR', and `NR' +`getline' VAR Sets VAR, `FNR', and `NR' +`getline <' FILE Sets `$0' and `NF' +`getline VAR < FILE' Sets VAR +COMMAND `| getline' Sets `$0' and `NF' +COMMAND `| getline' VAR Sets VAR +COMMAND `|& getline' Sets `$0' and `NF'. This is a `gawk' extension +COMMAND `|& getline' VAR Sets VAR. This is a `gawk' extension + +Table 3.1: getline Variants and What They Set + + +File: gawk.info, Node: Printing, Next: Expressions, Prev: Reading Files, Up: Top + +4 Printing Output +***************** + +One of the most common programming actions is to "print", or output, +some or all of the input. Use the `print' statement for simple output, +and the `printf' statement for fancier formatting. The `print' +statement is not limited when computing _which_ values to print. +However, with two exceptions, you cannot specify _how_ to print +them--how many columns, whether to use exponential notation or not, and +so on. (For the exceptions, *note Output Separators::, and *note +OFMT::.) For printing with specifications, you need the `printf' +statement (*note Printf::). + + Besides basic and formatted printing, this major node also covers +I/O redirections to files and pipes, introduces the special file names +that `gawk' processes internally, and discusses the `close' built-in +function. + +* Menu: + +* Print:: The `print' statement. +* Print Examples:: Simple examples of `print' statements. +* Output Separators:: The output separators and how to change them. +* OFMT:: Controlling Numeric Output With `print'. +* Printf:: The `printf' statement. +* Redirection:: How to redirect output to multiple files and + pipes. +* Special Files:: File name interpretation in `gawk'. + `gawk' allows access to inherited file + descriptors. +* Close Files And Pipes:: Closing Input and Output Files and Pipes. + + +File: gawk.info, Node: Print, Next: Print Examples, Up: Printing + +4.1 The `print' Statement +========================= + +The `print' statement is used to produce output with simple, +standardized formatting. Specify only the strings or numbers to print, +in a list separated by commas. They are output, separated by single +spaces, followed by a newline. The statement looks like this: + + print ITEM1, ITEM2, ... + +The entire list of items may be optionally enclosed in parentheses. The +parentheses are necessary if any of the item expressions uses the `>' +relational operator; otherwise it could be confused with a redirection +(*note Redirection::). + + The items to print can be constant strings or numbers, fields of the +current record (such as `$1'), variables, or any `awk' expression. +Numeric values are converted to strings and then printed. + + The simple statement `print' with no items is equivalent to `print +$0': it prints the entire current record. To print a blank line, use +`print ""', where `""' is the empty string. To print a fixed piece of +text, use a string constant, such as `"Don't Panic"', as one item. If +you forget to use the double-quote characters, your text is taken as an +`awk' expression, and you will probably get an error. Keep in mind +that a space is printed between any two items. + + +File: gawk.info, Node: Print Examples, Next: Output Separators, Prev: Print, Up: Printing + +4.2 Examples of `print' Statements +================================== + +Each `print' statement makes at least one line of output. However, it +isn't limited to only one line. If an item value is a string that +contains a newline, the newline is output along with the rest of the +string. A single `print' statement can make any number of lines this +way. + + The following is an example of printing a string that contains +embedded newlines (the `\n' is an escape sequence, used to represent +the newline character; *note Escape Sequences::): + + $ awk 'BEGIN { print "line one\nline two\nline three" }' + -| line one + -| line two + -| line three + + The next example, which is run on the `inventory-shipped' file, +prints the first two fields of each input record, with a space between +them: + + $ awk '{ print $1, $2 }' inventory-shipped + -| Jan 13 + -| Feb 15 + -| Mar 15 + ... + + A common mistake in using the `print' statement is to omit the comma +between two items. This often has the effect of making the items run +together in the output, with no space. The reason for this is that +juxtaposing two string expressions in `awk' means to concatenate them. +Here is the same program, without the comma: + + $ awk '{ print $1 $2 }' inventory-shipped + -| Jan13 + -| Feb15 + -| Mar15 + ... + + To someone unfamiliar with the `inventory-shipped' file, neither +example's output makes much sense. A heading line at the beginning +would make it clearer. Let's add some headings to our table of months +(`$1') and green crates shipped (`$2'). We do this using the `BEGIN' +pattern (*note BEGIN/END::) so that the headings are only printed once: + + awk 'BEGIN { print "Month Crates" + print "----- ------" } + { print $1, $2 }' inventory-shipped + +When run, the program prints the following: + + Month Crates + ----- ------ + Jan 13 + Feb 15 + Mar 15 + ... + +The only problem, however, is that the headings and the table data +don't line up! We can fix this by printing some spaces between the two +fields: + + awk 'BEGIN { print "Month Crates" + print "----- ------" } + { print $1, " ", $2 }' inventory-shipped + + Lining up columns this way can get pretty complicated when there are +many columns to fix. Counting spaces for two or three columns is +simple, but any more than this can take up a lot of time. This is why +the `printf' statement was created (*note Printf::); one of its +specialties is lining up columns of data. + + NOTE: You can continue either a `print' or `printf' statement + simply by putting a newline after any comma (*note + Statements/Lines::). + + +File: gawk.info, Node: Output Separators, Next: OFMT, Prev: Print Examples, Up: Printing + +4.3 Output Separators +===================== + +As mentioned previously, a `print' statement contains a list of items +separated by commas. In the output, the items are normally separated +by single spaces. However, this doesn't need to be the case; a single +space is only the default. Any string of characters may be used as the +"output field separator" by setting the built-in variable `OFS'. The +initial value of this variable is the string `" "'--that is, a single +space. + + The output from an entire `print' statement is called an "output +record". Each `print' statement outputs one output record, and then +outputs a string called the "output record separator" (or `ORS'). The +initial value of `ORS' is the string `"\n"'; i.e., a newline character. +Thus, each `print' statement normally makes a separate line. + + In order to change how output fields and records are separated, +assign new values to the variables `OFS' and `ORS'. The usual place to +do this is in the `BEGIN' rule (*note BEGIN/END::), so that it happens +before any input is processed. It can also be done with assignments on +the command line, before the names of the input files, or using the +`-v' command-line option (*note Options::). The following example +prints the first and second fields of each input record, separated by a +semicolon, with a blank line added after each newline: + + $ awk 'BEGIN { OFS = ";"; ORS = "\n\n" } + > { print $1, $2 }' BBS-list + -| aardvark;555-5553 + -| + -| alpo-net;555-3412 + -| + -| barfly;555-7685 + ... + + If the value of `ORS' does not contain a newline, the program's +output is run together on a single line. + + +File: gawk.info, Node: OFMT, Next: Printf, Prev: Output Separators, Up: Printing + +4.4 Controlling Numeric Output with `print' +=========================================== + +When the `print' statement is used to print numeric values, `awk' +internally converts the number to a string of characters and prints +that string. `awk' uses the `sprintf' function to do this conversion +(*note String Functions::). For now, it suffices to say that the +`sprintf' function accepts a "format specification" that tells it how +to format numbers (or strings), and that there are a number of +different ways in which numbers can be formatted. The different format +specifications are discussed more fully in *note Control Letters::. + + The built-in variable `OFMT' contains the default format +specification that `print' uses with `sprintf' when it wants to convert +a number to a string for printing. The default value of `OFMT' is +`"%.6g"'. The way `print' prints numbers can be changed by supplying +different format specifications as the value of `OFMT', as shown in the +following example: + + $ awk 'BEGIN { + > OFMT = "%.0f" # print numbers as integers (rounds) + > print 17.23, 17.54 }' + -| 17 18 + +According to the POSIX standard, `awk''s behavior is undefined if +`OFMT' contains anything but a floating-point conversion specification. +(d.c.) + + +File: gawk.info, Node: Printf, Next: Redirection, Prev: OFMT, Up: Printing + +4.5 Using `printf' Statements for Fancier Printing +================================================== + +For more precise control over the output format than what is normally +provided by `print', use `printf'. `printf' can be used to specify the +width to use for each item, as well as various formatting choices for +numbers (such as what output base to use, whether to print an exponent, +whether to print a sign, and how many digits to print after the decimal +point). This is done by supplying a string, called the "format +string", that controls how and where to print the other arguments. + +* Menu: + +* Basic Printf:: Syntax of the `printf' statement. +* Control Letters:: Format-control letters. +* Format Modifiers:: Format-specification modifiers. +* Printf Examples:: Several examples. + + +File: gawk.info, Node: Basic Printf, Next: Control Letters, Up: Printf + +4.5.1 Introduction to the `printf' Statement +-------------------------------------------- + +A simple `printf' statement looks like this: + + printf FORMAT, ITEM1, ITEM2, ... + +The entire list of arguments may optionally be enclosed in parentheses. +The parentheses are necessary if any of the item expressions use the `>' +relational operator; otherwise, it can be confused with a redirection +(*note Redirection::). + + The difference between `printf' and `print' is the FORMAT argument. +This is an expression whose value is taken as a string; it specifies +how to output each of the other arguments. It is called the "format +string". + + The format string is very similar to that in the ISO C library +function `printf'. Most of FORMAT is text to output verbatim. +Scattered among this text are "format specifiers"--one per item. Each +format specifier says to output the next item in the argument list at +that place in the format. + + The `printf' statement does not automatically append a newline to +its output. It outputs only what the format string specifies. So if a +newline is needed, you must include one in the format string. The +output separator variables `OFS' and `ORS' have no effect on `printf' +statements. For example: + + $ awk 'BEGIN { + > ORS = "\nOUCH!\n"; OFS = "+" + > msg = "Dont Panic!" + > printf "%s\n", msg + > }' + -| Dont Panic! + +Here, neither the `+' nor the `OUCH' appear when the message is printed. + + +File: gawk.info, Node: Control Letters, Next: Format Modifiers, Prev: Basic Printf, Up: Printf + +4.5.2 Format-Control Letters +---------------------------- + +A format specifier starts with the character `%' and ends with a +"format-control letter"--it tells the `printf' statement how to output +one item. The format-control letter specifies what _kind_ of value to +print. The rest of the format specifier is made up of optional +"modifiers" that control _how_ to print the value, such as the field +width. Here is a list of the format-control letters: + +`%c' + This prints a number as an ASCII character; thus, `printf "%c", + 65' outputs the letter `A'. (The output for a string value is the + first character of the string.) + +`%d, %i' + These are equivalent; they both print a decimal integer. (The + `%i' specification is for compatibility with ISO C.) + +`%e, %E' + These print a number in scientific (exponential) notation; for + example: + + printf "%4.3e\n", 1950 + + prints `1.950e+03', with a total of four significant figures, + three of which follow the decimal point. (The `4.3' represents + two modifiers, discussed in the next node.) `%E' uses `E' instead + of `e' in the output. + +`%f' + This prints a number in floating-point notation. For example: + + printf "%4.3f", 1950 + + prints `1950.000', with a total of four significant figures, three + of which follow the decimal point. (The `4.3' represents two + modifiers, discussed in the next node.) + + On systems supporting IEEE 754 floating point format, values + representing negative infinity are formatted as `-inf' or + `-infinity', and positive infinity as `inf' and `infinity'. The + special "not a number" value formats as `-nan' or `nan'. + +`%F' + Like `%f' but the infinity and "not a number" values are spelled + using uppercase letters. + + The `%F' format is a POSIX extension to ISO C; not all systems + support it. On those that don't, `gawk' uses `%f' instead. + +`%g, %G' + These print a number in either scientific notation or in + floating-point notation, whichever uses fewer characters; if the + result is printed in scientific notation, `%G' uses `E' instead of + `e'. + +`%o' + This prints an unsigned octal integer. + +`%s' + This prints a string. + +`%u' + This prints an unsigned decimal integer. (This format is of + marginal use, because all numbers in `awk' are floating-point; it + is provided primarily for compatibility with C.) + +`%x, %X' + These print an unsigned hexadecimal integer; `%X' uses the letters + `A' through `F' instead of `a' through `f'. + +`%%' + This isn't a format-control letter, but it does have meaning--the + sequence `%%' outputs one `%'; it does not consume an argument and + it ignores any modifiers. + + NOTE: When using the integer format-control letters for values + that are outside the range of the widest C integer type, `gawk' + switches to the `%g' format specifier. If `--lint' is provided on + the command line (*note Options::), `gawk' warns about this. + Other versions of `awk' may print invalid values or do something + else entirely. (d.c.) + + +File: gawk.info, Node: Format Modifiers, Next: Printf Examples, Prev: Control Letters, Up: Printf + +4.5.3 Modifiers for `printf' Formats +------------------------------------ + +A format specification can also include "modifiers" that can control +how much of the item's value is printed, as well as how much space it +gets. The modifiers come between the `%' and the format-control letter. +We will use the bullet symbol "*" in the following examples to represent +spaces in the output. Here are the possible modifiers, in the order in +which they may appear: + +`N$' + An integer constant followed by a `$' is a "positional specifier". + Normally, format specifications are applied to arguments in the + order given in the format string. With a positional specifier, + the format specification is applied to a specific argument, + instead of what would be the next argument in the list. + Positional specifiers begin counting with one. Thus: + + printf "%s %s\n", "don't", "panic" + printf "%2$s %1$s\n", "panic", "don't" + + prints the famous friendly message twice. + + At first glance, this feature doesn't seem to be of much use. It + is in fact a `gawk' extension, intended for use in translating + messages at runtime. *Note Printf Ordering::, which describes how + and why to use positional specifiers. For now, we will not use + them. + +`-' + The minus sign, used before the width modifier (see later on in + this table), says to left-justify the argument within its + specified width. Normally, the argument is printed + right-justified in the specified width. Thus: + + printf "%-4s", "foo" + + prints `foo*'. + +`SPACE' + For numeric conversions, prefix positive values with a space and + negative values with a minus sign. + +`+' + The plus sign, used before the width modifier (see later on in + this table), says to always supply a sign for numeric conversions, + even if the data to format is positive. The `+' overrides the + space modifier. + +`#' + Use an "alternate form" for certain control letters. For `%o', + supply a leading zero. For `%x' and `%X', supply a leading `0x' + or `0X' for a nonzero result. For `%e', `%E', and `%f', the + result always contains a decimal point. For `%g' and `%G', + trailing zeros are not removed from the result. + +`0' + A leading `0' (zero) acts as a flag that indicates that output + should be padded with zeros instead of spaces. This applies even + to non-numeric output formats. (d.c.) This flag only has an + effect when the field width is wider than the value to print. + +`'' + A single quote or apostrophe character is a POSIX extension to ISO + C. It indicates that the integer part of a floating point value, + or the entire part of an integer decimal value, should have a + thousands-separator character in it. This only works in locales + that support such characters. For example: + + $ cat thousands.awk Show source program + -| BEGIN { printf "%'d\n", 1234567 } + $ LC_ALL=C gawk -f thousands.awk + -| 1234567 Results in "C" locale + $ LC_ALL=en_US.UTF-8 gawk -f thousands.awk + -| 1,234,567 Results in US English UTF locale + + For more information about locales and internationalization issues, + see *note Locales::. + + NOTE: The `'' flag is a nice feature, but its use complicates + things: it becomes difficult to use it in command-line + programs. For information on appropriate quoting tricks, see + *note Quoting::. + +`WIDTH' + This is a number specifying the desired minimum width of a field. + Inserting any number between the `%' sign and the format-control + character forces the field to expand to this width. The default + way to do this is to pad with spaces on the left. For example: + + printf "%4s", "foo" + + prints `*foo'. + + The value of WIDTH is a minimum width, not a maximum. If the item + value requires more than WIDTH characters, it can be as wide as + necessary. Thus, the following: + + printf "%4s", "foobar" + + prints `foobar'. + + Preceding the WIDTH with a minus sign causes the output to be + padded with spaces on the right, instead of on the left. + +`.PREC' + A period followed by an integer constant specifies the precision + to use when printing. The meaning of the precision varies by + control letter: + + `%e', `%E', `%f' + Number of digits to the right of the decimal point. + + `%g', `%G' + Maximum number of significant digits. + + `%d', `%i', `%o', `%u', `%x', `%X' + Minimum number of digits to print. + + `%s' + Maximum number of characters from the string that should + print. + + Thus, the following: + + printf "%.4s", "foobar" + + prints `foob'. + + The C library `printf''s dynamic WIDTH and PREC capability (for +example, `"%*.*s"') is supported. Instead of supplying explicit WIDTH +and/or PREC values in the format string, they are passed in the +argument list. For example: + + w = 5 + p = 3 + s = "abcdefg" + printf "%*.*s\n", w, p, s + +is exactly equivalent to: + + s = "abcdefg" + printf "%5.3s\n", s + +Both programs output `**abc'. Earlier versions of `awk' did not +support this capability. If you must use such a version, you may +simulate this feature by using concatenation to build up the format +string, like so: + + w = 5 + p = 3 + s = "abcdefg" + printf "%" w "." p "s\n", s + +This is not particularly easy to read but it does work. + + C programmers may be used to supplying additional `l', `L', and `h' +modifiers in `printf' format strings. These are not valid in `awk'. +Most `awk' implementations silently ignore these modifiers. If +`--lint' is provided on the command line (*note Options::), `gawk' +warns about their use. If `--posix' is supplied, their use is a fatal +error. + + +File: gawk.info, Node: Printf Examples, Prev: Format Modifiers, Up: Printf + +4.5.4 Examples Using `printf' +----------------------------- + +The following is a simple example of how to use `printf' to make an +aligned table: + + awk '{ printf "%-10s %s\n", $1, $2 }' BBS-list + +This command prints the names of the bulletin boards (`$1') in the file +`BBS-list' as a string of 10 characters that are left-justified. It +also prints the phone numbers (`$2') next on the line. This produces +an aligned two-column table of names and phone numbers, as shown here: + + $ awk '{ printf "%-10s %s\n", $1, $2 }' BBS-list + -| aardvark 555-5553 + -| alpo-net 555-3412 + -| barfly 555-7685 + -| bites 555-1675 + -| camelot 555-0542 + -| core 555-2912 + -| fooey 555-1234 + -| foot 555-6699 + -| macfoo 555-6480 + -| sdace 555-3430 + -| sabafoo 555-2127 + + In this case, the phone numbers had to be printed as strings because +the numbers are separated by a dash. Printing the phone numbers as +numbers would have produced just the first three digits: `555'. This +would have been pretty confusing. + + It wasn't necessary to specify a width for the phone numbers because +they are last on their lines. They don't need to have spaces after +them. + + The table could be made to look even nicer by adding headings to the +tops of the columns. This is done using the `BEGIN' pattern (*note +BEGIN/END::) so that the headers are only printed once, at the +beginning of the `awk' program: + + awk 'BEGIN { print "Name Number" + print "---- ------" } + { printf "%-10s %s\n", $1, $2 }' BBS-list + + The above example mixed `print' and `printf' statements in the same +program. Using just `printf' statements can produce the same results: + + awk 'BEGIN { printf "%-10s %s\n", "Name", "Number" + printf "%-10s %s\n", "----", "------" } + { printf "%-10s %s\n", $1, $2 }' BBS-list + +Printing each column heading with the same format specification used +for the column elements ensures that the headings are aligned just like +the columns. + + The fact that the same format specification is used three times can +be emphasized by storing it in a variable, like this: + + awk 'BEGIN { format = "%-10s %s\n" + printf format, "Name", "Number" + printf format, "----", "------" } + { printf format, $1, $2 }' BBS-list + + At this point, it would be a worthwhile exercise to use the `printf' +statement to line up the headings and table data for the +`inventory-shipped' example that was covered earlier in the minor node +on the `print' statement (*note Print::). + + +File: gawk.info, Node: Redirection, Next: Special Files, Prev: Printf, Up: Printing + +4.6 Redirecting Output of `print' and `printf' +============================================== + +So far, the output from `print' and `printf' has gone to the standard +output, usually the terminal. Both `print' and `printf' can also send +their output to other places. This is called "redirection". + + A redirection appears after the `print' or `printf' statement. +Redirections in `awk' are written just like redirections in shell +commands, except that they are written inside the `awk' program. + + There are four forms of output redirection: output to a file, output +appended to a file, output through a pipe to another command, and output +to a coprocess. They are all shown for the `print' statement, but they +work identically for `printf': + +`print ITEMS > OUTPUT-FILE' + This type of redirection prints the items into the output file + named OUTPUT-FILE. The file name OUTPUT-FILE can be any + expression. Its value is changed to a string and then used as a + file name (*note Expressions::). + + When this type of redirection is used, the OUTPUT-FILE is erased + before the first output is written to it. Subsequent writes to + the same OUTPUT-FILE do not erase OUTPUT-FILE, but append to it. + (This is different from how you use redirections in shell scripts.) + If OUTPUT-FILE does not exist, it is created. For example, here + is how an `awk' program can write a list of BBS names to one file + named `name-list', and a list of phone numbers to another file + named `phone-list': + + $ awk '{ print $2 > "phone-list" + > print $1 > "name-list" }' BBS-list + $ cat phone-list + -| 555-5553 + -| 555-3412 + ... + $ cat name-list + -| aardvark + -| alpo-net + ... + + Each output file contains one name or number per line. + +`print ITEMS >> OUTPUT-FILE' + This type of redirection prints the items into the pre-existing + output file named OUTPUT-FILE. The difference between this and the + single-`>' redirection is that the old contents (if any) of + OUTPUT-FILE are not erased. Instead, the `awk' output is appended + to the file. If OUTPUT-FILE does not exist, then it is created. + +`print ITEMS | COMMAND' + It is also possible to send output to another program through a + pipe instead of into a file. This type of redirection opens a + pipe to COMMAND, and writes the values of ITEMS through this pipe + to another process created to execute COMMAND. + + The redirection argument COMMAND is actually an `awk' expression. + Its value is converted to a string whose contents give the shell + command to be run. For example, the following produces two files, + one unsorted list of BBS names, and one list sorted in reverse + alphabetical order: + + awk '{ print $1 > "names.unsorted" + command = "sort -r > names.sorted" + print $1 | command }' BBS-list + + The unsorted list is written with an ordinary redirection, while + the sorted list is written by piping through the `sort' utility. + + The next example uses redirection to mail a message to the mailing + list `bug-system'. This might be useful when trouble is + encountered in an `awk' script run periodically for system + maintenance: + + report = "mail bug-system" + print "Awk script failed:", $0 | report + m = ("at record number " FNR " of " FILENAME) + print m | report + close(report) + + The message is built using string concatenation and saved in the + variable `m'. It's then sent down the pipeline to the `mail' + program. (The parentheses group the items to concatenate--see + *note Concatenation::.) + + The `close' function is called here because it's a good idea to + close the pipe as soon as all the intended output has been sent to + it. *Note Close Files And Pipes::, for more information. + + This example also illustrates the use of a variable to represent a + FILE or COMMAND--it is not necessary to always use a string + constant. Using a variable is generally a good idea, because (if + you mean to refer to that same file or command) `awk' requires + that the string value be spelled identically every time. + +`print ITEMS |& COMMAND' + This type of redirection prints the items to the input of COMMAND. + The difference between this and the single-`|' redirection is that + the output from COMMAND can be read with `getline'. Thus COMMAND + is a "coprocess", which works together with, but subsidiary to, + the `awk' program. + + This feature is a `gawk' extension, and is not available in POSIX + `awk'. *Note Getline/Coprocess::, for a brief discussion. *Note + Two-way I/O::, for a more complete discussion. + + Redirecting output using `>', `>>', `|', or `|&' asks the system to +open a file, pipe, or coprocess only if the particular FILE or COMMAND +you specify has not already been written to by your program or if it +has been closed since it was last written to. + + It is a common error to use `>' redirection for the first `print' to +a file, and then to use `>>' for subsequent output: + + # clear the file + print "Don't panic" > "guide.txt" + ... + # append + print "Avoid improbability generators" >> "guide.txt" + +This is indeed how redirections must be used from the shell. But in +`awk', it isn't necessary. In this kind of case, a program should use +`>' for all the `print' statements, since the output file is only +opened once. (It happens that if you mix `>' and `>>' that output is +produced in the expected order. However, mixing the operators for the +same file is definitely poor style, and is confusing to readers of your +program.) + + Many `awk' implementations limit the number of pipelines that an +`awk' program may have open to just one! In `gawk', there is no such +limit. `gawk' allows a program to open as many pipelines as the +underlying operating system permits. + +Advanced Notes: Piping into `sh' +-------------------------------- + +A particularly powerful way to use redirection is to build command lines +and pipe them into the shell, `sh'. For example, suppose you have a +list of files brought over from a system where all the file names are +stored in uppercase, and you wish to rename them to have names in all +lowercase. The following program is both simple and efficient: + + { printf("mv %s %s\n", $0, tolower($0)) | "sh" } + + END { close("sh") } + + The `tolower' function returns its argument string with all +uppercase characters converted to lowercase (*note String Functions::). +The program builds up a list of command lines, using the `mv' utility +to rename the files. It then sends the list to the shell for execution. + + +File: gawk.info, Node: Special Files, Next: Close Files And Pipes, Prev: Redirection, Up: Printing + +4.7 Special File Names in `gawk' +================================ + +`gawk' provides a number of special file names that it interprets +internally. These file names provide access to standard file +descriptors, process-related information, and TCP/IP networking. + +* Menu: + +* Special FD:: Special files for I/O. +* Special Process:: Special files for process information. +* Special Network:: Special files for network communications. +* Special Caveats:: Things to watch out for. + + +File: gawk.info, Node: Special FD, Next: Special Process, Up: Special Files + +4.7.1 Special Files for Standard Descriptors +-------------------------------------------- + +Running programs conventionally have three input and output streams +already available to them for reading and writing. These are known as +the "standard input", "standard output", and "standard error output". +These streams are, by default, connected to your terminal, but they are +often redirected with the shell, via the `<', `<<', `>', `>>', `>&', +and `|' operators. Standard error is typically used for writing error +messages; the reason there are two separate streams, standard output +and standard error, is so that they can be redirected separately. + + In other implementations of `awk', the only way to write an error +message to standard error in an `awk' program is as follows: + + print "Serious error detected!" | "cat 1>&2" + +This works by opening a pipeline to a shell command that can access the +standard error stream that it inherits from the `awk' process. This is +far from elegant, and it is also inefficient, because it requires a +separate process. So people writing `awk' programs often don't do +this. Instead, they send the error messages to the terminal, like this: + + print "Serious error detected!" > "/dev/tty" + +This usually has the same effect but not always: although the standard +error stream is usually the terminal, it can be redirected; when that +happens, writing to the terminal is not correct. In fact, if `awk' is +run from a background job, it may not have a terminal at all. Then +opening `/dev/tty' fails. + + `gawk' provides special file names for accessing the three standard +streams, as well as any other inherited open files. If the file name +matches one of these special names when `gawk' redirects input or +output, then it directly uses the stream that the file name stands for. +These special file names work for all operating systems that `gawk' has +been ported to, not just those that are POSIX-compliant: + +`/dev/stdin' + The standard input (file descriptor 0). + +`/dev/stdout' + The standard output (file descriptor 1). + +`/dev/stderr' + The standard error output (file descriptor 2). + +`/dev/fd/N' + The file associated with file descriptor N. Such a file must be + opened by the program initiating the `awk' execution (typically + the shell). Unless special pains are taken in the shell from which + `gawk' is invoked, only descriptors 0, 1, and 2 are available. + + The file names `/dev/stdin', `/dev/stdout', and `/dev/stderr' are +aliases for `/dev/fd/0', `/dev/fd/1', and `/dev/fd/2', respectively. +However, they are more self-explanatory. The proper way to write an +error message in a `gawk' program is to use `/dev/stderr', like this: + + print "Serious error detected!" > "/dev/stderr" + + Note the use of quotes around the file name. Like any other +redirection, the value must be a string. It is a common error to omit +the quotes, which leads to confusing results. + + +File: gawk.info, Node: Special Process, Next: Special Network, Prev: Special FD, Up: Special Files + +4.7.2 Special Files for Process-Related Information +--------------------------------------------------- + +`gawk' also provides special file names that give access to information +about the running `gawk' process. Each of these "files" provides a +single record of information. To read them more than once, they must +first be closed with the `close' function (*note Close Files And +Pipes::). The file names are: + +`/dev/pid' + Reading this file returns the process ID of the current process, + in decimal form, terminated with a newline. + +`/dev/ppid' + Reading this file returns the parent process ID of the current + process, in decimal form, terminated with a newline. + +`/dev/pgrpid' + Reading this file returns the process group ID of the current + process, in decimal form, terminated with a newline. + +`/dev/user' + Reading this file returns a single record terminated with a + newline. The fields are separated with spaces. The fields + represent the following information: + + `$1' + The return value of the `getuid' system call (the real user + ID number). + + `$2' + The return value of the `geteuid' system call (the effective + user ID number). + + `$3' + The return value of the `getgid' system call (the real group + ID number). + + `$4' + The return value of the `getegid' system call (the effective + group ID number). + + If there are any additional fields, they are the group IDs + returned by the `getgroups' system call. (Multiple groups may not + be supported on all systems.) + + These special file names may be used on the command line as data +files, as well as for I/O redirections within an `awk' program. They +may not be used as source files with the `-f' option. + + NOTE: The special files that provide process-related information + are now considered obsolete and will disappear entirely in the + next release of `gawk'. `gawk' prints a warning message every + time you use one of these files. To obtain process-related + information, use the `PROCINFO' array. *Note Auto-set::. + + +File: gawk.info, Node: Special Network, Next: Special Caveats, Prev: Special Process, Up: Special Files + +4.7.3 Special Files for Network Communications +---------------------------------------------- + +Starting with version 3.1 of `gawk', `awk' programs can open a two-way +TCP/IP connection, acting as either a client or a server. This is done +using a special file name of the form: + + `/inet/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT' + + The PROTOCOL is one of `tcp', `udp', or `raw', and the other fields +represent the other essential pieces of information for making a +networking connection. These file names are used with the `|&' +operator for communicating with a coprocess (*note Two-way I/O::). +This is an advanced feature, mentioned here only for completeness. +Full discussion is delayed until *note TCP/IP Networking::. + + +File: gawk.info, Node: Special Caveats, Prev: Special Network, Up: Special Files + +4.7.4 Special File Name Caveats +------------------------------- + +Here is a list of things to bear in mind when using the special file +names that `gawk' provides: + + * Recognition of these special file names is disabled if `gawk' is in + compatibility mode (*note Options::). + + * The special files that provide process-related information are now + considered obsolete and will disappear entirely in the next + release of `gawk'. `gawk' prints a warning message every time you + use one of these files. To obtain process-related information, + use the `PROCINFO' array. *Note Built-in Variables::. + + * Starting with version 3.1, `gawk' _always_ interprets these + special file names.(1) For example, using `/dev/fd/4' for output + actually writes on file descriptor 4, and not on a new file + descriptor that is `dup''ed from file descriptor 4. Most of the + time this does not matter; however, it is important to _not_ close + any of the files related to file descriptors 0, 1, and 2. Doing + so results in unpredictable behavior. + + ---------- Footnotes ---------- + + (1) Older versions of `gawk' would interpret these names internally +only if the system did not actually have a `/dev/fd' directory or any +of the other special files listed earlier. Usually this didn't make a +difference, but sometimes it did; thus, it was decided to make `gawk''s +behavior consistent on all systems and to have it always interpret the +special file names itself. + + +File: gawk.info, Node: Close Files And Pipes, Prev: Special Files, Up: Printing + +4.8 Closing Input and Output Redirections +========================================= + +If the same file name or the same shell command is used with `getline' +more than once during the execution of an `awk' program (*note +Getline::), the file is opened (or the command is executed) the first +time only. At that time, the first record of input is read from that +file or command. The next time the same file or command is used with +`getline', another record is read from it, and so on. + + Similarly, when a file or pipe is opened for output, the file name or +command associated with it is remembered by `awk', and subsequent +writes to the same file or command are appended to the previous writes. +The file or pipe stays open until `awk' exits. + + This implies that special steps are necessary in order to read the +same file again from the beginning, or to rerun a shell command (rather +than reading more output from the same command). The `close' function +makes these things possible: + + close(FILENAME) + +or: + + close(COMMAND) + + The argument FILENAME or COMMAND can be any expression. Its value +must _exactly_ match the string that was used to open the file or start +the command (spaces and other "irrelevant" characters included). For +example, if you open a pipe with this: + + "sort -r names" | getline foo + +then you must close it with this: + + close("sort -r names") + + Once this function call is executed, the next `getline' from that +file or command, or the next `print' or `printf' to that file or +command, reopens the file or reruns the command. Because the +expression that you use to close a file or pipeline must exactly match +the expression used to open the file or run the command, it is good +practice to use a variable to store the file name or command. The +previous example becomes the following: + + sortcom = "sort -r names" + sortcom | getline foo + ... + close(sortcom) + +This helps avoid hard-to-find typographical errors in your `awk' +programs. Here are some of the reasons for closing an output file: + + * To write a file and read it back later on in the same `awk' + program. Close the file after writing it, then begin reading it + with `getline'. + + * To write numerous files, successively, in the same `awk' program. + If the files aren't closed, eventually `awk' may exceed a system + limit on the number of open files in one process. It is best to + close each one when the program has finished writing it. + + * To make a command finish. When output is redirected through a + pipe, the command reading the pipe normally continues to try to + read input as long as the pipe is open. Often this means the + command cannot really do its work until the pipe is closed. For + example, if output is redirected to the `mail' program, the + message is not actually sent until the pipe is closed. + + * To run the same program a second time, with the same arguments. + This is not the same thing as giving more input to the first run! + + For example, suppose a program pipes output to the `mail' program. + If it outputs several lines redirected to this pipe without closing + it, they make a single message of several lines. By contrast, if + the program closes the pipe after each line of output, then each + line makes a separate message. + + If you use more files than the system allows you to have open, +`gawk' attempts to multiplex the available open files among your data +files. `gawk''s ability to do this depends upon the facilities of your +operating system, so it may not always work. It is therefore both good +practice and good portability advice to always use `close' on your +files when you are done with them. In fact, if you are using a lot of +pipes, it is essential that you close commands when done. For example, +consider something like this: + + { + ... + command = ("grep " $1 " /some/file | my_prog -q " $3) + while ((command | getline) > 0) { + PROCESS OUTPUT OF command + } + # need close(command) here + } + + This example creates a new pipeline based on data in _each_ record. +Without the call to `close' indicated in the comment, `awk' creates +child processes to run the commands, until it eventually runs out of +file descriptors for more pipelines. + + Even though each command has finished (as indicated by the +end-of-file return status from `getline'), the child process is not +terminated;(1) more importantly, the file descriptor for the pipe is +not closed and released until `close' is called or `awk' exits. + + `close' will silently do nothing if given an argument that does not +represent a file, pipe or coprocess that was opened with a redirection. + + Note also that `close(FILENAME)' has no "magic" effects on the +implicit loop that reads through the files named on the command line. +It is, more likely, a close of a file that was never opened, so `awk' +silently does nothing. + + When using the `|&' operator to communicate with a coprocess, it is +occasionally useful to be able to close one end of the two-way pipe +without closing the other. This is done by supplying a second argument +to `close'. As in any other call to `close', the first argument is the +name of the command or special file used to start the coprocess. The +second argument should be a string, with either of the values `"to"' or +`"from"'. Case does not matter. As this is an advanced feature, a +more complete discussion is delayed until *note Two-way I/O::, which +discusses it in more detail and gives an example. + +Advanced Notes: Using `close''s Return Value +-------------------------------------------- + +In many versions of Unix `awk', the `close' function is actually a +statement. It is a syntax error to try and use the return value from +`close': (d.c.) + + command = "..." + command | getline info + retval = close(command) # syntax error in most Unix awks + + `gawk' treats `close' as a function. The return value is -1 if the +argument names something that was never opened with a redirection, or +if there is a system problem closing the file or process. In these +cases, `gawk' sets the built-in variable `ERRNO' to a string describing +the problem. + + In `gawk', when closing a pipe or coprocess (input or output), the +return value is the exit status of the command.(2) Otherwise, it is the +return value from the system's `close' or `fclose' C functions when +closing input or output files, respectively. This value is zero if the +close succeeds, or -1 if it fails. + + The POSIX standard is very vague; it says that `close' returns zero +on success and non-zero otherwise. In general, different +implementations vary in what they report when closing pipes; thus the +return value cannot be used portably. (d.c.) + + ---------- Footnotes ---------- + + (1) The technical terminology is rather morbid. The finished child +is called a "zombie," and cleaning up after it is referred to as +"reaping." + + (2) This is a full 16-bit value as returned by the `wait' system +call. See the system manual pages for information on how to decode this +value. + + +File: gawk.info, Node: Expressions, Next: Patterns and Actions, Prev: Printing, Up: Top + +5 Expressions +************* + +Expressions are the basic building blocks of `awk' patterns and +actions. An expression evaluates to a value that you can print, test, +or pass to a function. Additionally, an expression can assign a new +value to a variable or a field by using an assignment operator. + + An expression can serve as a pattern or action statement on its own. +Most other kinds of statements contain one or more expressions that +specify the data on which to operate. As in other languages, +expressions in `awk' include variables, array references, constants, +and function calls, as well as combinations of these with various +operators. + +* Menu: + +* Constants:: String, numeric and regexp constants. +* Using Constant Regexps:: When and how to use a regexp constant. +* Variables:: Variables give names to values for later use. +* Conversion:: The conversion of strings to numbers and vice + versa. +* Arithmetic Ops:: Arithmetic operations (`+', `-', + etc.) +* Concatenation:: Concatenating strings. +* Assignment Ops:: Changing the value of a variable or a field. +* Increment Ops:: Incrementing the numeric value of a variable. +* Truth Values:: What is ``true'' and what is ``false''. +* Typing and Comparison:: How variables acquire types and how this + affects comparison of numbers and strings with + `<', etc. +* Boolean Ops:: Combining comparison expressions using boolean + operators `||' (``or''), `&&' + (``and'') and `!' (``not''). +* Conditional Exp:: Conditional expressions select between two + subexpressions under control of a third + subexpression. +* Function Calls:: A function call is an expression. +* Precedence:: How various operators nest. + + +File: gawk.info, Node: Constants, Next: Using Constant Regexps, Up: Expressions + +5.1 Constant Expressions +======================== + +The simplest type of expression is the "constant", which always has the +same value. There are three types of constants: numeric, string, and +regular expression. + + Each is used in the appropriate context when you need a data value +that isn't going to change. Numeric constants can have different +forms, but are stored identically internally. + +* Menu: + +* Scalar Constants:: Numeric and string constants. +* Nondecimal-numbers:: What are octal and hex numbers. +* Regexp Constants:: Regular Expression constants. + + +File: gawk.info, Node: Scalar Constants, Next: Nondecimal-numbers, Up: Constants + +5.1.1 Numeric and String Constants +---------------------------------- + +A "numeric constant" stands for a number. This number can be an +integer, a decimal fraction, or a number in scientific (exponential) +notation.(1) Here are some examples of numeric constants that all have +the same value: + + 105 + 1.05e+2 + 1050e-1 + + A string constant consists of a sequence of characters enclosed in +double-quotation marks. For example: + + "parrot" + +represents the string whose contents are `parrot'. Strings in `gawk' +can be of any length, and they can contain any of the possible +eight-bit ASCII characters including ASCII NUL (character code zero). +Other `awk' implementations may have difficulty with some character +codes. + + ---------- Footnotes ---------- + + (1) The internal representation of all numbers, including integers, +uses double-precision floating-point numbers. On most modern systems, +these are in IEEE 754 standard format. + + +File: gawk.info, Node: Nondecimal-numbers, Next: Regexp Constants, Prev: Scalar Constants, Up: Constants + +5.1.2 Octal and Hexadecimal Numbers +----------------------------------- + +In `awk', all numbers are in decimal; i.e., base 10. Many other +programming languages allow you to specify numbers in other bases, often +octal (base 8) and hexadecimal (base 16). In octal, the numbers go 0, +1, 2, 3, 4, 5, 6, 7, 10, 11, 12, etc. Just as `11', in decimal, is 1 +times 10 plus 1, so `11', in octal, is 1 times 8, plus 1. This equals 9 +in decimal. In hexadecimal, there are 16 digits. Since the everyday +decimal number system only has ten digits (`0'-`9'), the letters `a' +through `f' are used to represent the rest. (Case in the letters is +usually irrelevant; hexadecimal `a' and `A' have the same value.) +Thus, `11', in hexadecimal, is 1 times 16 plus 1, which equals 17 in +decimal. + + Just by looking at plain `11', you can't tell what base it's in. +So, in C, C++, and other languages derived from C, there is a special +notation to help signify the base. Octal numbers start with a leading +`0', and hexadecimal numbers start with a leading `0x' or `0X': + +`11' + Decimal value 11. + +`011' + Octal 11, decimal value 9. + +`0x11' + Hexadecimal 11, decimal value 17. + + This example shows the difference: + + $ gawk 'BEGIN { printf "%d, %d, %d\n", 011, 11, 0x11 }' + -| 9, 11, 17 + + Being able to use octal and hexadecimal constants in your programs +is most useful when working with data that cannot be represented +conveniently as characters or as regular numbers, such as binary data +of various sorts. + + `gawk' allows the use of octal and hexadecimal constants in your +program text. However, such numbers in the input data are not treated +differently; doing so by default would break old programs. (If you +really need to do this, use the `--non-decimal-data' command-line +option; *note Nondecimal Data::.) If you have octal or hexadecimal +data, you can use the `strtonum' function (*note String Functions::) to +convert the data into a number. Most of the time, you will want to use +octal or hexadecimal constants when working with the built-in bit +manipulation functions; see *note Bitwise Functions::, for more +information. + + Unlike some early C implementations, `8' and `9' are not valid in +octal constants; e.g., `gawk' treats `018' as decimal 18: + + $ gawk 'BEGIN { print "021 is", 021 ; print 018 }' + -| 021 is 17 + -| 18 + + Octal and hexadecimal source code constants are a `gawk' extension. +If `gawk' is in compatibility mode (*note Options::), they are not +available. + +Advanced Notes: A Constant's Base Does Not Affect Its Value +----------------------------------------------------------- + +Once a numeric constant has been converted internally into a number, +`gawk' no longer remembers what the original form of the constant was; +the internal value is always used. This has particular consequences +for conversion of numbers to strings: + + $ gawk 'BEGIN { printf "0x11 is <%s>\n", 0x11 }' + -| 0x11 is <17> + + +File: gawk.info, Node: Regexp Constants, Prev: Nondecimal-numbers, Up: Constants + +5.1.3 Regular Expression Constants +---------------------------------- + +A regexp constant is a regular expression description enclosed in +slashes, such as `/^beginning and end$/'. Most regexps used in `awk' +programs are constant, but the `~' and `!~' matching operators can also +match computed or "dynamic" regexps (which are just ordinary strings or +variables that contain a regexp). + + +File: gawk.info, Node: Using Constant Regexps, Next: Variables, Prev: Constants, Up: Expressions + +5.2 Using Regular Expression Constants +====================================== + +When used on the righthand side of the `~' or `!~' operators, a regexp +constant merely stands for the regexp that is to be matched. However, +regexp constants (such as `/foo/') may be used like simple expressions. +When a regexp constant appears by itself, it has the same meaning as if +it appeared in a pattern, i.e., `($0 ~ /foo/)' (d.c.) *Note Expression +Patterns::. This means that the following two code segments: + + if ($0 ~ /barfly/ || $0 ~ /camelot/) + print "found" + +and: + + if (/barfly/ || /camelot/) + print "found" + +are exactly equivalent. One rather bizarre consequence of this rule is +that the following Boolean expression is valid, but does not do what +the user probably intended: + + # note that /foo/ is on the left of the ~ + if (/foo/ ~ $1) print "found foo" + +This code is "obviously" testing `$1' for a match against the regexp +`/foo/'. But in fact, the expression `/foo/ ~ $1' actually means `($0 +~ /foo/) ~ $1'. In other words, first match the input record against +the regexp `/foo/'. The result is either zero or one, depending upon +the success or failure of the match. That result is then matched +against the first field in the record. Because it is unlikely that you +would ever really want to make this kind of test, `gawk' issues a +warning when it sees this construct in a program. Another consequence +of this rule is that the assignment statement: + + matches = /foo/ + +assigns either zero or one to the variable `matches', depending upon +the contents of the current input record. This feature of the language +has never been well documented until the POSIX specification. + + Constant regular expressions are also used as the first argument for +the `gensub', `sub', and `gsub' functions, and as the second argument +of the `match' function (*note String Functions::). Modern +implementations of `awk', including `gawk', allow the third argument of +`split' to be a regexp constant, but some older implementations do not. +(d.c.) This can lead to confusion when attempting to use regexp +constants as arguments to user-defined functions (*note User-defined::). +For example: + + function mysub(pat, repl, str, global) + { + if (global) + gsub(pat, repl, str) + else + sub(pat, repl, str) + return str + } + + { + ... + text = "hi! hi yourself!" + mysub(/hi/, "howdy", text, 1) + ... + } + + In this example, the programmer wants to pass a regexp constant to +the user-defined function `mysub', which in turn passes it on to either +`sub' or `gsub'. However, what really happens is that the `pat' +parameter is either one or zero, depending upon whether or not `$0' +matches `/hi/'. `gawk' issues a warning when it sees a regexp constant +used as a parameter to a user-defined function, since passing a truth +value in this way is probably not what was intended. + + +File: gawk.info, Node: Variables, Next: Conversion, Prev: Using Constant Regexps, Up: Expressions + +5.3 Variables +============= + +Variables are ways of storing values at one point in your program for +use later in another part of your program. They can be manipulated +entirely within the program text, and they can also be assigned values +on the `awk' command line. + +* Menu: + +* Using Variables:: Using variables in your programs. +* Assignment Options:: Setting variables on the command-line and a + summary of command-line syntax. This is an + advanced method of input. + + +File: gawk.info, Node: Using Variables, Next: Assignment Options, Up: Variables + +5.3.1 Using Variables in a Program +---------------------------------- + +Variables let you give names to values and refer to them later. +Variables have already been used in many of the examples. The name of +a variable must be a sequence of letters, digits, or underscores, and +it may not begin with a digit. Case is significant in variable names; +`a' and `A' are distinct variables. + + A variable name is a valid expression by itself; it represents the +variable's current value. Variables are given new values with +"assignment operators", "increment operators", and "decrement +operators". *Note Assignment Ops::. + + A few variables have special built-in meanings, such as `FS' (the +field separator), and `NF' (the number of fields in the current input +record). *Note Built-in Variables::, for a list of the built-in +variables. These built-in variables can be used and assigned just like +all other variables, but their values are also used or changed +automatically by `awk'. All built-in variables' names are entirely +uppercase. + + Variables in `awk' can be assigned either numeric or string values. +The kind of value a variable holds can change over the life of a +program. By default, variables are initialized to the empty string, +which is zero if converted to a number. There is no need to +"initialize" each variable explicitly in `awk', which is what you would +do in C and in most other traditional languages. + + +File: gawk.info, Node: Assignment Options, Prev: Using Variables, Up: Variables + +5.3.2 Assigning Variables on the Command Line +--------------------------------------------- + +Any `awk' variable can be set by including a "variable assignment" +among the arguments on the command line when `awk' is invoked (*note +Other Arguments::). Such an assignment has the following form: + + VARIABLE=TEXT + +With it, a variable is set either at the beginning of the `awk' run or +in between input files. When the assignment is preceded with the `-v' +option, as in the following: + + -v VARIABLE=TEXT + +the variable is set at the very beginning, even before the `BEGIN' +rules are run. The `-v' option and its assignment must precede all the +file name arguments, as well as the program text. (*Note Options::, +for more information about the `-v' option.) Otherwise, the variable +assignment is performed at a time determined by its position among the +input file arguments--after the processing of the preceding input file +argument. For example: + + awk '{ print $n }' n=4 inventory-shipped n=2 BBS-list + +prints the value of field number `n' for all input records. Before the +first file is read, the command line sets the variable `n' equal to +four. This causes the fourth field to be printed in lines from the +file `inventory-shipped'. After the first file has finished, but +before the second file is started, `n' is set to two, so that the +second field is printed in lines from `BBS-list': + + $ awk '{ print $n }' n=4 inventory-shipped n=2 BBS-list + -| 15 + -| 24 + ... + -| 555-5553 + -| 555-3412 + ... + + Command-line arguments are made available for explicit examination by +the `awk' program in the `ARGV' array (*note ARGC and ARGV::). `awk' +processes the values of command-line assignments for escape sequences +(*note Escape Sequences::). (d.c.) + + +File: gawk.info, Node: Conversion, Next: Arithmetic Ops, Prev: Variables, Up: Expressions + +5.4 Conversion of Strings and Numbers +===================================== + +Strings are converted to numbers and numbers are converted to strings, +if the context of the `awk' program demands it. For example, if the +value of either `foo' or `bar' in the expression `foo + bar' happens to +be a string, it is converted to a number before the addition is +performed. If numeric values appear in string concatenation, they are +converted to strings. Consider the following: + + two = 2; three = 3 + print (two three) + 4 + +This prints the (numeric) value 27. The numeric values of the +variables `two' and `three' are converted to strings and concatenated +together. The resulting string is converted back to the number 23, to +which 4 is then added. + + If, for some reason, you need to force a number to be converted to a +string, concatenate the empty string, `""', with that number. To force +a string to be converted to a number, add zero to that string. A +string is converted to a number by interpreting any numeric prefix of +the string as numerals: `"2.5"' converts to 2.5, `"1e3"' converts to +1000, and `"25fix"' has a numeric value of 25. Strings that can't be +interpreted as valid numbers convert to zero. + + The exact manner in which numbers are converted into strings is +controlled by the `awk' built-in variable `CONVFMT' (*note Built-in +Variables::). Numbers are converted using the `sprintf' function with +`CONVFMT' as the format specifier (*note String Functions::). + + `CONVFMT''s default value is `"%.6g"', which prints a value with at +least six significant digits. For some applications, you might want to +change it to specify more precision. On most modern machines, 17 +digits is enough to capture a floating-point number's value exactly, +most of the time.(1) + + Strange results can occur if you set `CONVFMT' to a string that +doesn't tell `sprintf' how to format floating-point numbers in a useful +way. For example, if you forget the `%' in the format, `awk' converts +all numbers to the same constant string. As a special case, if a +number is an integer, then the result of converting it to a string is +_always_ an integer, no matter what the value of `CONVFMT' may be. +Given the following code fragment: + + CONVFMT = "%2.2f" + a = 12 + b = a "" + +`b' has the value `"12"', not `"12.00"'. (d.c.) + + Prior to the POSIX standard, `awk' used the value of `OFMT' for +converting numbers to strings. `OFMT' specifies the output format to +use when printing numbers with `print'. `CONVFMT' was introduced in +order to separate the semantics of conversion from the semantics of +printing. Both `CONVFMT' and `OFMT' have the same default value: +`"%.6g"'. In the vast majority of cases, old `awk' programs do not +change their behavior. However, these semantics for `OFMT' are +something to keep in mind if you must port your new style program to +older implementations of `awk'. We recommend that instead of changing +your programs, just port `gawk' itself. *Note Print::, for more +information on the `print' statement. + + And, once again, where you are can matter when it comes to converting +between numbers and strings. In *note Locales::, we mentioned that the +local character set and language (the locale) can affect how `gawk' +matches characters. The locale also affects numeric formats. In +particular, for `awk' programs, it affects the decimal point character. +The `"C"' locale, and most English-language locales, use the period +character (`.') as the decimal point. However, many (if not most) +European and non-English locales use the comma (`,') as the decimal +point character. + + The POSIX standard says that `awk' always uses the period as the +decimal point when reading the `awk' program source code, and for +command-line variable assignments (*note Other Arguments::). However, +when interpreting input data, for `print' and `printf' output, and for +number to string conversion, the local decimal point character is used. +Here are some examples indicating the difference in behavior, on a +GNU/Linux system: + + $ gawk 'BEGIN { printf "%g\n", 3.1415927 }' + -| 3.14159 + $ LC_ALL=en_DK gawk 'BEGIN { printf "%g\n", 3.1415927 }' + -| 3,14159 + $ echo 4,321 | gawk '{ print $1 + 1 }' + -| 5 + $ echo 4,321 | LC_ALL=en_DK gawk '{ print $1 + 1 }' + -| 5,321 + +The `en_DK' locale is for English in Denmark, where the comma acts as +the decimal point separator. In the normal `"C"' locale, `gawk' treats +`4,321' as `4', while in the Danish locale, it's treated as the full +number, `4.321'. + + For version 3.1.3 through 3.1.5, `gawk' fully complied with this +aspect of the standard. However, many users in non-English locales +complained about this behavior, since their data used a period as the +decimal point. Beginning in version 3.1.6, the default behavior was +restored to use a period as the decimal point character. You can use +the `--use-lc-numeric' option (*note Options::) to force `gawk' to use +the locale's decimal point character. (`gawk' also uses the locale's +decimal point character when in POSIX mode, either via `--posix', or +the `POSIXLY_CORRECT' environment variable.) + + The following table describes the cases in which the locale's decimal +point character is used and when a period is used. Some of these +features have not been described yet. + +Feature Default `--posix' or `--use-lc-numeric' +------------------------------------------------------------ +`%'g' Use locale Use locale +`%g' Use period Use locale +Input Use period Use locale +`strtonum' Use period Use locale + +Table 5.1: Locale Decimal Point versus A Period + + Finally, modern day formal standards and IEEE standard floating point +representation can have an unusual but important effect on the way +`gawk' converts some special string values to numbers. The details are +presented in *note POSIX Floating Point Problems::. + + ---------- Footnotes ---------- + + (1) Pathological cases can require up to 752 digits (!), but we +doubt that you need to worry about this. + + +File: gawk.info, Node: Arithmetic Ops, Next: Concatenation, Prev: Conversion, Up: Expressions + +5.5 Arithmetic Operators +======================== + +The `awk' language uses the common arithmetic operators when evaluating +expressions. All of these arithmetic operators follow normal +precedence rules and work as you would expect them to. + + The following example uses a file named `grades', which contains a +list of student names as well as three test scores per student (it's a +small class): + + Pat 100 97 58 + Sandy 84 72 93 + Chris 72 92 89 + +This programs takes the file `grades' and prints the average of the +scores: + + $ awk '{ sum = $2 + $3 + $4 ; avg = sum / 3 + > print $1, avg }' grades + -| Pat 85 + -| Sandy 83 + -| Chris 84.3333 + + The following list provides the arithmetic operators in `awk', in +order from the highest precedence to the lowest: + +`- X' + Negation. + +`+ X' + Unary plus; the expression is converted to a number. + +`X ^ Y' +`X ** Y' + Exponentiation; X raised to the Y power. `2 ^ 3' has the value + eight; the character sequence `**' is equivalent to `^'. + +`X * Y' + Multiplication. + +`X / Y' + Division; because all numbers in `awk' are floating-point + numbers, the result is _not_ rounded to an integer--`3 / 4' has + the value 0.75. (It is a common mistake, especially for C + programmers, to forget that _all_ numbers in `awk' are + floating-point, and that division of integer-looking constants + produces a real number, not an integer.) + +`X % Y' + Remainder; further discussion is provided in the text, just after + this list. + +`X + Y' + Addition. + +`X - Y' + Subtraction. + + Unary plus and minus have the same precedence, the multiplication +operators all have the same precedence, and addition and subtraction +have the same precedence. + + When computing the remainder of `X % Y', the quotient is rounded +toward zero to an integer and multiplied by Y. This result is +subtracted from X; this operation is sometimes known as "trunc-mod." +The following relation always holds: + + b * int(a / b) + (a % b) == a + + One possibly undesirable effect of this definition of remainder is +that `X % Y' is negative if X is negative. Thus: + + -17 % 8 = -1 + + In other `awk' implementations, the signedness of the remainder may +be machine-dependent. + + NOTE: The POSIX standard only specifies the use of `^' for + exponentiation. For maximum portability, do not use the `**' + operator. + + +File: gawk.info, Node: Concatenation, Next: Assignment Ops, Prev: Arithmetic Ops, Up: Expressions + +5.6 String Concatenation +======================== + + It seemed like a good idea at the time. + Brian Kernighan + + There is only one string operation: concatenation. It does not have +a specific operator to represent it. Instead, concatenation is +performed by writing expressions next to one another, with no operator. +For example: + + $ awk '{ print "Field number one: " $1 }' BBS-list + -| Field number one: aardvark + -| Field number one: alpo-net + ... + + Without the space in the string constant after the `:', the line +runs together. For example: + + $ awk '{ print "Field number one:" $1 }' BBS-list + -| Field number one:aardvark + -| Field number one:alpo-net + ... + + Because string concatenation does not have an explicit operator, it +is often necessary to insure that it happens at the right time by using +parentheses to enclose the items to concatenate. For example, you +might expect that the following code fragment concatenates `file' and +`name': + + file = "file" + name = "name" + print "something meaningful" > file name + +This produces a syntax error with Unix `awk'.(1) It is necessary to use +the following: + + print "something meaningful" > (file name) + + Parentheses should be used around concatenation in all but the most +common contexts, such as on the righthand side of `='. Be careful +about the kinds of expressions used in string concatenation. In +particular, the order of evaluation of expressions used for +concatenation is undefined in the `awk' language. Consider this +example: + + BEGIN { + a = "don't" + print (a " " (a = "panic")) + } + +It is not defined whether the assignment to `a' happens before or after +the value of `a' is retrieved for producing the concatenated value. +The result could be either `don't panic', or `panic panic'. The +precedence of concatenation, when mixed with other operators, is often +counter-intuitive. Consider this example: + + $ awk 'BEGIN { print -12 " " -24 }' + -| -12-24 + + This "obviously" is concatenating -12, a space, and -24. But where +did the space disappear to? The answer lies in the combination of +operator precedences and `awk''s automatic conversion rules. To get +the desired result, write the program in the following manner: + + $ awk 'BEGIN { print -12 " " (-24) }' + -| -12 -24 + + This forces `awk' to treat the `-' on the `-24' as unary. +Otherwise, it's parsed as follows: + + -12 (`" "' - 24) + => -12 (0 - 24) + => -12 (-24) + => -12-24 + + As mentioned earlier, when doing concatenation, _parenthesize_. +Otherwise, you're never quite sure what you'll get. + + ---------- Footnotes ---------- + + (1) It happens that `gawk' and `mawk' "get it right," but you should +not rely on this. + + +File: gawk.info, Node: Assignment Ops, Next: Increment Ops, Prev: Concatenation, Up: Expressions + +5.7 Assignment Expressions +========================== + +An "assignment" is an expression that stores a (usually different) +value into a variable. For example, let's assign the value one to the +variable `z': + + z = 1 + + After this expression is executed, the variable `z' has the value +one. Whatever old value `z' had before the assignment is forgotten. + + Assignments can also store string values. For example, the +following stores the value `"this food is good"' in the variable +`message': + + thing = "food" + predicate = "good" + message = "this " thing " is " predicate + +This also illustrates string concatenation. The `=' sign is called an +"assignment operator". It is the simplest assignment operator because +the value of the righthand operand is stored unchanged. Most operators +(addition, concatenation, and so on) have no effect except to compute a +value. If the value isn't used, there's no reason to use the operator. +An assignment operator is different; it does produce a value, but even +if you ignore it, the assignment still makes itself felt through the +alteration of the variable. We call this a "side effect". + + The lefthand operand of an assignment need not be a variable (*note +Variables::); it can also be a field (*note Changing Fields::) or an +array element (*note Arrays::). These are all called "lvalues", which +means they can appear on the lefthand side of an assignment operator. +The righthand operand may be any expression; it produces the new value +that the assignment stores in the specified variable, field, or array +element. (Such values are called "rvalues".) + + It is important to note that variables do _not_ have permanent types. +A variable's type is simply the type of whatever value it happens to +hold at the moment. In the following program fragment, the variable +`foo' has a numeric value at first, and a string value later on: + + foo = 1 + print foo + foo = "bar" + print foo + +When the second assignment gives `foo' a string value, the fact that it +previously had a numeric value is forgotten. + + String values that do not begin with a digit have a numeric value of +zero. After executing the following code, the value of `foo' is five: + + foo = "a string" + foo = foo + 5 + + NOTE: Using a variable as a number and then later as a string can + be confusing and is poor programming style. The previous two + examples illustrate how `awk' works, _not_ how you should write + your programs! + + An assignment is an expression, so it has a value--the same value +that is assigned. Thus, `z = 1' is an expression with the value one. +One consequence of this is that you can write multiple assignments +together, such as: + + x = y = z = 5 + +This example stores the value five in all three variables (`x', `y', +and `z'). It does so because the value of `z = 5', which is five, is +stored into `y' and then the value of `y = z = 5', which is five, is +stored into `x'. + + Assignments may be used anywhere an expression is called for. For +example, it is valid to write `x != (y = 1)' to set `y' to one, and +then test whether `x' equals one. But this style tends to make +programs hard to read; such nesting of assignments should be avoided, +except perhaps in a one-shot program. + + Aside from `=', there are several other assignment operators that do +arithmetic with the old value of the variable. For example, the +operator `+=' computes a new value by adding the righthand value to the +old value of the variable. Thus, the following assignment adds five to +the value of `foo': + + foo += 5 + +This is equivalent to the following: + + foo = foo + 5 + +Use whichever makes the meaning of your program clearer. + + There are situations where using `+=' (or any assignment operator) +is _not_ the same as simply repeating the lefthand operand in the +righthand expression. For example: + + # Thanks to Pat Rankin for this example + BEGIN { + foo[rand()] += 5 + for (x in foo) + print x, foo[x] + + bar[rand()] = bar[rand()] + 5 + for (x in bar) + print x, bar[x] + } + +The indices of `bar' are practically guaranteed to be different, because +`rand' returns different values each time it is called. (Arrays and +the `rand' function haven't been covered yet. *Note Arrays::, and see +*note Numeric Functions::, for more information). This example +illustrates an important fact about assignment operators: the lefthand +expression is only evaluated _once_. It is up to the implementation as +to which expression is evaluated first, the lefthand or the righthand. +Consider this example: + + i = 1 + a[i += 2] = i + 1 + +The value of `a[3]' could be either two or four. + + *note table-assign-ops:: lists the arithmetic assignment operators. +In each case, the righthand operand is an expression whose value is +converted to a number. + +Operator Effect +-------------------------------------------------------------------------- +LVALUE `+=' INCREMENT Adds INCREMENT to the value of LVALUE. +LVALUE `-=' DECREMENT Subtracts DECREMENT from the value of LVALUE. +LVALUE `*=' Multiplies the value of LVALUE by COEFFICIENT. +COEFFICIENT +LVALUE `/=' DIVISOR Divides the value of LVALUE by DIVISOR. +LVALUE `%=' MODULUS Sets LVALUE to its remainder by MODULUS. +LVALUE `^=' POWER +LVALUE `**=' POWER Raises LVALUE to the power POWER. + +Table 5.2: Arithmetic Assignment Operators + + NOTE: Only the `^=' operator is specified by POSIX. For maximum + portability, do not use the `**=' operator. + +Advanced Notes: Syntactic Ambiguities Between `/=' and Regular Expressions +-------------------------------------------------------------------------- + +There is a syntactic ambiguity between the `/=' assignment operator and +regexp constants whose first character is an `='. (d.c.) This is most +notable in commercial `awk' versions. For example: + + $ awk /==/ /dev/null + error--> awk: syntax error at source line 1 + error--> context is + error--> >>> /= <<< + error--> awk: bailing out at source line 1 + +A workaround is: + + awk '/[=]=/' /dev/null + + `gawk' does not have this problem, nor do the other freely available +versions described in *note Other Versions::. + + +File: gawk.info, Node: Increment Ops, Next: Truth Values, Prev: Assignment Ops, Up: Expressions + +5.8 Increment and Decrement Operators +===================================== + +"Increment" and "decrement operators" increase or decrease the value of +a variable by one. An assignment operator can do the same thing, so +the increment operators add no power to the `awk' language; however, +they are convenient abbreviations for very common operations. + + The operator used for adding one is written `++'. It can be used to +increment a variable either before or after taking its value. To +pre-increment a variable `v', write `++v'. This adds one to the value +of `v'--that new value is also the value of the expression. (The +assignment expression `v += 1' is completely equivalent.) Writing the +`++' after the variable specifies post-increment. This increments the +variable value just the same; the difference is that the value of the +increment expression itself is the variable's _old_ value. Thus, if +`foo' has the value four, then the expression `foo++' has the value +four, but it changes the value of `foo' to five. In other words, the +operator returns the old value of the variable, but with the side +effect of incrementing it. + + The post-increment `foo++' is nearly the same as writing `(foo += 1) +- 1'. It is not perfectly equivalent because all numbers in `awk' are +floating-point--in floating-point, `foo + 1 - 1' does not necessarily +equal `foo'. But the difference is minute as long as you stick to +numbers that are fairly small (less than 10e12). + + Fields and array elements are incremented just like variables. (Use +`$(i++)' when you want to do a field reference and a variable increment +at the same time. The parentheses are necessary because of the +precedence of the field reference operator `$'.) + + The decrement operator `--' works just like `++', except that it +subtracts one instead of adding it. As with `++', it can be used before +the lvalue to pre-decrement or after it to post-decrement. Following +is a summary of increment and decrement expressions: + +`++LVALUE' + This expression increments LVALUE, and the new value becomes the + value of the expression. + +`LVALUE++' + This expression increments LVALUE, but the value of the expression + is the _old_ value of LVALUE. + +`--LVALUE' + This expression is like `++LVALUE', but instead of adding, it + subtracts. It decrements LVALUE and delivers the value that is + the result. + +`LVALUE--' + This expression is like `LVALUE++', but instead of adding, it + subtracts. It decrements LVALUE. The value of the expression is + the _old_ value of LVALUE. + +Advanced Notes: Operator Evaluation Order +----------------------------------------- + + Doctor, doctor! It hurts when I do this! + So don't do that! + Groucho Marx + +What happens for something like the following? + + b = 6 + print b += b++ + +Or something even stranger? + + b = 6 + b += ++b + b++ + print b + + In other words, when do the various side effects prescribed by the +postfix operators (`b++') take effect? When side effects happen is +"implementation defined". In other words, it is up to the particular +version of `awk'. The result for the first example may be 12 or 13, +and for the second, it may be 22 or 23. + + In short, doing things like this is not recommended and definitely +not anything that you can rely upon for portability. You should avoid +such things in your own programs. + + +File: gawk.info, Node: Truth Values, Next: Typing and Comparison, Prev: Increment Ops, Up: Expressions + +5.9 True and False in `awk' +=========================== + +Many programming languages have a special representation for the +concepts of "true" and "false." Such languages usually use the special +constants `true' and `false', or perhaps their uppercase equivalents. +However, `awk' is different. It borrows a very simple concept of true +and false from C. In `awk', any nonzero numeric value _or_ any +nonempty string value is true. Any other value (zero or the null +string `""') is false. The following program prints `A strange truth +value' three times: + + BEGIN { + if (3.1415927) + print "A strange truth value" + if ("Four Score And Seven Years Ago") + print "A strange truth value" + if (j = 57) + print "A strange truth value" + } + + There is a surprising consequence of the "nonzero or non-null" rule: +the string constant `"0"' is actually true, because it is non-null. +(d.c.) + + +File: gawk.info, Node: Typing and Comparison, Next: Boolean Ops, Prev: Truth Values, Up: Expressions + +5.10 Variable Typing and Comparison Expressions +=============================================== + + The Guide is definitive. Reality is frequently inaccurate. + The Hitchhiker's Guide to the Galaxy + + Unlike other programming languages, `awk' variables do not have a +fixed type. Instead, they can be either a number or a string, depending +upon the value that is assigned to them. We look now at how variables +are typed, and how `awk' compares variables. + +* Menu: + +* Variable Typing:: String type versus numeric type. +* Comparison Operators:: The comparison operators. + + +File: gawk.info, Node: Variable Typing, Next: Comparison Operators, Up: Typing and Comparison + +5.10.1 String Type Versus Numeric Type +-------------------------------------- + +The 1992 POSIX standard introduced the concept of a "numeric string", +which is simply a string that looks like a number--for example, +`" +2"'. This concept is used for determining the type of a variable. +The type of the variable is important because the types of two variables +determine how they are compared. In `gawk', variable typing follows +these rules: + + * A numeric constant or the result of a numeric operation has the + NUMERIC attribute. + + * A string constant or the result of a string operation has the + STRING attribute. + + * Fields, `getline' input, `FILENAME', `ARGV' elements, `ENVIRON' + elements, and the elements of an array created by `split' that are + numeric strings have the STRNUM attribute. Otherwise, they have + the STRING attribute. Uninitialized variables also have the + STRNUM attribute. + + * Attributes propagate across assignments but are not changed by any + use. + + The last rule is particularly important. In the following program, +`a' has numeric type, even though it is later used in a string +operation: + + BEGIN { + a = 12.345 + b = a " is a cute number" + print b + } + + When two operands are compared, either string comparison or numeric +comparison may be used. This depends upon the attributes of the +operands, according to the following symmetric matrix: + + +--------------------------------------------- + | STRING NUMERIC STRNUM + -------+--------------------------------------------- + | + STRING | string string string + | + NUMERIC | string numeric numeric + | + STRNUM | string numeric numeric + -------+--------------------------------------------- + + The basic idea is that user input that looks numeric--and _only_ +user input--should be treated as numeric, even though it is actually +made of characters and is therefore also a string. Thus, for example, +the string constant `" +3.14"', when it appears in program source code, +is a string--even though it looks numeric--and is _never_ treated as +number for comparison purposes. + + In short, when one operand is a "pure" string, such as a string +constant, then a string comparison is performed. Otherwise, a numeric +comparison is performed.(1) + + This point bears additional emphasis: All user input is made of +characters, and so is first and foremost of STRING type; input strings +that look numeric are additionally given the STRNUM attribute. Thus, +the six-character input string ` +3.14' receives the STRNUM attribute. +In contrast, the eight-character literal `" +3.14"' appearing in +program text is a string constant. The following examples print `1' +when the comparison between the two different constants is true, `0' +otherwise: + + $ echo ' +3.14' | gawk '{ print $0 == " +3.14" }' True + -| 1 + $ echo ' +3.14' | gawk '{ print $0 == "+3.14" }' False + -| 0 + $ echo ' +3.14' | gawk '{ print $0 == "3.14" }' False + -| 0 + $ echo ' +3.14' | gawk '{ print $0 == 3.14 }' True + -| 1 + $ echo ' +3.14' | gawk '{ print $1 == " +3.14" }' False + -| 0 + $ echo ' +3.14' | gawk '{ print $1 == "+3.14" }' True + -| 1 + $ echo ' +3.14' | gawk '{ print $1 == "3.14" }' False + -| 0 + $ echo ' +3.14' | gawk '{ print $1 == 3.14 }' True + -| 1 + + ---------- Footnotes ---------- + + (1) The POSIX standard has been revised. The revised standard's +rules for typing and comparison are the same as just described for +`gawk'. + + +File: gawk.info, Node: Comparison Operators, Prev: Variable Typing, Up: Typing and Comparison + +5.10.2 Comparison Operators +--------------------------- + +"Comparison expressions" compare strings or numbers for relationships +such as equality. They are written using "relational operators", which +are a superset of those in C. *note table-relational-ops:: describes +them. + +Expression Result +-------------------------------------------------------------------------- +X `<' Y True if X is less than Y. +X `<=' Y True if X is less than or equal to Y. +X `>' Y True if X is greater than Y. +X `>=' Y True if X is greater than or equal to Y. +X `==' Y True if X is equal to Y. +X `!=' Y True if X is not equal to Y. +X `~' Y True if the string X matches the regexp denoted by Y. +X `!~' Y True if the string X does not match the regexp + denoted by Y. +SUBSCRIPT `in' True if the array ARRAY has an element with the +ARRAY subscript SUBSCRIPT. + +Table 5.3: Relational Operators + + Comparison expressions have the value one if true and zero if false. +When comparing operands of mixed types, numeric operands are converted +to strings using the value of `CONVFMT' (*note Conversion::). + + Strings are compared by comparing the first character of each, then +the second character of each, and so on. Thus, `"10"' is less than +`"9"'. If there are two strings where one is a prefix of the other, +the shorter string is less than the longer one. Thus, `"abc"' is less +than `"abcd"'. + + It is very easy to accidentally mistype the `==' operator and leave +off one of the `=' characters. The result is still valid `awk' code, +but the program does not do what is intended: + + if (a = b) # oops! should be a == b + ... + else + ... + +Unless `b' happens to be zero or the null string, the `if' part of the +test always succeeds. Because the operators are so similar, this kind +of error is very difficult to spot when scanning the source code. + + The following table of expressions illustrates the kind of comparison +`gawk' performs, as well as what the result of the comparison is: + +`1.5 <= 2.0' + numeric comparison (true) + +`"abc" >= "xyz"' + string comparison (false) + +`1.5 != " +2"' + string comparison (true) + +`"1e2" < "3"' + string comparison (true) + +`a = 2; b = "2"' +`a == b' + string comparison (true) + +`a = 2; b = " +2"' + +`a == b' + string comparison (false) + + In the next example: + + $ echo 1e2 3 | awk '{ print ($1 < $2) ? "true" : "false" }' + -| false + +the result is `false' because both `$1' and `$2' are user input. They +are numeric strings--therefore both have the STRNUM attribute, +dictating a numeric comparison. The purpose of the comparison rules +and the use of numeric strings is to attempt to produce the behavior +that is "least surprising," while still "doing the right thing." +String comparisons and regular expression comparisons are very +different. For example: + + x == "foo" + +has the value one, or is true if the variable `x' is precisely `foo'. +By contrast: + + x ~ /foo/ + +has the value one if `x' contains `foo', such as `"Oh, what a fool am +I!"'. + + The righthand operand of the `~' and `!~' operators may be either a +regexp constant (`/.../') or an ordinary expression. In the latter +case, the value of the expression as a string is used as a dynamic +regexp (*note Regexp Usage::; also *note Computed Regexps::). + + In modern implementations of `awk', a constant regular expression in +slashes by itself is also an expression. The regexp `/REGEXP/' is an +abbreviation for the following comparison expression: + + $0 ~ /REGEXP/ + + One special place where `/foo/' is _not_ an abbreviation for `$0 ~ +/foo/' is when it is the righthand operand of `~' or `!~'. *Note Using +Constant Regexps::, where this is discussed in more detail. + + +File: gawk.info, Node: Boolean Ops, Next: Conditional Exp, Prev: Typing and Comparison, Up: Expressions + +5.11 Boolean Expressions +======================== + +A "Boolean expression" is a combination of comparison expressions or +matching expressions, using the Boolean operators "or" (`||'), "and" +(`&&'), and "not" (`!'), along with parentheses to control nesting. +The truth value of the Boolean expression is computed by combining the +truth values of the component expressions. Boolean expressions are +also referred to as "logical expressions". The terms are equivalent. + + Boolean expressions can be used wherever comparison and matching +expressions can be used. They can be used in `if', `while', `do', and +`for' statements (*note Statements::). They have numeric values (one +if true, zero if false) that come into play if the result of the +Boolean expression is stored in a variable or used in arithmetic. + + In addition, every Boolean expression is also a valid pattern, so +you can use one as a pattern to control the execution of rules. The +Boolean operators are: + +`BOOLEAN1 && BOOLEAN2' + True if both BOOLEAN1 and BOOLEAN2 are true. For example, the + following statement prints the current input record if it contains + both `2400' and `foo': + + if ($0 ~ /2400/ && $0 ~ /foo/) print + + The subexpression BOOLEAN2 is evaluated only if BOOLEAN1 is true. + This can make a difference when BOOLEAN2 contains expressions that + have side effects. In the case of `$0 ~ /foo/ && ($2 == bar++)', + the variable `bar' is not incremented if there is no substring + `foo' in the record. + +`BOOLEAN1 || BOOLEAN2' + True if at least one of BOOLEAN1 or BOOLEAN2 is true. For + example, the following statement prints all records in the input + that contain _either_ `2400' or `foo' or both: + + if ($0 ~ /2400/ || $0 ~ /foo/) print + + The subexpression BOOLEAN2 is evaluated only if BOOLEAN1 is false. + This can make a difference when BOOLEAN2 contains expressions that + have side effects. + +`! BOOLEAN' + True if BOOLEAN is false. For example, the following program + prints `no home!' in the unusual event that the `HOME' environment + variable is not defined: + + BEGIN { if (! ("HOME" in ENVIRON)) + print "no home!" } + + (The `in' operator is described in *note Reference to Elements::.) + + The `&&' and `||' operators are called "short-circuit" operators +because of the way they work. Evaluation of the full expression is +"short-circuited" if the result can be determined part way through its +evaluation. + + Statements that use `&&' or `||' can be continued simply by putting +a newline after them. But you cannot put a newline in front of either +of these operators without using backslash continuation (*note +Statements/Lines::). + + The actual value of an expression using the `!' operator is either +one or zero, depending upon the truth value of the expression it is +applied to. The `!' operator is often useful for changing the sense of +a flag variable from false to true and back again. For example, the +following program is one way to print lines in between special +bracketing lines: + + $1 == "START" { interested = ! interested; next } + interested == 1 { print } + $1 == "END" { interested = ! interested; next } + +The variable `interested', as with all `awk' variables, starts out +initialized to zero, which is also false. When a line is seen whose +first field is `START', the value of `interested' is toggled to true, +using `!'. The next rule prints lines as long as `interested' is true. +When a line is seen whose first field is `END', `interested' is toggled +back to false.(1) + + NOTE: The `next' statement is discussed in *note Next Statement::. + `next' tells `awk' to skip the rest of the rules, get the next + record, and start processing the rules over again at the top. The + reason it's there is to avoid printing the bracketing `START' and + `END' lines. + + ---------- Footnotes ---------- + + (1) This program has a bug; it prints lines starting with `END'. How +would you fix it? + + +File: gawk.info, Node: Conditional Exp, Next: Function Calls, Prev: Boolean Ops, Up: Expressions + +5.12 Conditional Expressions +============================ + +A "conditional expression" is a special kind of expression that has +three operands. It allows you to use one expression's value to select +one of two other expressions. The conditional expression is the same +as in the C language, as shown here: + + SELECTOR ? IF-TRUE-EXP : IF-FALSE-EXP + +There are three subexpressions. The first, SELECTOR, is always +computed first. If it is "true" (not zero or not null), then +IF-TRUE-EXP is computed next and its value becomes the value of the +whole expression. Otherwise, IF-FALSE-EXP is computed next and its +value becomes the value of the whole expression. For example, the +following expression produces the absolute value of `x': + + x >= 0 ? x : -x + + Each time the conditional expression is computed, only one of +IF-TRUE-EXP and IF-FALSE-EXP is used; the other is ignored. This is +important when the expressions have side effects. For example, this +conditional expression examines element `i' of either array `a' or +array `b', and increments `i': + + x == y ? a[i++] : b[i++] + +This is guaranteed to increment `i' exactly once, because each time +only one of the two increment expressions is executed and the other is +not. *Note Arrays::, for more information about arrays. + + As a minor `gawk' extension, a statement that uses `?:' can be +continued simply by putting a newline after either character. However, +putting a newline in front of either character does not work without +using backslash continuation (*note Statements/Lines::). If `--posix' +is specified (*note Options::), then this extension is disabled. + + +File: gawk.info, Node: Function Calls, Next: Precedence, Prev: Conditional Exp, Up: Expressions + +5.13 Function Calls +=================== + +A "function" is a name for a particular calculation. This enables you +to ask for it by name at any point in the program. For example, the +function `sqrt' computes the square root of a number. + + A fixed set of functions are "built-in", which means they are +available in every `awk' program. The `sqrt' function is one of these. +*Note Built-in::, for a list of built-in functions and their +descriptions. In addition, you can define functions for use in your +program. *Note User-defined::, for instructions on how to do this. + + The way to use a function is with a "function call" expression, +which consists of the function name followed immediately by a list of +"arguments" in parentheses. The arguments are expressions that provide +the raw materials for the function's calculations. When there is more +than one argument, they are separated by commas. If there are no +arguments, just write `()' after the function name. The following +examples show function calls with and without arguments: + + sqrt(x^2 + y^2) one argument + atan2(y, x) two arguments + rand() no arguments + + *Caution:* Do not put any space between the function name and the +open-parenthesis! A user-defined function name looks just like the +name of a variable--a space would make the expression look like +concatenation of a variable with an expression inside parentheses. + + With built-in functions, space before the parenthesis is harmless, +but it is best not to get into the habit of using space to avoid +mistakes with user-defined functions. Each function expects a +particular number of arguments. For example, the `sqrt' function must +be called with a single argument, the number of which to take the +square root: + + sqrt(ARGUMENT) + + Some of the built-in functions have one or more optional arguments. +If those arguments are not supplied, the functions use a reasonable +default value. *Note Built-in::, for full details. If arguments are +omitted in calls to user-defined functions, then those arguments are +treated as local variables and initialized to the empty string (*note +User-defined::). + + Like every other expression, the function call has a value, which is +computed by the function based on the arguments you give it. In this +example, the value of `sqrt(ARGUMENT)' is the square root of ARGUMENT. +The following program reads numbers, one number per line, and prints the +square root of each one: + + $ awk '{ print "The square root of", $1, "is", sqrt($1) }' + 1 + -| The square root of 1 is 1 + 3 + -| The square root of 3 is 1.73205 + 5 + -| The square root of 5 is 2.23607 + Ctrl-d + + A function can also have side effects, such as assigning values to +certain variables or doing I/O. This program shows how the `match' +function (*note String Functions::) changes the variables `RSTART' and +`RLENGTH': + + { + if (match($1, $2)) + print RSTART, RLENGTH + else + print "no match" + } + +Here is a sample run: + + $ awk -f matchit.awk + aaccdd c+ + -| 3 2 + foo bar + -| no match + abcdefg e + -| 5 1 + + +File: gawk.info, Node: Precedence, Prev: Function Calls, Up: Expressions + +5.14 Operator Precedence (How Operators Nest) +============================================= + +"Operator precedence" determines how operators are grouped when +different operators appear close by in one expression. For example, +`*' has higher precedence than `+'; thus, `a + b * c' means to multiply +`b' and `c', and then add `a' to the product (i.e., `a + (b * c)'). + + The normal precedence of the operators can be overruled by using +parentheses. Think of the precedence rules as saying where the +parentheses are assumed to be. In fact, it is wise to always use +parentheses whenever there is an unusual combination of operators, +because other people who read the program may not remember what the +precedence is in this case. Even experienced programmers occasionally +forget the exact rules, which leads to mistakes. Explicit parentheses +help prevent any such mistakes. + + When operators of equal precedence are used together, the leftmost +operator groups first, except for the assignment, conditional, and +exponentiation operators, which group in the opposite order. Thus, `a +- b + c' groups as `(a - b) + c' and `a = b = c' groups as `a = (b = +c)'. + + Normally the precedence of prefix unary operators does not matter, +because there is only one way to interpret them: innermost first. +Thus, `$++i' means `$(++i)' and `++$x' means `++($x)'. However, when +another operator follows the operand, then the precedence of the unary +operators can matter. `$x^2' means `($x)^2', but `-x^2' means +`-(x^2)', because `-' has lower precedence than `^', whereas `$' has +higher precedence. Also, operators cannot be combined in a way that +violates the precedence rules; for example, `$$0++--' is not a valid +expression because the first `$' has higher precedence than the `++'; +to avoid the problem the expression can be rewritten as `$($0++)--'. + + This table presents `awk''s operators, in order of highest to lowest +precedence: + +`(...)' + Grouping. + +`$' + Field. + +`++ --' + Increment, decrement. + +`^ **' + Exponentiation. These operators group right-to-left. + +`+ - !' + Unary plus, minus, logical "not." + +`* / %' + Multiplication, division, remainder. + +`+ -' + Addition, subtraction. + +`String Concatenation' + No special symbol is used to indicate concatenation. The operands + are simply written side by side (*note Concatenation::). + +`< <= == !=' +`> >= >> | |&' + Relational and redirection. The relational operators and the + redirections have the same precedence level. Characters such as + `>' serve both as relationals and as redirections; the context + distinguishes between the two meanings. + + Note that the I/O redirection operators in `print' and `printf' + statements belong to the statement level, not to expressions. The + redirection does not produce an expression that could be the + operand of another operator. As a result, it does not make sense + to use a redirection operator near another operator of lower + precedence without parentheses. Such combinations (for example, + `print foo > a ? b : c'), result in syntax errors. The correct + way to write this statement is `print foo > (a ? b : c)'. + +`~ !~' + Matching, nonmatching. + +`in' + Array membership. + +`&&' + Logical "and". + +`||' + Logical "or". + +`?:' + Conditional. This operator groups right-to-left. + +`= += -= *=' +`/= %= ^= **=' + Assignment. These operators group right to left. + + NOTE: The `|&', `**', and `**=' operators are not specified by + POSIX. For maximum portability, do not use them. + + +File: gawk.info, Node: Patterns and Actions, Next: Arrays, Prev: Expressions, Up: Top + +6 Patterns, Actions, and Variables +********************************** + +As you have already seen, each `awk' statement consists of a pattern +with an associated action. This major node describes how you build +patterns and actions, what kinds of things you can do within actions, +and `awk''s built-in variables. + + The pattern-action rules and the statements available for use within +actions form the core of `awk' programming. In a sense, everything +covered up to here has been the foundation that programs are built on +top of. Now it's time to start building something useful. + +* Menu: + +* Pattern Overview:: What goes into a pattern. +* Using Shell Variables:: How to use shell variables with `awk'. +* Action Overview:: What goes into an action. +* Statements:: Describes the various control statements in + detail. +* Built-in Variables:: Summarizes the built-in variables. + + +File: gawk.info, Node: Pattern Overview, Next: Using Shell Variables, Up: Patterns and Actions + +6.1 Pattern Elements +==================== + +* Menu: + +* Regexp Patterns:: Using regexps as patterns. +* Expression Patterns:: Any expression can be used as a pattern. +* Ranges:: Pairs of patterns specify record ranges. +* BEGIN/END:: Specifying initialization and cleanup rules. +* Empty:: The empty pattern, which matches every record. + + Patterns in `awk' control the execution of rules--a rule is executed +when its pattern matches the current input record. The following is a +summary of the types of `awk' patterns: + +`/REGULAR EXPRESSION/' + A regular expression. It matches when the text of the input record + fits the regular expression. (*Note Regexp::.) + +`EXPRESSION' + A single expression. It matches when its value is nonzero (if a + number) or non-null (if a string). (*Note Expression Patterns::.) + +`PAT1, PAT2' + A pair of patterns separated by a comma, specifying a range of + records. The range includes both the initial record that matches + PAT1 and the final record that matches PAT2. (*Note Ranges::.) + +`BEGIN' +`END' + Special patterns for you to supply startup or cleanup actions for + your `awk' program. (*Note BEGIN/END::.) + +`EMPTY' + The empty pattern matches every input record. (*Note Empty::.) + + +File: gawk.info, Node: Regexp Patterns, Next: Expression Patterns, Up: Pattern Overview + +6.1.1 Regular Expressions as Patterns +------------------------------------- + +Regular expressions are one of the first kinds of patterns presented in +this book. This kind of pattern is simply a regexp constant in the +pattern part of a rule. Its meaning is `$0 ~ /PATTERN/'. The pattern +matches when the input record matches the regexp. For example: + + /foo|bar|baz/ { buzzwords++ } + END { print buzzwords, "buzzwords seen" } + + +File: gawk.info, Node: Expression Patterns, Next: Ranges, Prev: Regexp Patterns, Up: Pattern Overview + +6.1.2 Expressions as Patterns +----------------------------- + +Any `awk' expression is valid as an `awk' pattern. The pattern matches +if the expression's value is nonzero (if a number) or non-null (if a +string). The expression is reevaluated each time the rule is tested +against a new input record. If the expression uses fields such as +`$1', the value depends directly on the new input record's text; +otherwise, it depends on only what has happened so far in the execution +of the `awk' program. + + Comparison expressions, using the comparison operators described in +*note Typing and Comparison::, are a very common kind of pattern. +Regexp matching and nonmatching are also very common expressions. The +left operand of the `~' and `!~' operators is a string. The right +operand is either a constant regular expression enclosed in slashes +(`/REGEXP/'), or any expression whose string value is used as a dynamic +regular expression (*note Computed Regexps::). The following example +prints the second field of each input record whose first field is +precisely `foo': + + $ awk '$1 == "foo" { print $2 }' BBS-list + +(There is no output, because there is no BBS site with the exact name +`foo'.) Contrast this with the following regular expression match, +which accepts any record with a first field that contains `foo': + + $ awk '$1 ~ /foo/ { print $2 }' BBS-list + -| 555-1234 + -| 555-6699 + -| 555-6480 + -| 555-2127 + + A regexp constant as a pattern is also a special case of an +expression pattern. The expression `/foo/' has the value one if `foo' +appears in the current input record. Thus, as a pattern, `/foo/' +matches any record containing `foo'. + + Boolean expressions are also commonly used as patterns. Whether the +pattern matches an input record depends on whether its subexpressions +match. For example, the following command prints all the records in +`BBS-list' that contain both `2400' and `foo': + + $ awk '/2400/ && /foo/' BBS-list + -| fooey 555-1234 2400/1200/300 B + + The following command prints all records in `BBS-list' that contain +_either_ `2400' or `foo' (or both, of course): + + $ awk '/2400/ || /foo/' BBS-list + -| alpo-net 555-3412 2400/1200/300 A + -| bites 555-1675 2400/1200/300 A + -| fooey 555-1234 2400/1200/300 B + -| foot 555-6699 1200/300 B + -| macfoo 555-6480 1200/300 A + -| sdace 555-3430 2400/1200/300 A + -| sabafoo 555-2127 1200/300 C + + The following command prints all records in `BBS-list' that do _not_ +contain the string `foo': + + $ awk '! /foo/' BBS-list + -| aardvark 555-5553 1200/300 B + -| alpo-net 555-3412 2400/1200/300 A + -| barfly 555-7685 1200/300 A + -| bites 555-1675 2400/1200/300 A + -| camelot 555-0542 300 C + -| core 555-2912 1200/300 C + -| sdace 555-3430 2400/1200/300 A + + The subexpressions of a Boolean operator in a pattern can be +constant regular expressions, comparisons, or any other `awk' +expressions. Range patterns are not expressions, so they cannot appear +inside Boolean patterns. Likewise, the special patterns `BEGIN' and +`END', which never match any input record, are not expressions and +cannot appear inside Boolean patterns. + + +File: gawk.info, Node: Ranges, Next: BEGIN/END, Prev: Expression Patterns, Up: Pattern Overview + +6.1.3 Specifying Record Ranges with Patterns +-------------------------------------------- + +A "range pattern" is made of two patterns separated by a comma, in the +form `BEGPAT, ENDPAT'. It is used to match ranges of consecutive input +records. The first pattern, BEGPAT, controls where the range begins, +while ENDPAT controls where the pattern ends. For example, the +following: + + awk '$1 == "on", $1 == "off"' myfile + +prints every record in `myfile' between `on'/`off' pairs, inclusive. + + A range pattern starts out by matching BEGPAT against every input +record. When a record matches BEGPAT, the range pattern is "turned on" +and the range pattern matches this record as well. As long as the +range pattern stays turned on, it automatically matches every input +record read. The range pattern also matches ENDPAT against every input +record; when this succeeds, the range pattern is turned off again for +the following record. Then the range pattern goes back to checking +BEGPAT against each record. + + The record that turns on the range pattern and the one that turns it +off both match the range pattern. If you don't want to operate on +these records, you can write `if' statements in the rule's action to +distinguish them from the records you are interested in. + + It is possible for a pattern to be turned on and off by the same +record. If the record satisfies both conditions, then the action is +executed for just that record. For example, suppose there is text +between two identical markers (e.g., the `%' symbol), each on its own +line, that should be ignored. A first attempt would be to combine a +range pattern that describes the delimited text with the `next' +statement (not discussed yet, *note Next Statement::). This causes +`awk' to skip any further processing of the current record and start +over again with the next input record. Such a program looks like this: + + /^%$/,/^%$/ { next } + { print } + +This program fails because the range pattern is both turned on and +turned off by the first line, which just has a `%' on it. To +accomplish this task, write the program in the following manner, using +a flag: + + /^%$/ { skip = ! skip; next } + skip == 1 { next } # skip lines with `skip' set + + In a range pattern, the comma (`,') has the lowest precedence of all +the operators (i.e., it is evaluated last). Thus, the following +program attempts to combine a range pattern with another, simpler test: + + echo Yes | awk '/1/,/2/ || /Yes/' + + The intent of this program is `(/1/,/2/) || /Yes/'. However, `awk' +interprets this as `/1/, (/2/ || /Yes/)'. This cannot be changed or +worked around; range patterns do not combine with other patterns: + + $ echo Yes | gawk '(/1/,/2/) || /Yes/' + error--> gawk: cmd. line:1: (/1/,/2/) || /Yes/ + error--> gawk: cmd. line:1: ^ parse error + error--> gawk: cmd. line:2: (/1/,/2/) || /Yes/ + error--> gawk: cmd. line:2: ^ unexpected newline + + +File: gawk.info, Node: BEGIN/END, Next: Empty, Prev: Ranges, Up: Pattern Overview + +6.1.4 The `BEGIN' and `END' Special Patterns +-------------------------------------------- + +All the patterns described so far are for matching input records. The +`BEGIN' and `END' special patterns are different. They supply startup +and cleanup actions for `awk' programs. `BEGIN' and `END' rules must +have actions; there is no default action for these rules because there +is no current record when they run. `BEGIN' and `END' rules are often +referred to as "`BEGIN' and `END' blocks" by long-time `awk' +programmers. + +* Menu: + +* Using BEGIN/END:: How and why to use BEGIN/END rules. +* I/O And BEGIN/END:: I/O issues in BEGIN/END rules. + + +File: gawk.info, Node: Using BEGIN/END, Next: I/O And BEGIN/END, Up: BEGIN/END + +6.1.4.1 Startup and Cleanup Actions +................................... + +A `BEGIN' rule is executed once only, before the first input record is +read. Likewise, an `END' rule is executed once only, after all the +input is read. For example: + + $ awk ' + > BEGIN { print "Analysis of \"foo\"" } + > /foo/ { ++n } + > END { print "\"foo\" appears", n, "times." }' BBS-list + -| Analysis of "foo" + -| "foo" appears 4 times. + + This program finds the number of records in the input file `BBS-list' +that contain the string `foo'. The `BEGIN' rule prints a title for the +report. There is no need to use the `BEGIN' rule to initialize the +counter `n' to zero, since `awk' does this automatically (*note +Variables::). The second rule increments the variable `n' every time a +record containing the pattern `foo' is read. The `END' rule prints the +value of `n' at the end of the run. + + The special patterns `BEGIN' and `END' cannot be used in ranges or +with Boolean operators (indeed, they cannot be used with any operators). +An `awk' program may have multiple `BEGIN' and/or `END' rules. They +are executed in the order in which they appear: all the `BEGIN' rules +at startup and all the `END' rules at termination. `BEGIN' and `END' +rules may be intermixed with other rules. This feature was added in +the 1987 version of `awk' and is included in the POSIX standard. The +original (1978) version of `awk' required the `BEGIN' rule to be placed +at the beginning of the program, the `END' rule to be placed at the +end, and only allowed one of each. This is no longer required, but it +is a good idea to follow this template in terms of program organization +and readability. + + Multiple `BEGIN' and `END' rules are useful for writing library +functions, because each library file can have its own `BEGIN' and/or +`END' rule to do its own initialization and/or cleanup. The order in +which library functions are named on the command line controls the +order in which their `BEGIN' and `END' rules are executed. Therefore, +you have to be careful when writing such rules in library files so that +the order in which they are executed doesn't matter. *Note Options::, +for more information on using library functions. *Note Library +Functions::, for a number of useful library functions. + + If an `awk' program has only a `BEGIN' rule and no other rules, then +the program exits after the `BEGIN' rule is run.(1) However, if an +`END' rule exists, then the input is read, even if there are no other +rules in the program. This is necessary in case the `END' rule checks +the `FNR' and `NR' variables. + + ---------- Footnotes ---------- + + (1) The original version of `awk' used to keep reading and ignoring +input until the end of the file was seen. + + +File: gawk.info, Node: I/O And BEGIN/END, Prev: Using BEGIN/END, Up: BEGIN/END + +6.1.4.2 Input/Output from `BEGIN' and `END' Rules +................................................. + +There are several (sometimes subtle) points to remember when doing I/O +from a `BEGIN' or `END' rule. The first has to do with the value of +`$0' in a `BEGIN' rule. Because `BEGIN' rules are executed before any +input is read, there simply is no input record, and therefore no +fields, when executing `BEGIN' rules. References to `$0' and the fields +yield a null string or zero, depending upon the context. One way to +give `$0' a real value is to execute a `getline' command without a +variable (*note Getline::). Another way is simply to assign a value to +`$0'. + + The second point is similar to the first but from the other +direction. Traditionally, due largely to implementation issues, `$0' +and `NF' were _undefined_ inside an `END' rule. The POSIX standard +specifies that `NF' is available in an `END' rule. It contains the +number of fields from the last input record. Most probably due to an +oversight, the standard does not say that `$0' is also preserved, +although logically one would think that it should be. In fact, `gawk' +does preserve the value of `$0' for use in `END' rules. Be aware, +however, that Unix `awk', and possibly other implementations, do not. + + The third point follows from the first two. The meaning of `print' +inside a `BEGIN' or `END' rule is the same as always: `print $0'. If +`$0' is the null string, then this prints an empty line. Many long +time `awk' programmers use an unadorned `print' in `BEGIN' and `END' +rules, to mean `print ""', relying on `$0' being null. Although one +might generally get away with this in `BEGIN' rules, it is a very bad +idea in `END' rules, at least in `gawk'. It is also poor style, since +if an empty line is needed in the output, the program should print one +explicitly. + + Finally, the `next' and `nextfile' statements are not allowed in a +`BEGIN' rule, because the implicit +read-a-record-and-match-against-the-rules loop has not started yet. +Similarly, those statements are not valid in an `END' rule, since all +the input has been read. (*Note Next Statement::, and see *note +Nextfile Statement::.) + + +File: gawk.info, Node: Empty, Prev: BEGIN/END, Up: Pattern Overview + +6.1.5 The Empty Pattern +----------------------- + +An empty (i.e., nonexistent) pattern is considered to match _every_ +input record. For example, the program: + + awk '{ print $1 }' BBS-list + +prints the first field of every record. + + +File: gawk.info, Node: Using Shell Variables, Next: Action Overview, Prev: Pattern Overview, Up: Patterns and Actions + +6.2 Using Shell Variables in Programs +===================================== + +`awk' programs are often used as components in larger programs written +in shell. For example, it is very common to use a shell variable to +hold a pattern that the `awk' program searches for. There are two ways +to get the value of the shell variable into the body of the `awk' +program. + + The most common method is to use shell quoting to substitute the +variable's value into the program inside the script. For example, in +the following program: + + echo -n "Enter search pattern: " + read pattern + awk "/$pattern/ "'{ nmatches++ } + END { print nmatches, "found" }' /path/to/data + +the `awk' program consists of two pieces of quoted text that are +concatenated together to form the program. The first part is +double-quoted, which allows substitution of the `pattern' variable +inside the quotes. The second part is single-quoted. + + Variable substitution via quoting works, but can be potentially +messy. It requires a good understanding of the shell's quoting rules +(*note Quoting::), and it's often difficult to correctly match up the +quotes when reading the program. + + A better method is to use `awk''s variable assignment feature (*note +Assignment Options::) to assign the shell variable's value to an `awk' +variable's value. Then use dynamic regexps to match the pattern (*note +Computed Regexps::). The following shows how to redo the previous +example using this technique: + + echo -n "Enter search pattern: " + read pattern + awk -v pat="$pattern" '$0 ~ pat { nmatches++ } + END { print nmatches, "found" }' /path/to/data + +Now, the `awk' program is just one single-quoted string. The +assignment `-v pat="$pattern"' still requires double quotes, in case +there is whitespace in the value of `$pattern'. The `awk' variable +`pat' could be named `pattern' too, but that would be more confusing. +Using a variable also provides more flexibility, since the variable can +be used anywhere inside the program--for printing, as an array +subscript, or for any other use--without requiring the quoting tricks +at every point in the program. + + +File: gawk.info, Node: Action Overview, Next: Statements, Prev: Using Shell Variables, Up: Patterns and Actions + +6.3 Actions +=========== + +An `awk' program or script consists of a series of rules and function +definitions interspersed. (Functions are described later. *Note +User-defined::.) A rule contains a pattern and an action, either of +which (but not both) may be omitted. The purpose of the "action" is to +tell `awk' what to do once a match for the pattern is found. Thus, in +outline, an `awk' program generally looks like this: + + [PATTERN] [{ ACTION }] + [PATTERN] [{ ACTION }] + ... + function NAME(ARGS) { ... } + ... + + An action consists of one or more `awk' "statements", enclosed in +curly braces (`{...}'). Each statement specifies one thing to do. The +statements are separated by newlines or semicolons. The curly braces +around an action must be used even if the action contains only one +statement, or if it contains no statements at all. However, if you +omit the action entirely, omit the curly braces as well. An omitted +action is equivalent to `{ print $0 }': + + /foo/ { } match `foo', do nothing -- empty action + /foo/ match `foo', print the record -- omitted action + + The following types of statements are supported in `awk': + +Expressions + Call functions or assign values to variables (*note + Expressions::). Executing this kind of statement simply computes + the value of the expression. This is useful when the expression + has side effects (*note Assignment Ops::). + +Control statements + Specify the control flow of `awk' programs. The `awk' language + gives you C-like constructs (`if', `for', `while', and `do') as + well as a few special ones (*note Statements::). + +Compound statements + Consist of one or more statements enclosed in curly braces. A + compound statement is used in order to put several statements + together in the body of an `if', `while', `do', or `for' statement. + +Input statements + Use the `getline' command (*note Getline::). Also supplied in + `awk' are the `next' statement (*note Next Statement::), and the + `nextfile' statement (*note Nextfile Statement::). + +Output statements + Such as `print' and `printf'. *Note Printing::. + +Deletion statements + For deleting array elements. *Note Delete::. + + +File: gawk.info, Node: Statements, Next: Built-in Variables, Prev: Action Overview, Up: Patterns and Actions + +6.4 Control Statements in Actions +================================= + +"Control statements", such as `if', `while', and so on, control the +flow of execution in `awk' programs. Most of the control statements in +`awk' are patterned on similar statements in C. + + All the control statements start with special keywords, such as `if' +and `while', to distinguish them from simple expressions. Many control +statements contain other statements. For example, the `if' statement +contains another statement that may or may not be executed. The +contained statement is called the "body". To include more than one +statement in the body, group them into a single "compound statement" +with curly braces, separating them with newlines or semicolons. + +* Menu: + +* If Statement:: Conditionally execute some `awk' + statements. +* While Statement:: Loop until some condition is satisfied. +* Do Statement:: Do specified action while looping until some + condition is satisfied. +* For Statement:: Another looping statement, that provides + initialization and increment clauses. +* Switch Statement:: Switch/case evaluation for conditional + execution of statements based on a value. +* Break Statement:: Immediately exit the innermost enclosing loop. +* Continue Statement:: Skip to the end of the innermost enclosing + loop. +* Next Statement:: Stop processing the current input record. +* Nextfile Statement:: Stop processing the current file. +* Exit Statement:: Stop execution of `awk'. + + +File: gawk.info, Node: If Statement, Next: While Statement, Up: Statements + +6.4.1 The `if'-`else' Statement +------------------------------- + +The `if'-`else' statement is `awk''s decision-making statement. It +looks like this: + + if (CONDITION) THEN-BODY [else ELSE-BODY] + +The CONDITION is an expression that controls what the rest of the +statement does. If the CONDITION is true, THEN-BODY is executed; +otherwise, ELSE-BODY is executed. The `else' part of the statement is +optional. The condition is considered false if its value is zero or +the null string; otherwise, the condition is true. Refer to the +following: + + if (x % 2 == 0) + print "x is even" + else + print "x is odd" + + In this example, if the expression `x % 2 == 0' is true (that is, if +the value of `x' is evenly divisible by two), then the first `print' +statement is executed; otherwise, the second `print' statement is +executed. If the `else' keyword appears on the same line as THEN-BODY +and THEN-BODY is not a compound statement (i.e., not surrounded by +curly braces), then a semicolon must separate THEN-BODY from the `else'. +To illustrate this, the previous example can be rewritten as: + + if (x % 2 == 0) print "x is even"; else + print "x is odd" + +If the `;' is left out, `awk' can't interpret the statement and it +produces a syntax error. Don't actually write programs this way, +because a human reader might fail to see the `else' if it is not the +first thing on its line. + + +File: gawk.info, Node: While Statement, Next: Do Statement, Prev: If Statement, Up: Statements + +6.4.2 The `while' Statement +--------------------------- + +In programming, a "loop" is a part of a program that can be executed +two or more times in succession. The `while' statement is the simplest +looping statement in `awk'. It repeatedly executes a statement as long +as a condition is true. For example: + + while (CONDITION) + BODY + +BODY is a statement called the "body" of the loop, and CONDITION is an +expression that controls how long the loop keeps running. The first +thing the `while' statement does is test the CONDITION. If the +CONDITION is true, it executes the statement BODY. (The CONDITION is +true when the value is not zero and not a null string.) After BODY has +been executed, CONDITION is tested again, and if it is still true, BODY +is executed again. This process repeats until the CONDITION is no +longer true. If the CONDITION is initially false, the body of the loop +is never executed and `awk' continues with the statement following the +loop. This example prints the first three fields of each record, one +per line: + + awk '{ i = 1 + while (i <= 3) { + print $i + i++ + } + }' inventory-shipped + +The body of this loop is a compound statement enclosed in braces, +containing two statements. The loop works in the following manner: +first, the value of `i' is set to one. Then, the `while' statement +tests whether `i' is less than or equal to three. This is true when +`i' equals one, so the `i'-th field is printed. Then the `i++' +increments the value of `i' and the loop repeats. The loop terminates +when `i' reaches four. + + A newline is not required between the condition and the body; +however using one makes the program clearer unless the body is a +compound statement or else is very simple. The newline after the +open-brace that begins the compound statement is not required either, +but the program is harder to read without it. + + +File: gawk.info, Node: Do Statement, Next: For Statement, Prev: While Statement, Up: Statements + +6.4.3 The `do'-`while' Statement +-------------------------------- + +The `do' loop is a variation of the `while' looping statement. The +`do' loop executes the BODY once and then repeats the BODY as long as +the CONDITION is true. It looks like this: + + do + BODY + while (CONDITION) + + Even if the CONDITION is false at the start, the BODY is executed at +least once (and only once, unless executing BODY makes CONDITION true). +Contrast this with the corresponding `while' statement: + + while (CONDITION) + BODY + +This statement does not execute BODY even once if the CONDITION is +false to begin with. The following is an example of a `do' statement: + + { i = 1 + do { + print $0 + i++ + } while (i <= 10) + } + +This program prints each input record 10 times. However, it isn't a +very realistic example, since in this case an ordinary `while' would do +just as well. This situation reflects actual experience; only +occasionally is there a real use for a `do' statement. + + +File: gawk.info, Node: For Statement, Next: Switch Statement, Prev: Do Statement, Up: Statements + +6.4.4 The `for' Statement +------------------------- + +The `for' statement makes it more convenient to count iterations of a +loop. The general form of the `for' statement looks like this: + + for (INITIALIZATION; CONDITION; INCREMENT) + BODY + +The INITIALIZATION, CONDITION, and INCREMENT parts are arbitrary `awk' +expressions, and BODY stands for any `awk' statement. + + The `for' statement starts by executing INITIALIZATION. Then, as +long as the CONDITION is true, it repeatedly executes BODY and then +INCREMENT. Typically, INITIALIZATION sets a variable to either zero or +one, INCREMENT adds one to it, and CONDITION compares it against the +desired number of iterations. For example: + + awk '{ for (i = 1; i <= 3; i++) + print $i + }' inventory-shipped + +This prints the first three fields of each input record, with one field +per line. + + It isn't possible to set more than one variable in the +INITIALIZATION part without using a multiple assignment statement such +as `x = y = 0'. This makes sense only if all the initial values are +equal. (But it is possible to initialize additional variables by +writing their assignments as separate statements preceding the `for' +loop.) + + The same is true of the INCREMENT part. Incrementing additional +variables requires separate statements at the end of the loop. The C +compound expression, using C's comma operator, is useful in this +context but it is not supported in `awk'. + + Most often, INCREMENT is an increment expression, as in the previous +example. But this is not required; it can be any expression +whatsoever. For example, the following statement prints all the powers +of two between 1 and 100: + + for (i = 1; i <= 100; i *= 2) + print i + + If there is nothing to be done, any of the three expressions in the +parentheses following the `for' keyword may be omitted. Thus, +`for (; x > 0;)' is equivalent to `while (x > 0)'. If the CONDITION is +omitted, it is treated as true, effectively yielding an "infinite loop" +(i.e., a loop that never terminates). + + In most cases, a `for' loop is an abbreviation for a `while' loop, +as shown here: + + INITIALIZATION + while (CONDITION) { + BODY + INCREMENT + } + +The only exception is when the `continue' statement (*note Continue +Statement::) is used inside the loop. Changing a `for' statement to a +`while' statement in this way can change the effect of the `continue' +statement inside the loop. + + The `awk' language has a `for' statement in addition to a `while' +statement because a `for' loop is often both less work to type and more +natural to think of. Counting the number of iterations is very common +in loops. It can be easier to think of this counting as part of +looping rather than as something to do inside the loop. + + There is an alternate version of the `for' loop, for iterating over +all the indices of an array: + + for (i in array) + DO SOMETHING WITH array[i] + +*Note Scanning an Array::, for more information on this version of the +`for' loop. + + +File: gawk.info, Node: Switch Statement, Next: Break Statement, Prev: For Statement, Up: Statements + +6.4.5 The `switch' Statement +---------------------------- + + NOTE: This node describes an experimental feature added in `gawk' + 3.1.3. It is _not_ enabled by default. To enable it, use the + `--enable-switch' option to `configure' when `gawk' is being + configured and built. *Note Additional Configuration Options::, + for more information. + + The `switch' statement allows the evaluation of an expression and +the execution of statements based on a `case' match. Case statements +are checked for a match in the order they are defined. If no suitable +`case' is found, the `default' section is executed, if supplied. + + Each `case' contains a single constant, be it numeric, string, or +regexp. The `switch' expression is evaluated, and then each `case''s +constant is compared against the result in turn. The type of constant +determines the comparison: numeric or string do the usual comparisons. +A regexp constant does a regular expression match against the string +value of the original expression. The general form of the `switch' +statement looks like this: + + switch (EXPRESSION) { + case VALUE OR REGULAR EXPRESSION: + CASE-BODY + default: + DEFAULT-BODY + } + + Control flow in the `switch' statement works as it does in C. Once a +match to a given case is made, case statement bodies are executed until +a `break', `continue', `next', `nextfile' or `exit' is encountered, or +the end of the `switch' statement itself. For example: + + switch (NR * 2 + 1) { + case 3: + case "11": + print NR - 1 + break + + case /2[[:digit:]]+/: + print NR + + default: + print NR + 1 + + case -1: + print NR * -1 + } + + Note that if none of the statements specified above halt execution +of a matched `case' statement, execution falls through to the next +`case' until execution halts. In the above example, for any case value +starting with `2' followed by one or more digits, the `print' statement +is executed and then falls through into the `default' section, +executing its `print' statement. In turn, the -1 case will also be +executed since the `default' does not halt execution. + + +File: gawk.info, Node: Break Statement, Next: Continue Statement, Prev: Switch Statement, Up: Statements + +6.4.6 The `break' Statement +--------------------------- + +The `break' statement jumps out of the innermost `for', `while', or +`do' loop that encloses it. The following example finds the smallest +divisor of any integer, and also identifies prime numbers: + + # find smallest divisor of num + { + num = $1 + for (div = 2; div*div <= num; div++) + if (num % div == 0) + break + if (num % div == 0) + printf "Smallest divisor of %d is %d\n", num, div + else + printf "%d is prime\n", num + } + + When the remainder is zero in the first `if' statement, `awk' +immediately "breaks out" of the containing `for' loop. This means that +`awk' proceeds immediately to the statement following the loop and +continues processing. (This is very different from the `exit' +statement, which stops the entire `awk' program. *Note Exit +Statement::.) + + Th following program illustrates how the CONDITION of a `for' or +`while' statement could be replaced with a `break' inside an `if': + + # find smallest divisor of num + { + num = $1 + for (div = 2; ; div++) { + if (num % div == 0) { + printf "Smallest divisor of %d is %d\n", num, div + break + } + if (div*div > num) { + printf "%d is prime\n", num + break + } + } + } + + The `break' statement has no meaning when used outside the body of a +loop. However, although it was never documented, historical +implementations of `awk' treated the `break' statement outside of a +loop as if it were a `next' statement (*note Next Statement::). Recent +versions of Unix `awk' no longer allow this usage. `gawk' supports +this use of `break' only if `--traditional' has been specified on the +command line (*note Options::). Otherwise, it is treated as an error, +since the POSIX standard specifies that `break' should only be used +inside the body of a loop. (d.c.) + + +File: gawk.info, Node: Continue Statement, Next: Next Statement, Prev: Break Statement, Up: Statements + +6.4.7 The `continue' Statement +------------------------------ + +As with `break', the `continue' statement is used only inside `for', +`while', and `do' loops. It skips over the rest of the loop body, +causing the next cycle around the loop to begin immediately. Contrast +this with `break', which jumps out of the loop altogether. + + The `continue' statement in a `for' loop directs `awk' to skip the +rest of the body of the loop and resume execution with the +increment-expression of the `for' statement. The following program +illustrates this fact: + + BEGIN { + for (x = 0; x <= 20; x++) { + if (x == 5) + continue + printf "%d ", x + } + print "" + } + +This program prints all the numbers from 0 to 20--except for 5, for +which the `printf' is skipped. Because the increment `x++' is not +skipped, `x' does not remain stuck at 5. Contrast the `for' loop from +the previous example with the following `while' loop: + + BEGIN { + x = 0 + while (x <= 20) { + if (x == 5) + continue + printf "%d ", x + x++ + } + print "" + } + +This program loops forever once `x' reaches 5. + + The `continue' statement has no meaning when used outside the body of +a loop. Historical versions of `awk' treated a `continue' statement +outside a loop the same way they treated a `break' statement outside a +loop: as if it were a `next' statement (*note Next Statement::). +Recent versions of Unix `awk' no longer work this way, and `gawk' +allows it only if `--traditional' is specified on the command line +(*note Options::). Just like the `break' statement, the POSIX standard +specifies that `continue' should only be used inside the body of a loop. +(d.c.) + + +File: gawk.info, Node: Next Statement, Next: Nextfile Statement, Prev: Continue Statement, Up: Statements + +6.4.8 The `next' Statement +-------------------------- + +The `next' statement forces `awk' to immediately stop processing the +current record and go on to the next record. This means that no +further rules are executed for the current record, and the rest of the +current rule's action isn't executed. + + Contrast this with the effect of the `getline' function (*note +Getline::). That also causes `awk' to read the next record +immediately, but it does not alter the flow of control in any way +(i.e., the rest of the current action executes with a new input record). + + At the highest level, `awk' program execution is a loop that reads +an input record and then tests each rule's pattern against it. If you +think of this loop as a `for' statement whose body contains the rules, +then the `next' statement is analogous to a `continue' statement. It +skips to the end of the body of this implicit loop and executes the +increment (which reads another record). + + For example, suppose an `awk' program works only on records with +four fields, and it shouldn't fail when given bad input. To avoid +complicating the rest of the program, write a "weed out" rule near the +beginning, in the following manner: + + NF != 4 { + err = sprintf("%s:%d: skipped: NF != 4\n", FILENAME, FNR) + print err > "/dev/stderr" + next + } + +Because of the `next' statement, the program's subsequent rules won't +see the bad record. The error message is redirected to the standard +error output stream, as error messages should be. For more detail see +*note Special Files::. + + According to the POSIX standard, the behavior is undefined if the +`next' statement is used in a `BEGIN' or `END' rule. `gawk' treats it +as a syntax error. Although POSIX permits it, some other `awk' +implementations don't allow the `next' statement inside function bodies +(*note User-defined::). Just as with any other `next' statement, a +`next' statement inside a function body reads the next record and +starts processing it with the first rule in the program. If the `next' +statement causes the end of the input to be reached, then the code in +any `END' rules is executed. *Note BEGIN/END::. + + +File: gawk.info, Node: Nextfile Statement, Next: Exit Statement, Prev: Next Statement, Up: Statements + +6.4.9 Using `gawk''s `nextfile' Statement +----------------------------------------- + +`gawk' provides the `nextfile' statement, which is similar to the +`next' statement. However, instead of abandoning processing of the +current record, the `nextfile' statement instructs `gawk' to stop +processing the current data file. + + The `nextfile' statement is a `gawk' extension. In most other `awk' +implementations, or if `gawk' is in compatibility mode (*note +Options::), `nextfile' is not special. + + Upon execution of the `nextfile' statement, `FILENAME' is updated to +the name of the next data file listed on the command line, `FNR' is +reset to one, `ARGIND' is incremented, and processing starts over with +the first rule in the program. (`ARGIND' hasn't been introduced yet. +*Note Built-in Variables::.) If the `nextfile' statement causes the +end of the input to be reached, then the code in any `END' rules is +executed. *Note BEGIN/END::. + + The `nextfile' statement is useful when there are many data files to +process but it isn't necessary to process every record in every file. +Normally, in order to move on to the next data file, a program has to +continue scanning the unwanted records. The `nextfile' statement +accomplishes this much more efficiently. + + While one might think that `close(FILENAME)' would accomplish the +same as `nextfile', this isn't true. `close' is reserved for closing +files, pipes, and coprocesses that are opened with redirections. It is +not related to the main processing that `awk' does with the files +listed in `ARGV'. + + If it's necessary to use an `awk' version that doesn't support +`nextfile', see *note Nextfile Function::, for a user-defined function +that simulates the `nextfile' statement. + + The current version of the Bell Laboratories `awk' (*note Other +Versions::) also supports `nextfile'. However, it doesn't allow the +`nextfile' statement inside function bodies (*note User-defined::). +`gawk' does; a `nextfile' inside a function body reads the next record +and starts processing it with the first rule in the program, just as +any other `nextfile' statement. + + *Caution:* Versions of `gawk' prior to 3.0 used two words (`next +file') for the `nextfile' statement. In version 3.0, this was changed +to one word, because the treatment of `file' was inconsistent. When it +appeared after `next', `file' was a keyword; otherwise, it was a +regular identifier. The old usage is no longer accepted; `next file' +generates a syntax error. + + +File: gawk.info, Node: Exit Statement, Prev: Nextfile Statement, Up: Statements + +6.4.10 The `exit' Statement +--------------------------- + +The `exit' statement causes `awk' to immediately stop executing the +current rule and to stop processing input; any remaining input is +ignored. The `exit' statement is written as follows: + + exit [RETURN CODE] + + When an `exit' statement is executed from a `BEGIN' rule, the +program stops processing everything immediately. No input records are +read. However, if an `END' rule is present, as part of executing the +`exit' statement, the `END' rule is executed (*note BEGIN/END::). If +`exit' is used as part of an `END' rule, it causes the program to stop +immediately. + + An `exit' statement that is not part of a `BEGIN' or `END' rule +stops the execution of any further automatic rules for the current +record, skips reading any remaining input records, and executes the +`END' rule if there is one. + + In such a case, if you don't want the `END' rule to do its job, set +a variable to nonzero before the `exit' statement and check that +variable in the `END' rule. *Note Assert Function::, for an example +that does this. + + If an argument is supplied to `exit', its value is used as the exit +status code for the `awk' process. If no argument is supplied, `exit' +returns status zero (success). In the case where an argument is +supplied to a first `exit' statement, and then `exit' is called a +second time from an `END' rule with no argument, `awk' uses the +previously supplied exit value. (d.c.) + + For example, suppose an error condition occurs that is difficult or +impossible to handle. Conventionally, programs report this by exiting +with a nonzero status. An `awk' program can do this using an `exit' +statement with a nonzero argument, as shown in the following example: + + BEGIN { + if (("date" | getline date_now) <= 0) { + print "Can't get system date" > "/dev/stderr" + exit 1 + } + print "current date is", date_now + close("date") + } + + +File: gawk.info, Node: Built-in Variables, Prev: Statements, Up: Patterns and Actions + +6.5 Built-in Variables +====================== + +Most `awk' variables are available to use for your own purposes; they +never change unless your program assigns values to them, and they never +affect anything unless your program examines them. However, a few +variables in `awk' have special built-in meanings. `awk' examines some +of these automatically, so that they enable you to tell `awk' how to do +certain things. Others are set automatically by `awk', so that they +carry information from the internal workings of `awk' to your program. + + This minor node documents all the built-in variables of `gawk', most +of which are also documented in the chapters describing their areas of +activity. + +* Menu: + +* User-modified:: Built-in variables that you change to control + `awk'. +* Auto-set:: Built-in variables where `awk' gives + you information. +* ARGC and ARGV:: Ways to use `ARGC' and `ARGV'. + + +File: gawk.info, Node: User-modified, Next: Auto-set, Up: Built-in Variables + +6.5.1 Built-in Variables That Control `awk' +------------------------------------------- + +The following is an alphabetical list of variables that you can change +to control how `awk' does certain things. The variables that are +specific to `gawk' are marked with a pound sign (`#'). + +`BINMODE #' + On non-POSIX systems, this variable specifies use of binary mode + for all I/O. Numeric values of one, two, or three specify that + input files, output files, or all files, respectively, should use + binary I/O. Alternatively, string values of `"r"' or `"w"' + specify that input files and output files, respectively, should + use binary I/O. A string value of `"rw"' or `"wr"' indicates that + all files should use binary I/O. Any other string value is + equivalent to `"rw"', but `gawk' generates a warning message. + `BINMODE' is described in more detail in *note PC Using::. + + This variable is a `gawk' extension. In other `awk' + implementations (except `mawk', *note Other Versions::), or if + `gawk' is in compatibility mode (*note Options::), it is not + special. + +`CONVFMT' + This string controls conversion of numbers to strings (*note + Conversion::). It works by being passed, in effect, as the first + argument to the `sprintf' function (*note String Functions::). + Its default value is `"%.6g"'. `CONVFMT' was introduced by the + POSIX standard. + +`FIELDWIDTHS #' + This is a space-separated list of columns that tells `gawk' how to + split input with fixed columnar boundaries. Assigning a value to + `FIELDWIDTHS' overrides the use of `FS' for field splitting. + *Note Constant Size::, for more information. + + If `gawk' is in compatibility mode (*note Options::), then + `FIELDWIDTHS' has no special meaning, and field-splitting + operations occur based exclusively on the value of `FS'. + +`FS' + This is the input field separator (*note Field Separators::). The + value is a single-character string or a multi-character regular + expression that matches the separations between fields in an input + record. If the value is the null string (`""'), then each + character in the record becomes a separate field. (This behavior + is a `gawk' extension. POSIX `awk' does not specify the behavior + when `FS' is the null string.) + + The default value is `" "', a string consisting of a single space. + As a special exception, this value means that any sequence of + spaces, tabs, and/or newlines is a single separator.(1) It also + causes spaces, tabs, and newlines at the beginning and end of a + record to be ignored. + + You can set the value of `FS' on the command line using the `-F' + option: + + awk -F, 'PROGRAM' INPUT-FILES + + If `gawk' is using `FIELDWIDTHS' for field splitting, assigning a + value to `FS' causes `gawk' to return to the normal, `FS'-based + field splitting. An easy way to do this is to simply say `FS = + FS', perhaps with an explanatory comment. + +`IGNORECASE #' + If `IGNORECASE' is nonzero or non-null, then all string comparisons + and all regular expression matching are case independent. Thus, + regexp matching with `~' and `!~', as well as the `gensub', + `gsub', `index', `match', `split', and `sub' functions, record + termination with `RS', and field splitting with `FS', all ignore + case when doing their particular regexp operations. However, the + value of `IGNORECASE' does _not_ affect array subscripting and it + does not affect field splitting when using a single-character + field separator. *Note Case-sensitivity::. + + If `gawk' is in compatibility mode (*note Options::), then + `IGNORECASE' has no special meaning. Thus, string and regexp + operations are always case-sensitive. + +`LINT #' + When this variable is true (nonzero or non-null), `gawk' behaves + as if the `--lint' command-line option is in effect. (*note + Options::). With a value of `"fatal"', lint warnings become fatal + errors. With a value of `"invalid"', only warnings about things + that are actually invalid are issued. (This is not fully + implemented yet.) Any other true value prints nonfatal warnings. + Assigning a false value to `LINT' turns off the lint warnings. + + This variable is a `gawk' extension. It is not special in other + `awk' implementations. Unlike the other special variables, + changing `LINT' does affect the production of lint warnings, even + if `gawk' is in compatibility mode. Much as the `--lint' and + `--traditional' options independently control different aspects of + `gawk''s behavior, the control of lint warnings during program + execution is independent of the flavor of `awk' being executed. + +`OFMT' + This string controls conversion of numbers to strings (*note + Conversion::) for printing with the `print' statement. It works + by being passed as the first argument to the `sprintf' function + (*note String Functions::). Its default value is `"%.6g"'. + Earlier versions of `awk' also used `OFMT' to specify the format + for converting numbers to strings in general expressions; this is + now done by `CONVFMT'. + +`OFS' + This is the output field separator (*note Output Separators::). + It is output between the fields printed by a `print' statement. + Its default value is `" "', a string consisting of a single space. + +`ORS' + This is the output record separator. It is output at the end of + every `print' statement. Its default value is `"\n"', the newline + character. (*Note Output Separators::.) + +`RS' + This is `awk''s input record separator. Its default value is a + string containing a single newline character, which means that an + input record consists of a single line of text. It can also be + the null string, in which case records are separated by runs of + blank lines. If it is a regexp, records are separated by matches + of the regexp in the input text. (*Note Records::.) + + The ability for `RS' to be a regular expression is a `gawk' + extension. In most other `awk' implementations, or if `gawk' is + in compatibility mode (*note Options::), just the first character + of `RS''s value is used. + +`SUBSEP' + This is the subscript separator. It has the default value of + `"\034"' and is used to separate the parts of the indices of a + multidimensional array. Thus, the expression `foo["A", "B"]' + really accesses `foo["A\034B"]' (*note Multi-dimensional::). + +`TEXTDOMAIN #' + This variable is used for internationalization of programs at the + `awk' level. It sets the default text domain for specially marked + string constants in the source text, as well as for the + `dcgettext', `dcngettext' and `bindtextdomain' functions (*note + Internationalization::). The default value of `TEXTDOMAIN' is + `"messages"'. + + This variable is a `gawk' extension. In other `awk' + implementations, or if `gawk' is in compatibility mode (*note + Options::), it is not special. + + ---------- Footnotes ---------- + + (1) In POSIX `awk', newline does not count as whitespace. + + +File: gawk.info, Node: Auto-set, Next: ARGC and ARGV, Prev: User-modified, Up: Built-in Variables + +6.5.2 Built-in Variables That Convey Information +------------------------------------------------ + +The following is an alphabetical list of variables that `awk' sets +automatically on certain occasions in order to provide information to +your program. The variables that are specific to `gawk' are marked +with a pound sign (`#'). + +`ARGC, ARGV' + The command-line arguments available to `awk' programs are stored + in an array called `ARGV'. `ARGC' is the number of command-line + arguments present. *Note Other Arguments::. Unlike most `awk' + arrays, `ARGV' is indexed from 0 to `ARGC' - 1. In the following + example: + + $ awk 'BEGIN { + > for (i = 0; i < ARGC; i++) + > print ARGV[i] + > }' inventory-shipped BBS-list + -| awk + -| inventory-shipped + -| BBS-list + + `ARGV[0]' contains `"awk"', `ARGV[1]' contains + `"inventory-shipped"', and `ARGV[2]' contains `"BBS-list"'. The + value of `ARGC' is three, one more than the index of the last + element in `ARGV', because the elements are numbered from zero. + + The names `ARGC' and `ARGV', as well as the convention of indexing + the array from 0 to `ARGC' - 1, are derived from the C language's + method of accessing command-line arguments. + + The value of `ARGV[0]' can vary from system to system. Also, you + should note that the program text is _not_ included in `ARGV', nor + are any of `awk''s command-line options. *Note ARGC and ARGV::, + for information about how `awk' uses these variables. + +`ARGIND #' + The index in `ARGV' of the current file being processed. Every + time `gawk' opens a new data file for processing, it sets `ARGIND' + to the index in `ARGV' of the file name. When `gawk' is + processing the input files, `FILENAME == ARGV[ARGIND]' is always + true. + + This variable is useful in file processing; it allows you to tell + how far along you are in the list of data files as well as to + distinguish between successive instances of the same file name on + the command line. + + While you can change the value of `ARGIND' within your `awk' + program, `gawk' automatically sets it to a new value when the next + file is opened. + + This variable is a `gawk' extension. In other `awk' + implementations, or if `gawk' is in compatibility mode (*note + Options::), it is not special. + +`ENVIRON' + An associative array that contains the values of the environment. + The array indices are the environment variable names; the elements + are the values of the particular environment variables. For + example, `ENVIRON["HOME"]' might be `/home/arnold'. Changing this + array does not affect the environment passed on to any programs + that `awk' may spawn via redirection or the `system' function. + + Some operating systems may not have environment variables. On + such systems, the `ENVIRON' array is empty (except for + `ENVIRON["AWKPATH"]', *note AWKPATH Variable::). + +`ERRNO #' + If a system error occurs during a redirection for `getline', + during a read for `getline', or during a `close' operation, then + `ERRNO' contains a string describing the error. + + `ERRNO' works similarly to the C variable `errno'. In particular + `gawk' _never_ clears it (sets it to zero or `""'). Thus, you + should only expect its value to be meaningful when an I/O + operation returns a failure value, such as `getline' returning -1. + You are, of course, free to clear it yourself before doing an I/O + operation. + + This variable is a `gawk' extension. In other `awk' + implementations, or if `gawk' is in compatibility mode (*note + Options::), it is not special. + +`FILENAME' + The name of the file that `awk' is currently reading. When no + data files are listed on the command line, `awk' reads from the + standard input and `FILENAME' is set to `"-"'. `FILENAME' is + changed each time a new file is read (*note Reading Files::). + Inside a `BEGIN' rule, the value of `FILENAME' is `""', since + there are no input files being processed yet.(1) (d.c.) Note, + though, that using `getline' (*note Getline::) inside a `BEGIN' + rule can give `FILENAME' a value. + +`FNR' + The current record number in the current file. `FNR' is + incremented each time a new record is read (*note Getline::). It + is reinitialized to zero each time a new input file is started. + +`NF' + The number of fields in the current input record. `NF' is set + each time a new record is read, when a new field is created or + when `$0' changes (*note Fields::). + + Unlike most of the variables described in this node, assigning a + value to `NF' has the potential to affect `awk''s internal + workings. In particular, assignments to `NF' can be used to + create or remove fields from the current record: *Note Changing + Fields::. + +`NR' + The number of input records `awk' has processed since the + beginning of the program's execution (*note Records::). `NR' is + incremented each time a new record is read. + +`PROCINFO #' + The elements of this array provide access to information about the + running `awk' program. The following elements (listed + alphabetically) are guaranteed to be available: + + `PROCINFO["egid"]' + The value of the `getegid' system call. + + `PROCINFO["euid"]' + The value of the `geteuid' system call. + + `PROCINFO["FS"]' + This is `"FS"' if field splitting with `FS' is in effect, or + it is `"FIELDWIDTHS"' if field splitting with `FIELDWIDTHS' + is in effect. + + `PROCINFO["gid"]' + The value of the `getgid' system call. + + `PROCINFO["pgrpid"]' + The process group ID of the current process. + + `PROCINFO["pid"]' + The process ID of the current process. + + `PROCINFO["ppid"]' + The parent process ID of the current process. + + `PROCINFO["uid"]' + The value of the `getuid' system call. + + `PROCINFO["version"]' + The version of `gawk'. This is available from version 3.1.4 + and later. + + On some systems, there may be elements in the array, `"group1"' + through `"groupN"' for some N. N is the number of supplementary + groups that the process has. Use the `in' operator to test for + these elements (*note Reference to Elements::). + + This array is a `gawk' extension. In other `awk' implementations, + or if `gawk' is in compatibility mode (*note Options::), it is not + special. + +`RLENGTH' + The length of the substring matched by the `match' function (*note + String Functions::). `RLENGTH' is set by invoking the `match' + function. Its value is the length of the matched string, or -1 if + no match is found. + +`RSTART' + The start-index in characters of the substring that is matched by + the `match' function (*note String Functions::). `RSTART' is set + by invoking the `match' function. Its value is the position of + the string where the matched substring starts, or zero if no match + was found. + +`RT #' + This is set each time a record is read. It contains the input text + that matched the text denoted by `RS', the record separator. + + This variable is a `gawk' extension. In other `awk' + implementations, or if `gawk' is in compatibility mode (*note + Options::), it is not special. + +Advanced Notes: Changing `NR' and `FNR' +--------------------------------------- + +`awk' increments `NR' and `FNR' each time it reads a record, instead of +setting them to the absolute value of the number of records read. This +means that a program can change these variables and their new values +are incremented for each record. (d.c.) This is demonstrated in the +following example: + + $ echo '1 + > 2 + > 3 + > 4' | awk 'NR == 2 { NR = 17 } + > { print NR }' + -| 1 + -| 17 + -| 18 + -| 19 + +Before `FNR' was added to the `awk' language (*note V7/SVR3.1::), many +`awk' programs used this feature to track the number of records in a +file by resetting `NR' to zero when `FILENAME' changed. + + ---------- Footnotes ---------- + + (1) Some early implementations of Unix `awk' initialized `FILENAME' +to `"-"', even if there were data files to be processed. This behavior +was incorrect and should not be relied upon in your programs. + + +File: gawk.info, Node: ARGC and ARGV, Prev: Auto-set, Up: Built-in Variables + +6.5.3 Using `ARGC' and `ARGV' +----------------------------- + +*note Auto-set::, presented the following program describing the +information contained in `ARGC' and `ARGV': + + $ awk 'BEGIN { + > for (i = 0; i < ARGC; i++) + > print ARGV[i] + > }' inventory-shipped BBS-list + -| awk + -| inventory-shipped + -| BBS-list + +In this example, `ARGV[0]' contains `awk', `ARGV[1]' contains +`inventory-shipped', and `ARGV[2]' contains `BBS-list'. Notice that +the `awk' program is not entered in `ARGV'. The other special +command-line options, with their arguments, are also not entered. This +includes variable assignments done with the `-v' option (*note +Options::). Normal variable assignments on the command line _are_ +treated as arguments and do show up in the `ARGV' array: + + $ cat showargs.awk + -| BEGIN { + -| printf "A=%d, B=%d\n", A, B + -| for (i = 0; i < ARGC; i++) + -| printf "\tARGV[%d] = %s\n", i, ARGV[i] + -| } + -| END { printf "A=%d, B=%d\n", A, B } + $ awk -v A=1 -f showargs.awk B=2 /dev/null + -| A=1, B=0 + -| ARGV[0] = awk + -| ARGV[1] = B=2 + -| ARGV[2] = /dev/null + -| A=1, B=2 + + A program can alter `ARGC' and the elements of `ARGV'. Each time +`awk' reaches the end of an input file, it uses the next element of +`ARGV' as the name of the next input file. By storing a different +string there, a program can change which files are read. Use `"-"' to +represent the standard input. Storing additional elements and +incrementing `ARGC' causes additional files to be read. + + If the value of `ARGC' is decreased, that eliminates input files +from the end of the list. By recording the old value of `ARGC' +elsewhere, a program can treat the eliminated arguments as something +other than file names. + + To eliminate a file from the middle of the list, store the null +string (`""') into `ARGV' in place of the file's name. As a special +feature, `awk' ignores file names that have been replaced with the null +string. Another option is to use the `delete' statement to remove +elements from `ARGV' (*note Delete::). + + All of these actions are typically done in the `BEGIN' rule, before +actual processing of the input begins. *Note Split Program::, and see +*note Tee Program::, for examples of each way of removing elements from +`ARGV'. The following fragment processes `ARGV' in order to examine, +and then remove, command-line options: + + BEGIN { + for (i = 1; i < ARGC; i++) { + if (ARGV[i] == "-v") + verbose = 1 + else if (ARGV[i] == "-d") + debug = 1 + else if (ARGV[i] ~ /^-./) { + e = sprintf("%s: unrecognized option -- %c", + ARGV[0], substr(ARGV[i], 2, 1)) + print e > "/dev/stderr" + } else + break + delete ARGV[i] + } + } + + To actually get the options into the `awk' program, end the `awk' +options with `--' and then supply the `awk' program's options, in the +following manner: + + awk -f myprog -- -v -d file1 file2 ... + + This is not necessary in `gawk'. Unless `--posix' has been +specified, `gawk' silently puts any unrecognized options into `ARGV' +for the `awk' program to deal with. As soon as it sees an unknown +option, `gawk' stops looking for other options that it might otherwise +recognize. The previous example with `gawk' would be: + + gawk -f myprog -d -v file1 file2 ... + +Because `-d' is not a valid `gawk' option, it and the following `-v' +are passed on to the `awk' program. + + +File: gawk.info, Node: Arrays, Next: Functions, Prev: Patterns and Actions, Up: Top + +7 Arrays in `awk' +***************** + +An "array" is a table of values called "elements". The elements of an +array are distinguished by their indices. "Indices" may be either +numbers or strings. + + This major node describes how arrays work in `awk', how to use array +elements, how to scan through every element in an array, and how to +remove array elements. It also describes how `awk' simulates +multidimensional arrays, as well as some of the less obvious points +about array usage. The major node finishes with a discussion of +`gawk''s facility for sorting an array based on its indices. + + `awk' maintains a single set of names that may be used for naming +variables, arrays, and functions (*note User-defined::). Thus, you +cannot have a variable and an array with the same name in the same +`awk' program. + +* Menu: + +* Array Intro:: Introduction to Arrays +* Reference to Elements:: How to examine one element of an array. +* Assigning Elements:: How to change an element of an array. +* Array Example:: Basic Example of an Array +* Scanning an Array:: A variation of the `for' statement. It + loops through the indices of an array's + existing elements. +* Delete:: The `delete' statement removes an element + from an array. +* Numeric Array Subscripts:: How to use numbers as subscripts in + `awk'. +* Uninitialized Subscripts:: Using Uninitialized variables as subscripts. +* Multi-dimensional:: Emulating multidimensional arrays in + `awk'. +* Multi-scanning:: Scanning multidimensional arrays. +* Array Sorting:: Sorting array values and indices. + + +File: gawk.info, Node: Array Intro, Next: Reference to Elements, Up: Arrays + +7.1 Introduction to Arrays +========================== + +The `awk' language provides one-dimensional arrays for storing groups +of related strings or numbers. Every `awk' array must have a name. +Array names have the same syntax as variable names; any valid variable +name would also be a valid array name. But one name cannot be used in +both ways (as an array and as a variable) in the same `awk' program. + + Arrays in `awk' superficially resemble arrays in other programming +languages, but there are fundamental differences. In `awk', it isn't +necessary to specify the size of an array before starting to use it. +Additionally, any number or string in `awk', not just consecutive +integers, may be used as an array index. + + In most other languages, arrays must be "declared" before use, +including a specification of how many elements or components they +contain. In such languages, the declaration causes a contiguous block +of memory to be allocated for that many elements. Usually, an index in +the array must be a positive integer. For example, the index zero +specifies the first element in the array, which is actually stored at +the beginning of the block of memory. Index one specifies the second +element, which is stored in memory right after the first element, and +so on. It is impossible to add more elements to the array, because it +has room only for as many elements as given in the declaration. (Some +languages allow arbitrary starting and ending indices--e.g., `15 .. +27'--but the size of the array is still fixed when the array is +declared.) + + A contiguous array of four elements might look like the following +example, conceptually, if the element values are 8, `"foo"', `""', and +30: + + +---------+---------+--------+---------+ + | 8 | "foo" | "" | 30 | Value + +---------+---------+--------+---------+ + 0 1 2 3 Index + +Only the values are stored; the indices are implicit from the order of +the values. Here, 8 is the value at index zero, because 8 appears in the +position with zero elements before it. + + Arrays in `awk' are different--they are "associative". This means +that each array is a collection of pairs: an index and its corresponding +array element value: + + Element 3 Value 30 + Element 1 Value "foo" + Element 0 Value 8 + Element 2 Value "" + +The pairs are shown in jumbled order because their order is irrelevant. + + One advantage of associative arrays is that new pairs can be added +at any time. For example, suppose a tenth element is added to the array +whose value is `"number ten"'. The result is: + + Element 10 Value "number ten" + Element 3 Value 30 + Element 1 Value "foo" + Element 0 Value 8 + Element 2 Value "" + +Now the array is "sparse", which just means some indices are missing. +It has elements 0-3 and 10, but doesn't have elements 4, 5, 6, 7, 8, or +9. + + Another consequence of associative arrays is that the indices don't +have to be positive integers. Any number, or even a string, can be an +index. For example, the following is an array that translates words +from English to French: + + Element "dog" Value "chien" + Element "cat" Value "chat" + Element "one" Value "un" + Element 1 Value "un" + +Here we decided to translate the number one in both spelled-out and +numeric form--thus illustrating that a single array can have both +numbers and strings as indices. In fact, array subscripts are always +strings; this is discussed in more detail in *note Numeric Array +Subscripts::. Here, the number `1' isn't double-quoted, since `awk' +automatically converts it to a string. + + The value of `IGNORECASE' has no effect upon array subscripting. +The identical string value used to store an array element must be used +to retrieve it. When `awk' creates an array (e.g., with the `split' +built-in function), that array's indices are consecutive integers +starting at one. (*Note String Functions::.) + + `awk''s arrays are efficient--the time to access an element is +independent of the number of elements in the array. + + +File: gawk.info, Node: Reference to Elements, Next: Assigning Elements, Prev: Array Intro, Up: Arrays + +7.2 Referring to an Array Element +================================= + +The principal way to use an array is to refer to one of its elements. +An array reference is an expression as follows: + + ARRAY[INDEX] + +Here, ARRAY is the name of an array. The expression INDEX is the index +of the desired element of the array. + + The value of the array reference is the current value of that array +element. For example, `foo[4.3]' is an expression for the element of +array `foo' at index `4.3'. + + A reference to an array element that has no recorded value yields a +value of `""', the null string. This includes elements that have not +been assigned any value as well as elements that have been deleted +(*note Delete::). Such a reference automatically creates that array +element, with the null string as its value. (In some cases, this is +unfortunate, because it might waste memory inside `awk'.) + + To determine whether an element exists in an array at a certain +index, use the following expression: + + INDEX in ARRAY + +This expression tests whether the particular index exists, without the +side effect of creating that element if it is not present. The +expression has the value one (true) if `ARRAY[INDEX]' exists and zero +(false) if it does not exist. For example, this statement tests +whether the array `frequencies' contains the index `2': + + if (2 in frequencies) + print "Subscript 2 is present." + + Note that this is _not_ a test of whether the array `frequencies' +contains an element whose _value_ is two. There is no way to do that +except to scan all the elements. Also, this _does not_ create +`frequencies[2]', while the following (incorrect) alternative does: + + if (frequencies[2] != "") + print "Subscript 2 is present." + + +File: gawk.info, Node: Assigning Elements, Next: Array Example, Prev: Reference to Elements, Up: Arrays + +7.3 Assigning Array Elements +============================ + +Array elements can be assigned values just like `awk' variables: + + ARRAY[SUBSCRIPT] = VALUE + +ARRAY is the name of an array. The expression SUBSCRIPT is the index +of the element of the array that is assigned a value. The expression +VALUE is the value to assign to that element of the array. + + +File: gawk.info, Node: Array Example, Next: Scanning an Array, Prev: Assigning Elements, Up: Arrays + +7.4 Basic Array Example +======================= + +The following program takes a list of lines, each beginning with a line +number, and prints them out in order of line number. The line numbers +are not in order when they are first read--instead they are scrambled. +This program sorts the lines by making an array using the line numbers +as subscripts. The program then prints out the lines in sorted order +of their numbers. It is a very simple program and gets confused upon +encountering repeated numbers, gaps, or lines that don't begin with a +number: + + { + if ($1 > max) + max = $1 + arr[$1] = $0 + } + + END { + for (x = 1; x <= max; x++) + print arr[x] + } + + The first rule keeps track of the largest line number seen so far; +it also stores each line into the array `arr', at an index that is the +line's number. The second rule runs after all the input has been read, +to print out all the lines. When this program is run with the +following input: + + 5 I am the Five man + 2 Who are you? The new number two! + 4 . . . And four on the floor + 1 Who is number one? + 3 I three you. + +Its output is: + + 1 Who is number one? + 2 Who are you? The new number two! + 3 I three you. + 4 . . . And four on the floor + 5 I am the Five man + + If a line number is repeated, the last line with a given number +overrides the others. Gaps in the line numbers can be handled with an +easy improvement to the program's `END' rule, as follows: + + END { + for (x = 1; x <= max; x++) + if (x in arr) + print arr[x] + } + + +File: gawk.info, Node: Scanning an Array, Next: Delete, Prev: Array Example, Up: Arrays + +7.5 Scanning All Elements of an Array +===================================== + +In programs that use arrays, it is often necessary to use a loop that +executes once for each element of an array. In other languages, where +arrays are contiguous and indices are limited to positive integers, +this is easy: all the valid indices can be found by counting from the +lowest index up to the highest. This technique won't do the job in +`awk', because any number or string can be an array index. So `awk' +has a special kind of `for' statement for scanning an array: + + for (VAR in ARRAY) + BODY + +This loop executes BODY once for each index in ARRAY that the program +has previously used, with the variable VAR set to that index. + + The following program uses this form of the `for' statement. The +first rule scans the input records and notes which words appear (at +least once) in the input, by storing a one into the array `used' with +the word as index. The second rule scans the elements of `used' to +find all the distinct words that appear in the input. It prints each +word that is more than 10 characters long and also prints the number of +such words. *Note String Functions::, for more information on the +built-in function `length'. + + # Record a 1 for each word that is used at least once + { + for (i = 1; i <= NF; i++) + used[$i] = 1 + } + + # Find number of distinct words more than 10 characters long + END { + for (x in used) + if (length(x) > 10) { + ++num_long_words + print x + } + print num_long_words, "words longer than 10 characters" + } + +*Note Word Sorting::, for a more detailed example of this type. + + The order in which elements of the array are accessed by this +statement is determined by the internal arrangement of the array +elements within `awk' and cannot be controlled or changed. This can +lead to problems if new elements are added to ARRAY by statements in +the loop body; it is not predictable whether the `for' loop will reach +them. Similarly, changing VAR inside the loop may produce strange +results. It is best to avoid such things. + + +File: gawk.info, Node: Delete, Next: Numeric Array Subscripts, Prev: Scanning an Array, Up: Arrays + +7.6 The `delete' Statement +========================== + +To remove an individual element of an array, use the `delete' statement: + + delete ARRAY[INDEX] + + Once an array element has been deleted, any value the element once +had is no longer available. It is as if the element had never been +referred to or had been given a value. The following is an example of +deleting elements in an array: + + for (i in frequencies) + delete frequencies[i] + +This example removes all the elements from the array `frequencies'. +Once an element is deleted, a subsequent `for' statement to scan the +array does not report that element and the `in' operator to check for +the presence of that element returns zero (i.e., false): + + delete foo[4] + if (4 in foo) + print "This will never be printed" + + It is important to note that deleting an element is _not_ the same +as assigning it a null value (the empty string, `""'). For example: + + foo[4] = "" + if (4 in foo) + print "This is printed, even though foo[4] is empty" + + It is not an error to delete an element that does not exist. If +`--lint' is provided on the command line (*note Options::), `gawk' +issues a warning message when an element that is not in the array is +deleted. + + All the elements of an array may be deleted with a single statement +by leaving off the subscript in the `delete' statement, as follows: + + delete ARRAY + + This ability is a `gawk' extension; it is not available in +compatibility mode (*note Options::). + + Using this version of the `delete' statement is about three times +more efficient than the equivalent loop that deletes each element one +at a time. + + The following statement provides a portable but nonobvious way to +clear out an array:(1) + + split("", array) + + The `split' function (*note String Functions::) clears out the +target array first. This call asks it to split apart the null string. +Because there is no data to split out, the function simply clears the +array and then returns. + + *Caution:* Deleting an array does not change its type; you cannot +delete an array and then use the array's name as a scalar (i.e., a +regular variable). For example, the following does not work: + + a[1] = 3; delete a; a = 3 + + ---------- Footnotes ---------- + + (1) Thanks to Michael Brennan for pointing this out. + + +File: gawk.info, Node: Numeric Array Subscripts, Next: Uninitialized Subscripts, Prev: Delete, Up: Arrays + +7.7 Using Numbers to Subscript Arrays +===================================== + +An important aspect about arrays to remember is that _array subscripts +are always strings_. When a numeric value is used as a subscript, it +is converted to a string value before being used for subscripting +(*note Conversion::). This means that the value of the built-in +variable `CONVFMT' can affect how your program accesses elements of an +array. For example: + + xyz = 12.153 + data[xyz] = 1 + CONVFMT = "%2.2f" + if (xyz in data) + printf "%s is in data\n", xyz + else + printf "%s is not in data\n", xyz + +This prints `12.15 is not in data'. The first statement gives `xyz' a +numeric value. Assigning to `data[xyz]' subscripts `data' with the +string value `"12.153"' (using the default conversion value of +`CONVFMT', `"%.6g"'). Thus, the array element `data["12.153"]' is +assigned the value one. The program then changes the value of +`CONVFMT'. The test `(xyz in data)' generates a new string value from +`xyz'--this time `"12.15"'--because the value of `CONVFMT' only allows +two significant digits. This test fails, since `"12.15"' is a +different string from `"12.153"'. + + According to the rules for conversions (*note Conversion::), integer +values are always converted to strings as integers, no matter what the +value of `CONVFMT' may happen to be. So the usual case of the +following works: + + for (i = 1; i <= maxsub; i++) + do something with array[i] + + The "integer values always convert to strings as integers" rule has +an additional consequence for array indexing. Octal and hexadecimal +constants (*note Nondecimal-numbers::) are converted internally into +numbers, and their original form is forgotten. This means, for +example, that `array[17]', `array[021]', and `array[0x11]' all refer to +the same element! + + As with many things in `awk', the majority of the time things work +as one would expect them to. But it is useful to have a precise +knowledge of the actual rules which sometimes can have a subtle effect +on your programs. + + +File: gawk.info, Node: Uninitialized Subscripts, Next: Multi-dimensional, Prev: Numeric Array Subscripts, Up: Arrays + +7.8 Using Uninitialized Variables as Subscripts +=============================================== + +Suppose it's necessary to write a program to print the input data in +reverse order. A reasonable attempt to do so (with some test data) +might look like this: + + $ echo 'line 1 + > line 2 + > line 3' | awk '{ l[lines] = $0; ++lines } + > END { + > for (i = lines-1; i >= 0; --i) + > print l[i] + > }' + -| line 3 + -| line 2 + + Unfortunately, the very first line of input data did not come out in +the output! + + At first glance, this program should have worked. The variable +`lines' is uninitialized, and uninitialized variables have the numeric +value zero. So, `awk' should have printed the value of `l[0]'. + + The issue here is that subscripts for `awk' arrays are _always_ +strings. Uninitialized variables, when used as strings, have the value +`""', not zero. Thus, `line 1' ends up stored in `l[""]'. The +following version of the program works correctly: + + { l[lines++] = $0 } + END { + for (i = lines - 1; i >= 0; --i) + print l[i] + } + + Here, the `++' forces `lines' to be numeric, thus making the "old +value" numeric zero. This is then converted to `"0"' as the array +subscript. + + Even though it is somewhat unusual, the null string (`""') is a +valid array subscript. (d.c.) `gawk' warns about the use of the null +string as a subscript if `--lint' is provided on the command line +(*note Options::). + + +File: gawk.info, Node: Multi-dimensional, Next: Multi-scanning, Prev: Uninitialized Subscripts, Up: Arrays + +7.9 Multidimensional Arrays +=========================== + +A multidimensional array is an array in which an element is identified +by a sequence of indices instead of a single index. For example, a +two-dimensional array requires two indices. The usual way (in most +languages, including `awk') to refer to an element of a two-dimensional +array named `grid' is with `grid[X,Y]'. + + Multidimensional arrays are supported in `awk' through concatenation +of indices into one string. `awk' converts the indices into strings +(*note Conversion::) and concatenates them together, with a separator +between them. This creates a single string that describes the values +of the separate indices. The combined string is used as a single index +into an ordinary, one-dimensional array. The separator used is the +value of the built-in variable `SUBSEP'. + + For example, suppose we evaluate the expression `foo[5,12] = "value"' +when the value of `SUBSEP' is `"@"'. The numbers 5 and 12 are +converted to strings and concatenated with an `@' between them, +yielding `"5@12"'; thus, the array element `foo["5@12"]' is set to +`"value"'. + + Once the element's value is stored, `awk' has no record of whether +it was stored with a single index or a sequence of indices. The two +expressions `foo[5,12]' and `foo[5 SUBSEP 12]' are always equivalent. + + The default value of `SUBSEP' is the string `"\034"', which contains +a nonprinting character that is unlikely to appear in an `awk' program +or in most input data. The usefulness of choosing an unlikely +character comes from the fact that index values that contain a string +matching `SUBSEP' can lead to combined strings that are ambiguous. +Suppose that `SUBSEP' is `"@"'; then `foo["a@b", "c"]' and +`foo["a", "b@c"]' are indistinguishable because both are actually +stored as `foo["a@b@c"]'. + + To test whether a particular index sequence exists in a +multidimensional array, use the same operator (`in') that is used for +single dimensional arrays. Write the whole sequence of indices in +parentheses, separated by commas, as the left operand: + + (SUBSCRIPT1, SUBSCRIPT2, ...) in ARRAY + + The following example treats its input as a two-dimensional array of +fields; it rotates this array 90 degrees clockwise and prints the +result. It assumes that all lines have the same number of elements: + + { + if (max_nf < NF) + max_nf = NF + max_nr = NR + for (x = 1; x <= NF; x++) + vector[x, NR] = $x + } + + END { + for (x = 1; x <= max_nf; x++) { + for (y = max_nr; y >= 1; --y) + printf("%s ", vector[x, y]) + printf("\n") + } + } + +When given the input: + + 1 2 3 4 5 6 + 2 3 4 5 6 1 + 3 4 5 6 1 2 + 4 5 6 1 2 3 + +the program produces the following output: + + 4 3 2 1 + 5 4 3 2 + 6 5 4 3 + 1 6 5 4 + 2 1 6 5 + 3 2 1 6 + + +File: gawk.info, Node: Multi-scanning, Next: Array Sorting, Prev: Multi-dimensional, Up: Arrays + +7.10 Scanning Multidimensional Arrays +===================================== + +There is no special `for' statement for scanning a "multidimensional" +array. There cannot be one, because, in truth, there are no +multidimensional arrays or elements--there is only a multidimensional +_way of accessing_ an array. + + However, if your program has an array that is always accessed as +multidimensional, you can get the effect of scanning it by combining +the scanning `for' statement (*note Scanning an Array::) with the +built-in `split' function (*note String Functions::). It works in the +following manner: + + for (combined in array) { + split(combined, separate, SUBSEP) + ... + } + +This sets the variable `combined' to each concatenated combined index +in the array, and splits it into the individual indices by breaking it +apart where the value of `SUBSEP' appears. The individual indices then +become the elements of the array `separate'. + + Thus, if a value is previously stored in `array[1, "foo"]'; then an +element with index `"1\034foo"' exists in `array'. (Recall that the +default value of `SUBSEP' is the character with code 034.) Sooner or +later, the `for' statement finds that index and does an iteration with +the variable `combined' set to `"1\034foo"'. Then the `split' function +is called as follows: + + split("1\034foo", separate, "\034") + +The result is to set `separate[1]' to `"1"' and `separate[2]' to +`"foo"'. Presto! The original sequence of separate indices is +recovered. + + +File: gawk.info, Node: Array Sorting, Prev: Multi-scanning, Up: Arrays + +7.11 Sorting Array Values and Indices with `gawk' +================================================= + +The order in which an array is scanned with a `for (i in array)' loop +is essentially arbitrary. In most `awk' implementations, sorting an +array requires writing a `sort' function. While this can be +educational for exploring different sorting algorithms, usually that's +not the point of the program. `gawk' provides the built-in `asort' and +`asorti' functions (*note String Functions::) for sorting arrays. For +example: + + POPULATE THE ARRAY data + n = asort(data) + for (i = 1; i <= n; i++) + DO SOMETHING WITH data[i] + + After the call to `asort', the array `data' is indexed from 1 to +some number N, the total number of elements in `data'. (This count is +`asort''s return value.) `data[1]' <= `data[2]' <= `data[3]', and so +on. The comparison of array elements is done using `gawk''s usual +comparison rules (*note Typing and Comparison::). + + An important side effect of calling `asort' is that _the array's +original indices are irrevocably lost_. As this isn't always +desirable, `asort' accepts a second argument: + + POPULATE THE ARRAY source + n = asort(source, dest) + for (i = 1; i <= n; i++) + DO SOMETHING WITH dest[i] + + In this case, `gawk' copies the `source' array into the `dest' array +and then sorts `dest', destroying its indices. However, the `source' +array is not affected. + + Often, what's needed is to sort on the values of the _indices_ +instead of the values of the elements. To do that, starting with +`gawk' 3.1.2, use the `asorti' function. The interface is identical to +that of `asort', except that the index values are used for sorting, and +become the values of the result array: + + { source[$0] = some_func($0) } + + END { + n = asorti(source, dest) + for (i = 1; i <= n; i++) { + DO SOMETHING WITH dest[i] Work with sorted indices directly + ... + DO SOMETHING WITH source[dest[i]] Access original array via sorted indices + } + } + + If your version of `gawk' is 3.1.0 or 3.1.1, you don't have +`asorti'. Instead, use a helper array to hold the sorted index values, +and then access the original array's elements. It works in the +following way: + + POPULATE THE ARRAY data + # copy indices + j = 1 + for (i in data) { + ind[j] = i # index value becomes element value + j++ + } + n = asort(ind) # index values are now sorted + for (i = 1; i <= n; i++) { + DO SOMETHING WITH ind[i] Work with sorted indices directly + ... + DO SOMETHING WITH data[ind[i]] Access original array via sorted indices + } + + Sorting the array by replacing the indices provides maximal +flexibility. To traverse the elements in decreasing order, use a loop +that goes from N down to 1, either over the elements or over the +indices. + + Copying array indices and elements isn't expensive in terms of +memory. Internally, `gawk' maintains "reference counts" to data. For +example, when `asort' copies the first array to the second one, there +is only one copy of the original array elements' data, even though both +arrays use the values. Similarly, when copying the indices from `data' +to `ind', there is only one copy of the actual index strings. + + We said previously that comparisons are done using `gawk''s "usual +comparison rules." Because `IGNORECASE' affects string comparisons, +the value of `IGNORECASE' also affects sorting for both `asort' and +`asorti'. Caveat Emptor. + + +File: gawk.info, Node: Functions, Next: Internationalization, Prev: Arrays, Up: Top + +8 Functions +*********** + +This major node describes `awk''s built-in functions, which fall into +three categories: numeric, string, and I/O. `gawk' provides additional +groups of functions to work with values that represent time, do bit +manipulation, and internationalize and localize programs. + + Besides the built-in functions, `awk' has provisions for writing new +functions that the rest of a program can use. The second half of this +major node describes these "user-defined" functions. + +* Menu: + +* Built-in:: Summarizes the built-in functions. +* User-defined:: Describes User-defined functions in detail. + + +File: gawk.info, Node: Built-in, Next: User-defined, Up: Functions + +8.1 Built-in Functions +====================== + +"Built-in" functions are always available for your `awk' program to +call. This minor node defines all the built-in functions in `awk'; +some of these are mentioned in other sections but are summarized here +for your convenience. + +* Menu: + +* Calling Built-in:: How to call built-in functions. +* Numeric Functions:: Functions that work with numbers, including + `int', `sin' and `rand'. +* String Functions:: Functions for string manipulation, such as + `split', `match' and `sprintf'. +* I/O Functions:: Functions for files and shell commands. +* Time Functions:: Functions for dealing with timestamps. +* Bitwise Functions:: Functions for bitwise operations. +* I18N Functions:: Functions for string translation. + + +File: gawk.info, Node: Calling Built-in, Next: Numeric Functions, Up: Built-in + +8.1.1 Calling Built-in Functions +-------------------------------- + +To call one of `awk''s built-in functions, write the name of the +function followed by arguments in parentheses. For example, `atan2(y + +z, 1)' is a call to the function `atan2' and has two arguments. + + Whitespace is ignored between the built-in function name and the +open parenthesis, and it is good practice to avoid using whitespace +there. User-defined functions do not permit whitespace in this way, and +it is easier to avoid mistakes by following a simple convention that +always works--no whitespace after a function name. + + Each built-in function accepts a certain number of arguments. In +some cases, arguments can be omitted. The defaults for omitted +arguments vary from function to function and are described under the +individual functions. In some `awk' implementations, extra arguments +given to built-in functions are ignored. However, in `gawk', it is a +fatal error to give extra arguments to a built-in function. + + When a function is called, expressions that create the function's +actual parameters are evaluated completely before the call is performed. +For example, in the following code fragment: + + i = 4 + j = sqrt(i++) + +the variable `i' is incremented to the value five before `sqrt' is +called with a value of four for its actual parameter. The order of +evaluation of the expressions used for the function's parameters is +undefined. Thus, avoid writing programs that assume that parameters +are evaluated from left to right or from right to left. For example: + + i = 5 + j = atan2(i++, i *= 2) + + If the order of evaluation is left to right, then `i' first becomes +6, and then 12, and `atan2' is called with the two arguments 6 and 12. +But if the order of evaluation is right to left, `i' first becomes 10, +then 11, and `atan2' is called with the two arguments 11 and 10. + + +File: gawk.info, Node: Numeric Functions, Next: String Functions, Prev: Calling Built-in, Up: Built-in + +8.1.2 Numeric Functions +----------------------- + +The following list describes all of the built-in functions that work +with numbers. Optional parameters are enclosed in square +brackets ([ ]): + +`int(X)' + This returns the nearest integer to X, located between X and zero + and truncated toward zero. + + For example, `int(3)' is 3, `int(3.9)' is 3, `int(-3.9)' is -3, + and `int(-3)' is -3 as well. + +`sqrt(X)' + This returns the positive square root of X. `gawk' reports an + error if X is negative. Thus, `sqrt(4)' is 2. + +`exp(X)' + This returns the exponential of X (`e ^ X') or reports an error if + X is out of range. The range of values X can have depends on your + machine's floating-point representation. + +`log(X)' + This returns the natural logarithm of X, if X is positive; + otherwise, it reports an error. + +`sin(X)' + This returns the sine of X, with X in radians. + +`cos(X)' + This returns the cosine of X, with X in radians. + +`atan2(Y, X)' + This returns the arctangent of `Y / X' in radians. + +`rand()' + This returns a random number. The values of `rand' are uniformly + distributed between zero and one. The value could be zero but is + never one.(1) + + Often random integers are needed instead. Following is a + user-defined function that can be used to obtain a random + non-negative integer less than N: + + function randint(n) { + return int(n * rand()) + } + + The multiplication produces a random number greater than zero and + less than `n'. Using `int', this result is made into an integer + between zero and `n' - 1, inclusive. + + The following example uses a similar function to produce random + integers between one and N. This program prints a new random + number for each input record: + + # Function to roll a simulated die. + function roll(n) { return 1 + int(rand() * n) } + + # Roll 3 six-sided dice and + # print total number of points. + { + printf("%d points\n", + roll(6)+roll(6)+roll(6)) + } + + *Caution:* In most `awk' implementations, including `gawk', `rand' + starts generating numbers from the same starting number, or + "seed", each time you run `awk'. Thus, a program generates the + same results each time you run it. The numbers are random within + one `awk' run but predictable from run to run. This is convenient + for debugging, but if you want a program to do different things + each time it is used, you must change the seed to a value that is + different in each run. To do this, use `srand'. + +`srand([X])' + The function `srand' sets the starting point, or seed, for + generating random numbers to the value X. + + Each seed value leads to a particular sequence of random + numbers.(2) Thus, if the seed is set to the same value a second + time, the same sequence of random numbers is produced again. + + Different `awk' implementations use different random-number + generators internally. Don't expect the same `awk' program to + produce the same series of random numbers when executed by + different versions of `awk'. + + If the argument X is omitted, as in `srand()', then the current + date and time of day are used for a seed. This is the way to get + random numbers that are truly unpredictable. + + The return value of `srand' is the previous seed. This makes it + easy to keep track of the seeds in case you need to consistently + reproduce sequences of random numbers. + + ---------- Footnotes ---------- + + (1) The C version of `rand' is known to produce fairly poor +sequences of random numbers. However, nothing requires that an `awk' +implementation use the C `rand' to implement the `awk' version of +`rand'. In fact, `gawk' uses the BSD `random' function, which is +considerably better than `rand', to produce random numbers. + + (2) Computer-generated random numbers really are not truly random. +They are technically known as "pseudorandom." This means that while +the numbers in a sequence appear to be random, you can in fact generate +the same sequence of random numbers over and over again. + + +File: gawk.info, Node: String Functions, Next: I/O Functions, Prev: Numeric Functions, Up: Built-in + +8.1.3 String-Manipulation Functions +----------------------------------- + +The functions in this minor node look at or change the text of one or +more strings. Optional parameters are enclosed in square +brackets ([ ]). Those functions that are specific to `gawk' are marked +with a pound sign (`#'): + +* Menu: + +* Gory Details:: More than you want to know about `\' and + `&' with `sub', `gsub', and + `gensub'. + +`asort(SOURCE [, DEST]) #' + `asort' is a `gawk'-specific extension, returning the number of + elements in the array SOURCE. The contents of SOURCE are sorted + using `gawk''s normal rules for comparing values (in particular, + `IGNORECASE' affects the sorting) and the indices of the sorted + values of SOURCE are replaced with sequential integers starting + with one. If the optional array DEST is specified, then SOURCE is + duplicated into DEST. DEST is then sorted, leaving the indices of + SOURCE unchanged. For example, if the contents of `a' are as + follows: + + a["last"] = "de" + a["first"] = "sac" + a["middle"] = "cul" + + A call to `asort': + + asort(a) + + results in the following contents of `a': + + a[1] = "cul" + a[2] = "de" + a[3] = "sac" + + The `asort' function is described in more detail in *note Array + Sorting::. `asort' is a `gawk' extension; it is not available in + compatibility mode (*note Options::). + +`asorti(SOURCE [, DEST]) #' + `asorti' is a `gawk'-specific extension, returning the number of + elements in the array SOURCE. It works similarly to `asort', + however, the _indices_ are sorted, instead of the values. As + array indices are always strings, the comparison performed is + always a string comparison. (Here too, `IGNORECASE' affects the + sorting.) + + The `asorti' function is described in more detail in *note Array + Sorting::. It was added in `gawk' 3.1.2. `asorti' is a `gawk' + extension; it is not available in compatibility mode (*note + Options::). + +`index(IN, FIND)' + This searches the string IN for the first occurrence of the string + FIND, and returns the position in characters where that occurrence + begins in the string IN. Consider the following example: + + $ awk 'BEGIN { print index("peanut", "an") }' + -| 3 + + If FIND is not found, `index' returns zero. (Remember that string + indices in `awk' start at one.) + +`length([STRING])' + This returns the number of characters in STRING. If STRING is a + number, the length of the digit string representing that number is + returned. For example, `length("abcde")' is 5. By contrast, + `length(15 * 35)' works out to 3. In this example, 15 * 35 = 525, + and 525 is then converted to the string `"525"', which has three + characters. + + If no argument is supplied, `length' returns the length of `$0'. + + NOTE: In older versions of `awk', the `length' function could + be called without any parentheses. Doing so is marked as + "deprecated" in the POSIX standard. This means that while a + program can do this, it is a feature that can eventually be + removed from a future version of the standard. Therefore, + for programs to be maximally portable, always supply the + parentheses. + + Beginning with `gawk' version 3.2, when supplied an array + argument, the `length' function returns the number of elements in + the array. This is less useful than it might seem at first, as the + array is not guaranteed to be indexed from one to the number of + elements in it. If `--lint' is provided on the command line + (*note Options::), `gawk' warns that passing an array argument is + not portable. If `--posix' is supplied, using an array argument + is a fatal error (*note Arrays::). + +`match(STRING, REGEXP [, ARRAY])' + The `match' function searches STRING for the longest, leftmost + substring matched by the regular expression, REGEXP. It returns + the character position, or "index", at which that substring begins + (one, if it starts at the beginning of STRING). If no match is + found, it returns zero. + + The REGEXP argument may be either a regexp constant (`/.../') or a + string constant ("..."). In the latter case, the string is + treated as a regexp to be matched. *note Computed Regexps::, for a + discussion of the difference between the two forms, and the + implications for writing your program correctly. + + The order of the first two arguments is backwards from most other + string functions that work with regular expressions, such as `sub' + and `gsub'. It might help to remember that for `match', the order + is the same as for the `~' operator: `STRING ~ REGEXP'. + + The `match' function sets the built-in variable `RSTART' to the + index. It also sets the built-in variable `RLENGTH' to the length + in characters of the matched substring. If no match is found, + `RSTART' is set to zero, and `RLENGTH' to -1. + + For example: + + { + if ($1 == "FIND") + regex = $2 + else { + where = match($0, regex) + if (where != 0) + print "Match of", regex, "found at", + where, "in", $0 + } + } + + This program looks for lines that match the regular expression + stored in the variable `regex'. This regular expression can be + changed. If the first word on a line is `FIND', `regex' is + changed to be the second word on that line. Therefore, if given: + + FIND ru+n + My program runs + but not very quickly + FIND Melvin + JF+KM + This line is property of Reality Engineering Co. + Melvin was here. + + `awk' prints: + + Match of ru+n found at 12 in My program runs + Match of Melvin found at 1 in Melvin was here. + + If ARRAY is present, it is cleared, and then the 0th element of + ARRAY is set to the entire portion of STRING matched by REGEXP. + If REGEXP contains parentheses, the integer-indexed elements of + ARRAY are set to contain the portion of STRING matching the + corresponding parenthesized subexpression. For example: + + $ echo foooobazbarrrrr | + > gawk '{ match($0, /(fo+).+(bar*)/, arr) + > print arr[1], arr[2] }' + -| foooo barrrrr + + In addition, beginning with `gawk' 3.1.2, multidimensional + subscripts are available providing the start index and length of + each matched subexpression: + + $ echo foooobazbarrrrr | + > gawk '{ match($0, /(fo+).+(bar*)/, arr) + > print arr[1], arr[2] + > print arr[1, "start"], arr[1, "length"] + > print arr[2, "start"], arr[2, "length"] + > }' + -| foooo barrrrr + -| 1 5 + -| 9 7 + + There may not be subscripts for the start and index for every + parenthesized subexpressions, since they may not all have matched + text; thus they should be tested for with the `in' operator (*note + Reference to Elements::). + + The ARRAY argument to `match' is a `gawk' extension. In + compatibility mode (*note Options::), using a third argument is a + fatal error. + +`split(STRING, ARRAY [, FIELDSEP])' + This function divides STRING into pieces separated by FIELDSEP and + stores the pieces in ARRAY. The first piece is stored in + `ARRAY[1]', the second piece in `ARRAY[2]', and so forth. The + string value of the third argument, FIELDSEP, is a regexp + describing where to split STRING (much as `FS' can be a regexp + describing where to split input records). If FIELDSEP is omitted, + the value of `FS' is used. `split' returns the number of elements + created. + + The `split' function splits strings into pieces in a manner + similar to the way input lines are split into fields. For example: + + split("cul-de-sac", a, "-") + + splits the string `cul-de-sac' into three fields using `-' as the + separator. It sets the contents of the array `a' as follows: + + a[1] = "cul" + a[2] = "de" + a[3] = "sac" + + The value returned by this call to `split' is three. + + As with input field-splitting, when the value of FIELDSEP is + `" "', leading and trailing whitespace is ignored, and the elements + are separated by runs of whitespace. Also as with input + field-splitting, if FIELDSEP is the null string, each individual + character in the string is split into its own array element. + (This is a `gawk'-specific extension.) + + Note, however, that `RS' has no effect on the way `split' works. + Even though `RS = ""' causes newline to also be an input field + separator, this does not affect how `split' splits strings. + + Modern implementations of `awk', including `gawk', allow the third + argument to be a regexp constant (`/abc/') as well as a string. + (d.c.) The POSIX standard allows this as well. *note Computed + Regexps::, for a discussion of the difference between using a + string constant or a regexp constant, and the implications for + writing your program correctly. + + Before splitting the string, `split' deletes any previously + existing elements in the array ARRAY. + + If STRING is null, the array has no elements. (So this is a + portable way to delete an entire array with one statement. *Note + Delete::.) + + If STRING does not match FIELDSEP at all (but is not null), ARRAY + has one element only. The value of that element is the original + STRING. + +`sprintf(FORMAT, EXPRESSION1, ...)' + This returns (without printing) the string that `printf' would + have printed out with the same arguments (*note Printf::). For + example: + + pival = sprintf("pi = %.2f (approx.)", 22/7) + + assigns the string `"pi = 3.14 (approx.)"' to the variable `pival'. + +`strtonum(STR) #' + Examines STR and returns its numeric value. If STR begins with a + leading `0', `strtonum' assumes that STR is an octal number. If + STR begins with a leading `0x' or `0X', `strtonum' assumes that + STR is a hexadecimal number. For example: + + $ echo 0x11 | + > gawk '{ printf "%d\n", strtonum($1) }' + -| 17 + + Using the `strtonum' function is _not_ the same as adding zero to + a string value; the automatic coercion of strings to numbers works + only for decimal data, not for octal or hexadecimal.(1) + + Note also that `strtonum' uses the current locale's decimal point + for recognizing numbers. + + `strtonum' is a `gawk' extension; it is not available in + compatibility mode (*note Options::). + +`sub(REGEXP, REPLACEMENT [, TARGET])' + The `sub' function alters the value of TARGET. It searches this + value, which is treated as a string, for the leftmost, longest + substring matched by the regular expression REGEXP. Then the + entire string is changed by replacing the matched text with + REPLACEMENT. The modified string becomes the new value of TARGET. + + The REGEXP argument may be either a regexp constant (`/.../') or a + string constant ("..."). In the latter case, the string is + treated as a regexp to be matched. *note Computed Regexps::, for a + discussion of the difference between the two forms, and the + implications for writing your program correctly. + + This function is peculiar because TARGET is not simply used to + compute a value, and not just any expression will do--it must be a + variable, field, or array element so that `sub' can store a + modified value there. If this argument is omitted, then the + default is to use and alter `$0'.(2) For example: + + str = "water, water, everywhere" + sub(/at/, "ith", str) + + sets `str' to `"wither, water, everywhere"', by replacing the + leftmost longest occurrence of `at' with `ith'. + + The `sub' function returns the number of substitutions made (either + one or zero). + + If the special character `&' appears in REPLACEMENT, it stands for + the precise substring that was matched by REGEXP. (If the regexp + can match more than one string, then this precise substring may + vary.) For example: + + { sub(/candidate/, "& and his wife"); print } + + changes the first occurrence of `candidate' to `candidate and his + wife' on each input line. Here is another example: + + $ awk 'BEGIN { + > str = "daabaaa" + > sub(/a+/, "C&C", str) + > print str + > }' + -| dCaaCbaaa + + This shows how `&' can represent a nonconstant string and also + illustrates the "leftmost, longest" rule in regexp matching (*note + Leftmost Longest::). + + The effect of this special character (`&') can be turned off by + putting a backslash before it in the string. As usual, to insert + one backslash in the string, you must write two backslashes. + Therefore, write `\\&' in a string constant to include a literal + `&' in the replacement. For example, the following shows how to + replace the first `|' on each line with an `&': + + { sub(/\|/, "\\&"); print } + + As mentioned, the third argument to `sub' must be a variable, + field or array reference. Some versions of `awk' allow the third + argument to be an expression that is not an lvalue. In such a + case, `sub' still searches for the pattern and returns zero or + one, but the result of the substitution (if any) is thrown away + because there is no place to put it. Such versions of `awk' + accept expressions such as the following: + + sub(/USA/, "United States", "the USA and Canada") + + For historical compatibility, `gawk' accepts erroneous code, such + as in the previous example. However, using any other nonchangeable + object as the third parameter causes a fatal error and your program + will not run. + + Finally, if the REGEXP is not a regexp constant, it is converted + into a string, and then the value of that string is treated as the + regexp to match. + +`gsub(REGEXP, REPLACEMENT [, TARGET])' + This is similar to the `sub' function, except `gsub' replaces + _all_ of the longest, leftmost, _nonoverlapping_ matching + substrings it can find. The `g' in `gsub' stands for "global," + which means replace everywhere. For example: + + { gsub(/Britain/, "United Kingdom"); print } + + replaces all occurrences of the string `Britain' with `United + Kingdom' for all input records. + + The `gsub' function returns the number of substitutions made. If + the variable to search and alter (TARGET) is omitted, then the + entire input record (`$0') is used. As in `sub', the characters + `&' and `\' are special, and the third argument must be assignable. + +`gensub(REGEXP, REPLACEMENT, HOW [, TARGET]) #' + `gensub' is a general substitution function. Like `sub' and + `gsub', it searches the target string TARGET for matches of the + regular expression REGEXP. Unlike `sub' and `gsub', the modified + string is returned as the result of the function and the original + target string is _not_ changed. If HOW is a string beginning with + `g' or `G', then it replaces all matches of REGEXP with + REPLACEMENT. Otherwise, HOW is treated as a number that indicates + which match of REGEXP to replace. If no TARGET is supplied, `$0' + is used. + + `gensub' provides an additional feature that is not available in + `sub' or `gsub': the ability to specify components of a regexp in + the replacement text. This is done by using parentheses in the + regexp to mark the components and then specifying `\N' in the + replacement text, where N is a digit from 1 to 9. For example: + + $ gawk ' + > BEGIN { + > a = "abc def" + > b = gensub(/(.+) (.+)/, "\\2 \\1", "g", a) + > print b + > }' + -| def abc + + As with `sub', you must type two backslashes in order to get one + into the string. In the replacement text, the sequence `\0' + represents the entire matched text, as does the character `&'. + + The following example shows how you can use the third argument to + control which match of the regexp should be changed: + + $ echo a b c a b c | + > gawk '{ print gensub(/a/, "AA", 2) }' + -| a b c AA b c + + In this case, `$0' is used as the default target string. `gensub' + returns the new string as its result, which is passed directly to + `print' for printing. + + If the HOW argument is a string that does not begin with `g' or + `G', or if it is a number that is less than or equal to zero, only + one substitution is performed. If HOW is zero, `gawk' issues a + warning message. + + If REGEXP does not match TARGET, `gensub''s return value is the + original unchanged value of TARGET. + + `gensub' is a `gawk' extension; it is not available in + compatibility mode (*note Options::). + +`substr(STRING, START [, LENGTH])' + This returns a LENGTH-character-long substring of STRING, starting + at character number START. The first character of a string is + character number one.(3) For example, `substr("washington", 5, 3)' + returns `"ing"'. + + If LENGTH is not present, this function returns the whole suffix of + STRING that begins at character number START. For example, + `substr("washington", 5)' returns `"ington"'. The whole suffix is + also returned if LENGTH is greater than the number of characters + remaining in the string, counting from character START. + + If START is less than one, `substr' treats it as if it was one. + (POSIX doesn't specify what to do in this case: Unix `awk' acts + this way, and therefore `gawk' does too.) If START is greater + than the number of characters in the string, `substr' returns the + null string. Similarly, if LENGTH is present but less than or + equal to zero, the null string is returned. + + The string returned by `substr' _cannot_ be assigned. Thus, it is + a mistake to attempt to change a portion of a string, as shown in + the following example: + + string = "abcdef" + # try to get "abCDEf", won't work + substr(string, 3, 3) = "CDE" + + It is also a mistake to use `substr' as the third argument of + `sub' or `gsub': + + gsub(/xyz/, "pdq", substr($0, 5, 20)) # WRONG + + (Some commercial versions of `awk' do in fact let you use `substr' + this way, but doing so is not portable.) + + If you need to replace bits and pieces of a string, combine + `substr' with string concatenation, in the following manner: + + string = "abcdef" + ... + string = substr(string, 1, 2) "CDE" substr(string, 6) + +`tolower(STRING)' + This returns a copy of STRING, with each uppercase character in + the string replaced with its corresponding lowercase character. + Nonalphabetic characters are left unchanged. For example, + `tolower("MiXeD cAsE 123")' returns `"mixed case 123"'. + +`toupper(STRING)' + This returns a copy of STRING, with each lowercase character in + the string replaced with its corresponding uppercase character. + Nonalphabetic characters are left unchanged. For example, + `toupper("MiXeD cAsE 123")' returns `"MIXED CASE 123"'. + + ---------- Footnotes ---------- + + (1) Unless you use the `--non-decimal-data' option, which isn't +recommended. *Note Nondecimal Data::, for more information. + + (2) Note that this means that the record will first be regenerated +using the value of `OFS' if any fields have been changed, and that the +fields will be updated after the substitution, even if the operation is +a "no-op" such as `sub(/^/, "")'. + + (3) This is different from C and C++, in which the first character +is number zero. + + +File: gawk.info, Node: Gory Details, Up: String Functions + +8.1.3.1 More About `\' and `&' with `sub', `gsub', and `gensub' +............................................................... + +When using `sub', `gsub', or `gensub', and trying to get literal +backslashes and ampersands into the replacement text, you need to +remember that there are several levels of "escape processing" going on. + + First, there is the "lexical" level, which is when `awk' reads your +program and builds an internal copy of it that can be executed. Then +there is the runtime level, which is when `awk' actually scans the +replacement string to determine what to generate. + + At both levels, `awk' looks for a defined set of characters that can +come after a backslash. At the lexical level, it looks for the escape +sequences listed in *note Escape Sequences::. Thus, for every `\' that +`awk' processes at the runtime level, type two backslashes at the +lexical level. When a character that is not valid for an escape +sequence follows the `\', Unix `awk' and `gawk' both simply remove the +initial `\' and put the next character into the string. Thus, for +example, `"a\qb"' is treated as `"aqb"'. + + At the runtime level, the various functions handle sequences of `\' +and `&' differently. The situation is (sadly) somewhat complex. +Historically, the `sub' and `gsub' functions treated the two character +sequence `\&' specially; this sequence was replaced in the generated +text with a single `&'. Any other `\' within the REPLACEMENT string +that did not precede an `&' was passed through unchanged. This is +illustrated in *note table-sub-escapes::. + + You type `sub' sees `sub' generates + ------- --------- -------------- + `\&' `&' the matched text + `\\&' `\&' a literal `&' + `\\\&' `\&' a literal `&' + `\\\\&' `\\&' a literal `\&' + `\\\\\&' `\\&' a literal `\&' + `\\\\\\&' `\\\&' a literal `\\&' + `\\q' `\q' a literal `\q' + +Table 8.1: Historical Escape Sequence Processing for sub and gsub + +This table shows both the lexical-level processing, where an odd number +of backslashes becomes an even number at the runtime level, as well as +the runtime processing done by `sub'. (For the sake of simplicity, the +rest of the following tables only show the case of even numbers of +backslashes entered at the lexical level.) + + The problem with the historical approach is that there is no way to +get a literal `\' followed by the matched text. + + The 1992 POSIX standard attempted to fix this problem. That standard +says that `sub' and `gsub' look for either a `\' or an `&' after the +`\'. If either one follows a `\', that character is output literally. +The interpretation of `\' and `&' then becomes as shown in *note +table-sub-posix-92::. + + You type `sub' sees `sub' generates + ------- --------- -------------- + `&' `&' the matched text + `\\&' `\&' a literal `&' + `\\\\&' `\\&' a literal `\', then the matched text + `\\\\\\&' `\\\&' a literal `\&' + +Table 8.2: 1992 POSIX Rules for sub and gsub Escape Sequence Processing + +This appears to solve the problem. Unfortunately, the phrasing of the +standard is unusual. It says, in effect, that `\' turns off the special +meaning of any following character, but for anything other than `\' and +`&', such special meaning is undefined. This wording leads to two +problems: + + * Backslashes must now be doubled in the REPLACEMENT string, breaking + historical `awk' programs. + + * To make sure that an `awk' program is portable, _every_ character + in the REPLACEMENT string must be preceded with a backslash.(1) + + Because of the problems just listed, in 1996, the `gawk' maintainer +submitted proposed text for a revised standard that reverts to rules +that correspond more closely to the original existing practice. The +proposed rules have special cases that make it possible to produce a +`\' preceding the matched text. This is shown in *note +table-sub-proposed::. + + You type `sub' sees `sub' generates + ------- --------- -------------- + `\\\\\\&' `\\\&' a literal `\&' + `\\\\&' `\\&' a literal `\', followed by the matched text + `\\&' `\&' a literal `&' + `\\q' `\q' a literal `\q' + `\\\\' `\\' `\\' + +Table 8.3: Proposed rules for sub and backslash + + In a nutshell, at the runtime level, there are now three special +sequences of characters (`\\\&', `\\&' and `\&') whereas historically +there was only one. However, as in the historical case, any `\' that +is not part of one of these three sequences is not special and appears +in the output literally. + + `gawk' 3.0 and 3.1 follow these proposed POSIX rules for `sub' and +`gsub'. The POSIX standard took much longer to be revised than was +expected in 1996. The 2001 standard does not follow the above rules. +Instead, the rules there are somewhat simpler. The results are similar +except for one case. + + The 2001 POSIX rules state that `\&' in the replacement string +produces a literal `&', `\\' produces a literal `\', and `\' followed +by anything else is not special; the `\' is placed straight into the +output. These rules are presented in *note table-posix-2001-sub::. + + You type `sub' sees `sub' generates + ------- --------- -------------- + `\\\\\\&' `\\\&' a literal `\&' + `\\\\&' `\\&' a literal `\', followed by the matched text + `\\&' `\&' a literal `&' + `\\q' `\q' a literal `\q' + `\\\\' `\\' `\' + +Table 8.4: POSIX 2001 rules for sub + + The only case where the difference is noticeable is the last one: +`\\\\' is seen as `\\' and produces `\' instead of `\\'. + + Starting with version 3.1.4, `gawk' follows the POSIX rules when +`--posix' is specified (*note Options::). Otherwise, it continues to +follow the 1996 proposed rules, since, as of this writing, that has +been its behavior for over seven years. + + NOTE: At the next major release, `gawk' will switch to using the + POSIX 2001 rules by default. + + The rules for `gensub' are considerably simpler. At the runtime +level, whenever `gawk' sees a `\', if the following character is a +digit, then the text that matched the corresponding parenthesized +subexpression is placed in the generated output. Otherwise, no matter +what character follows the `\', it appears in the generated text and +the `\' does not, as shown in *note table-gensub-escapes::. + + You type `gensub' sees `gensub' generates + ------- ------------ ----------------- + `&' `&' the matched text + `\\&' `\&' a literal `&' + `\\\\' `\\' a literal `\' + `\\\\&' `\\&' a literal `\', then the matched text + `\\\\\\&' `\\\&' a literal `\&' + `\\q' `\q' a literal `q' + +Table 8.5: Escape Sequence Processing for gensub + + Because of the complexity of the lexical and runtime level processing +and the special cases for `sub' and `gsub', we recommend the use of +`gawk' and `gensub' when you have to do substitutions. + +Advanced Notes: Matching the Null String +---------------------------------------- + +In `awk', the `*' operator can match the null string. This is +particularly important for the `sub', `gsub', and `gensub' functions. +For example: + + $ echo abc | awk '{ gsub(/m*/, "X"); print }' + -| XaXbXcX + +Although this makes a certain amount of sense, it can be surprising. + + ---------- Footnotes ---------- + + (1) This consequence was certainly unintended. + + +File: gawk.info, Node: I/O Functions, Next: Time Functions, Prev: String Functions, Up: Built-in + +8.1.4 Input/Output Functions +---------------------------- + +The following functions relate to input/output (I/O). Optional +parameters are enclosed in square brackets ([ ]): + +`close(FILENAME [, HOW])' + Close the file FILENAME for input or output. Alternatively, the + argument may be a shell command that was used for creating a + coprocess, or for redirecting to or from a pipe; then the + coprocess or pipe is closed. *Note Close Files And Pipes::, for + more information. + + When closing a coprocess, it is occasionally useful to first close + one end of the two-way pipe and then to close the other. This is + done by providing a second argument to `close'. This second + argument should be one of the two string values `"to"' or `"from"', + indicating which end of the pipe to close. Case in the string does + not matter. *Note Two-way I/O::, which discusses this feature in + more detail and gives an example. + +`fflush([FILENAME])' + Flush any buffered output associated with FILENAME, which is + either a file opened for writing or a shell command for + redirecting output to a pipe or coprocess. + + Many utility programs "buffer" their output; i.e., they save + information to write to a disk file or terminal in memory until + there is enough for it to be worthwhile to send the data to the + output device. This is often more efficient than writing every + little bit of information as soon as it is ready. However, + sometimes it is necessary to force a program to "flush" its + buffers; that is, write the information to its destination, even + if a buffer is not full. This is the purpose of the `fflush' + function--`gawk' also buffers its output and the `fflush' function + forces `gawk' to flush its buffers. + + `fflush' was added to the Bell Laboratories research version of + `awk' in 1994; it is not part of the POSIX standard and is not + available if `--posix' has been specified on the command line + (*note Options::). + + `gawk' extends the `fflush' function in two ways. The first is to + allow no argument at all. In this case, the buffer for the + standard output is flushed. The second is to allow the null string + (`""') as the argument. In this case, the buffers for _all_ open + output files and pipes are flushed. + + `fflush' returns zero if the buffer is successfully flushed; + otherwise, it returns -1. In the case where all buffers are + flushed, the return value is zero only if all buffers were flushed + successfully. Otherwise, it is -1, and `gawk' warns about the + problem FILENAME. + + `gawk' also issues a warning message if you attempt to flush a + file or pipe that was opened for reading (such as with `getline'), + or if FILENAME is not an open file, pipe, or coprocess. In such a + case, `fflush' returns -1, as well. + +`system(COMMAND)' + Executes operating-system commands and then returns to the `awk' + program. The `system' function executes the command given by the + string COMMAND. It returns the status returned by the command + that was executed as its value. + + For example, if the following fragment of code is put in your `awk' + program: + + END { + system("date | mail -s 'awk run done' root") + } + + the system administrator is sent mail when the `awk' program + finishes processing input and begins its end-of-input processing. + + Note that redirecting `print' or `printf' into a pipe is often + enough to accomplish your task. If you need to run many commands, + it is more efficient to simply print them down a pipeline to the + shell: + + while (MORE STUFF TO DO) + print COMMAND | "/bin/sh" + close("/bin/sh") + + However, if your `awk' program is interactive, `system' is useful + for cranking up large self-contained programs, such as a shell or + an editor. Some operating systems cannot implement the `system' + function. `system' causes a fatal error if it is not supported. + +Advanced Notes: Interactive Versus Noninteractive Buffering +----------------------------------------------------------- + +As a side point, buffering issues can be even more confusing, depending +upon whether your program is "interactive", i.e., communicating with a +user sitting at a keyboard.(1) + + Interactive programs generally "line buffer" their output; i.e., they +write out every line. Noninteractive programs wait until they have a +full buffer, which may be many lines of output. Here is an example of +the difference: + + $ awk '{ print $1 + $2 }' + 1 1 + -| 2 + 2 3 + -| 5 + Ctrl-d + +Each line of output is printed immediately. Compare that behavior with +this example: + + $ awk '{ print $1 + $2 }' | cat + 1 1 + 2 3 + Ctrl-d + -| 2 + -| 5 + +Here, no output is printed until after the `Ctrl-d' is typed, because +it is all buffered and sent down the pipe to `cat' in one shot. + +Advanced Notes: Controlling Output Buffering with `system' +---------------------------------------------------------- + +The `fflush' function provides explicit control over output buffering +for individual files and pipes. However, its use is not portable to +many other `awk' implementations. An alternative method to flush output +buffers is to call `system' with a null string as its argument: + + system("") # flush output + +`gawk' treats this use of the `system' function as a special case and +is smart enough not to run a shell (or other command interpreter) with +the empty command. Therefore, with `gawk', this idiom is not only +useful, it is also efficient. While this method should work with other +`awk' implementations, it does not necessarily avoid starting an +unnecessary shell. (Other implementations may only flush the buffer +associated with the standard output and not necessarily all buffered +output.) + + If you think about what a programmer expects, it makes sense that +`system' should flush any pending output. The following program: + + BEGIN { + print "first print" + system("echo system echo") + print "second print" + } + +must print: + + first print + system echo + second print + +and not: + + system echo + first print + second print + + If `awk' did not flush its buffers before calling `system', you +would see the latter (undesirable) output. + + ---------- Footnotes ---------- + + (1) A program is interactive if the standard output is connected to +a terminal device. + + +File: gawk.info, Node: Time Functions, Next: Bitwise Functions, Prev: I/O Functions, Up: Built-in + +8.1.5 Using `gawk''s Timestamp Functions +---------------------------------------- + +`awk' programs are commonly used to process log files containing +timestamp information, indicating when a particular log record was +written. Many programs log their timestamp in the form returned by the +`time' system call, which is the number of seconds since a particular +epoch. On POSIX-compliant systems, it is the number of seconds since +1970-01-01 00:00:00 UTC, not counting leap seconds.(1) All known +POSIX-compliant systems support timestamps from 0 through 2^31 - 1, +which is sufficient to represent times through 2038-01-19 03:14:07 UTC. +Many systems support a wider range of timestamps, including negative +timestamps that represent times before the epoch. + + In order to make it easier to process such log files and to produce +useful reports, `gawk' provides the following functions for working +with timestamps. They are `gawk' extensions; they are not specified in +the POSIX standard, nor are they in any other known version of `awk'.(2) +Optional parameters are enclosed in square brackets ([ ]): + +`systime()' + This function returns the current time as the number of seconds + since the system epoch. On POSIX systems, this is the number of + seconds since 1970-01-01 00:00:00 UTC, not counting leap seconds. + It may be a different number on other systems. + +`mktime(DATESPEC)' + This function turns DATESPEC into a timestamp in the same form as + is returned by `systime'. It is similar to the function of the + same name in ISO C. The argument, DATESPEC, is a string of the + form `"YYYY MM DD HH MM SS [DST]"'. The string consists of six or + seven numbers representing, respectively, the full year including + century, the month from 1 to 12, the day of the month from 1 to + 31, the hour of the day from 0 to 23, the minute from 0 to 59, the + second from 0 to 60,(3) and an optional daylight-savings flag. + + The values of these numbers need not be within the ranges + specified; for example, an hour of -1 means 1 hour before midnight. + The origin-zero Gregorian calendar is assumed, with year 0 + preceding year 1 and year -1 preceding year 0. The time is + assumed to be in the local timezone. If the daylight-savings flag + is positive, the time is assumed to be daylight savings time; if + zero, the time is assumed to be standard time; and if negative + (the default), `mktime' attempts to determine whether daylight + savings time is in effect for the specified time. + + If DATESPEC does not contain enough elements or if the resulting + time is out of range, `mktime' returns -1. + +`strftime([FORMAT [, TIMESTAMP [, UTC-FLAG]]])' + This function returns a string. It is similar to the function of + the same name in ISO C. The time specified by TIMESTAMP is used to + produce a string, based on the contents of the FORMAT string. If + UTC-FLAG is present and is either non-zero or non-null, the value + is formatted as UTC (Coordinated Universal Time, formerly GMT or + Greenwich Mean Time). Otherwise, the value is formatted for the + local time zone. The TIMESTAMP is in the same format as the value + returned by the `systime' function. If no TIMESTAMP argument is + supplied, `gawk' uses the current time of day as the timestamp. + If no FORMAT argument is supplied, `strftime' uses + `"%a %b %d %H:%M:%S %Z %Y"'. This format string produces output + that is (almost) equivalent to that of the `date' utility. + (Versions of `gawk' prior to 3.0 require the FORMAT argument.) + + The `systime' function allows you to compare a timestamp from a log +file with the current time of day. In particular, it is easy to +determine how long ago a particular record was logged. It also allows +you to produce log records using the "seconds since the epoch" format. + + The `mktime' function allows you to convert a textual representation +of a date and time into a timestamp. This makes it easy to do +before/after comparisons of dates and times, particularly when dealing +with date and time data coming from an external source, such as a log +file. + + The `strftime' function allows you to easily turn a timestamp into +human-readable information. It is similar in nature to the `sprintf' +function (*note String Functions::), in that it copies nonformat +specification characters verbatim to the returned string, while +substituting date and time values for format specifications in the +FORMAT string. + + `strftime' is guaranteed by the 1999 ISO C standard(4) to support +the following date format specifications: + +`%a' + The locale's abbreviated weekday name. + +`%A' + The locale's full weekday name. + +`%b' + The locale's abbreviated month name. + +`%B' + The locale's full month name. + +`%c' + The locale's "appropriate" date and time representation. (This is + `%A %B %d %T %Y' in the `"C"' locale.) + +`%C' + The century. This is the year divided by 100 and truncated to the + next lower integer. + +`%d' + The day of the month as a decimal number (01-31). + +`%D' + Equivalent to specifying `%m/%d/%y'. + +`%e' + The day of the month, padded with a space if it is only one digit. + +`%F' + Equivalent to specifying `%Y-%m-%d'. This is the ISO 8601 date + format. + +`%g' + The year modulo 100 of the ISO week number, as a decimal number + (00-99). For example, January 1, 1993 is in week 53 of 1992. + Thus, the year of its ISO week number is 1992, even though its + year is 1993. Similarly, December 31, 1973 is in week 1 of 1974. + Thus, the year of its ISO week number is 1974, even though its + year is 1973. + +`%G' + The full year of the ISO week number, as a decimal number. + +`%h' + Equivalent to `%b'. + +`%H' + The hour (24-hour clock) as a decimal number (00-23). + +`%I' + The hour (12-hour clock) as a decimal number (01-12). + +`%j' + The day of the year as a decimal number (001-366). + +`%m' + The month as a decimal number (01-12). + +`%M' + The minute as a decimal number (00-59). + +`%n' + A newline character (ASCII LF). + +`%p' + The locale's equivalent of the AM/PM designations associated with + a 12-hour clock. + +`%r' + The locale's 12-hour clock time. (This is `%I:%M:%S %p' in the + `"C"' locale.) + +`%R' + Equivalent to specifying `%H:%M'. + +`%S' + The second as a decimal number (00-60). + +`%t' + A TAB character. + +`%T' + Equivalent to specifying `%H:%M:%S'. + +`%u' + The weekday as a decimal number (1-7). Monday is day one. + +`%U' + The week number of the year (the first Sunday as the first day of + week one) as a decimal number (00-53). + +`%V' + The week number of the year (the first Monday as the first day of + week one) as a decimal number (01-53). The method for determining + the week number is as specified by ISO 8601. (To wit: if the week + containing January 1 has four or more days in the new year, then + it is week one; otherwise it is week 53 of the previous year and + the next week is week one.) + +`%w' + The weekday as a decimal number (0-6). Sunday is day zero. + +`%W' + The week number of the year (the first Monday as the first day of + week one) as a decimal number (00-53). + +`%x' + The locale's "appropriate" date representation. (This is `%A %B + %d %Y' in the `"C"' locale.) + +`%X' + The locale's "appropriate" time representation. (This is `%T' in + the `"C"' locale.) + +`%y' + The year modulo 100 as a decimal number (00-99). + +`%Y' + The full year as a decimal number (e.g., 1995). + +`%z' + The timezone offset in a +HHMM format (e.g., the format necessary + to produce RFC 822/RFC 1036 date headers). + +`%Z' + The time zone name or abbreviation; no characters if no time zone + is determinable. + +`%Ec %EC %Ex %EX %Ey %EY %Od %Oe %OH' +`%OI %Om %OM %OS %Ou %OU %OV %Ow %OW %Oy' + "Alternate representations" for the specifications that use only + the second letter (`%c', `%C', and so on).(5) (These facilitate + compliance with the POSIX `date' utility.) + +`%%' + A literal `%'. + + If a conversion specifier is not one of the above, the behavior is +undefined.(6) + + Informally, a "locale" is the geographic place in which a program is +meant to run. For example, a common way to abbreviate the date +September 4, 1991 in the United States is "9/4/91." In many countries +in Europe, however, it is abbreviated "4.9.91." Thus, the `%x' +specification in a `"US"' locale might produce `9/4/91', while in a +`"EUROPE"' locale, it might produce `4.9.91'. The ISO C standard +defines a default `"C"' locale, which is an environment that is typical +of what most C programmers are used to. + + For systems that are not yet fully standards-compliant, `gawk' +supplies a copy of `strftime' from the GNU C Library. It supports all +of the just listed format specifications. If that version is used to +compile `gawk' (*note Installation::), then the following additional +format specifications are available: + +`%k' + The hour (24-hour clock) as a decimal number (0-23). Single-digit + numbers are padded with a space. + +`%l' + The hour (12-hour clock) as a decimal number (1-12). Single-digit + numbers are padded with a space. + +`%s' + The time as a decimal timestamp in seconds since the epoch. + + + Additionally, the alternate representations are recognized but their +normal representations are used. + + This example is an `awk' implementation of the POSIX `date' utility. +Normally, the `date' utility prints the current date and time of day in +a well-known format. However, if you provide an argument to it that +begins with a `+', `date' copies nonformat specifier characters to the +standard output and interprets the current time according to the format +specifiers in the string. For example: + + $ date '+Today is %A, %B %d, %Y.' + -| Today is Thursday, September 14, 2000. + + Here is the `gawk' version of the `date' utility. It has a shell +"wrapper" to handle the `-u' option, which requires that `date' run as +if the time zone is set to UTC: + + #! /bin/sh + # + # date --- approximate the P1003.2 'date' command + + case $1 in + -u) TZ=UTC0 # use UTC + export TZ + shift ;; + esac + + gawk 'BEGIN { + format = "%a %b %d %H:%M:%S %Z %Y" + exitval = 0 + + if (ARGC > 2) + exitval = 1 + else if (ARGC == 2) { + format = ARGV[1] + if (format ~ /^\+/) + format = substr(format, 2) # remove leading + + } + print strftime(format) + exit exitval + }' "$@" + + ---------- Footnotes ---------- + + (1) *Note Glossary::, especially the entries "Epoch" and "UTC." + + (2) The GNU `date' utility can also do many of the things described +here. Its use may be preferable for simple time-related operations in +shell scripts. + + (3) Occasionally there are minutes in a year with a leap second, +which is why the seconds can go up to 60. + + (4) As this is a recent standard, not every system's `strftime' +necessarily supports all of the conversions listed here. + + (5) If you don't understand any of this, don't worry about it; these +facilities are meant to make it easier to "internationalize" programs. +Other internationalization features are described in *note +Internationalization::. + + (6) This is because ISO C leaves the behavior of the C version of +`strftime' undefined and `gawk' uses the system's version of `strftime' +if it's there. Typically, the conversion specifier either does not +appear in the returned string or appears literally. + + +File: gawk.info, Node: Bitwise Functions, Next: I18N Functions, Prev: Time Functions, Up: Built-in + +8.1.6 Bit-Manipulation Functions of `gawk' +------------------------------------------ + + I can explain it for you, but I can't understand it for you. + Anonymous + + Many languages provide the ability to perform "bitwise" operations +on two integer numbers. In other words, the operation is performed on +each successive pair of bits in the operands. Three common operations +are bitwise AND, OR, and XOR. The operations are described in *note +table-bitwise-ops::. + + Bit Operator + | AND | OR | XOR + |--+--+--+--+--+-- + Operands | 0 | 1 | 0 | 1 | 0 | 1 + ---------+--+--+--+--+--+-- + 0 | 0 0 | 0 1 | 0 1 + 1 | 0 1 | 1 1 | 1 0 + +Table 8.6: Bitwise Operations + + As you can see, the result of an AND operation is 1 only when _both_ +bits are 1. The result of an OR operation is 1 if _either_ bit is 1. +The result of an XOR operation is 1 if either bit is 1, but not both. +The next operation is the "complement"; the complement of 1 is 0 and +the complement of 0 is 1. Thus, this operation "flips" all the bits of +a given value. + + Finally, two other common operations are to shift the bits left or +right. For example, if you have a bit string `10111001' and you shift +it right by three bits, you end up with `00010111'.(1) If you start over +again with `10111001' and shift it left by three bits, you end up with +`11001000'. `gawk' provides built-in functions that implement the +bitwise operations just described. They are: + +`and(V1, V2)' Returns the bitwise AND of the values provided by V1 + and V2. +`or(V1, V2)' Returns the bitwise OR of the values provided by V1 + and V2. +`xor(V1, V2)' Returns the bitwise XOR of the values provided by V1 + and V2. +`compl(VAL)' Returns the bitwise complement of VAL. +`lshift(VAL, COUNT)' Returns the value of VAL, shifted left by COUNT bits. +`rshift(VAL, COUNT)' Returns the value of VAL, shifted right by COUNT bits. + + For all of these functions, first the double-precision +floating-point value is converted to the widest C unsigned integer +type, then the bitwise operation is performed. If the result cannot be +represented exactly as a C `double', leading nonzero bits are removed +one by one until it can be represented exactly. The result is then +converted back into a C `double'. (If you don't understand this +paragraph, don't worry about it.) + + Here is a user-defined function (*note User-defined::) that +illustrates the use of these functions: + + # bits2str --- turn a byte into readable 1's and 0's + + function bits2str(bits, data, mask) + { + if (bits == 0) + return "0" + + mask = 1 + for (; bits != 0; bits = rshift(bits, 1)) + data = (and(bits, mask) ? "1" : "0") data + + while ((length(data) % 8) != 0) + data = "0" data + + return data + } + + BEGIN { + printf "123 = %s\n", bits2str(123) + printf "0123 = %s\n", bits2str(0123) + printf "0x99 = %s\n", bits2str(0x99) + comp = compl(0x99) + printf "compl(0x99) = %#x = %s\n", comp, bits2str(comp) + shift = lshift(0x99, 2) + printf "lshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift) + shift = rshift(0x99, 2) + printf "rshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift) + } + +This program produces the following output when run: + + $ gawk -f testbits.awk + -| 123 = 01111011 + -| 0123 = 01010011 + -| 0x99 = 10011001 + -| compl(0x99) = 0xffffff66 = 11111111111111111111111101100110 + -| lshift(0x99, 2) = 0x264 = 0000001001100100 + -| rshift(0x99, 2) = 0x26 = 00100110 + + The `bits2str' function turns a binary number into a string. The +number `1' represents a binary value where the rightmost bit is set to +1. Using this mask, the function repeatedly checks the rightmost bit. +ANDing the mask with the value indicates whether the rightmost bit is 1 +or not. If so, a `"1"' is concatenated onto the front of the string. +Otherwise, a `"0"' is added. The value is then shifted right by one +bit and the loop continues until there are no more 1 bits. + + If the initial value is zero it returns a simple `"0"'. Otherwise, +at the end, it pads the value with zeros to represent multiples of +8-bit quantities. This is typical in modern computers. + + The main code in the `BEGIN' rule shows the difference between the +decimal and octal values for the same numbers (*note +Nondecimal-numbers::), and then demonstrates the results of the +`compl', `lshift', and `rshift' functions. + + ---------- Footnotes ---------- + + (1) This example shows that 0's come in on the left side. For +`gawk', this is always true, but in some languages, it's possible to +have the left side fill with 1's. Caveat emptor. + + +File: gawk.info, Node: I18N Functions, Prev: Bitwise Functions, Up: Built-in + +8.1.7 Using `gawk''s String-Translation Functions +------------------------------------------------- + +`gawk' provides facilities for internationalizing `awk' programs. +These include the functions described in the following list. The +descriptions here are purposely brief. *Note Internationalization::, +for the full story. Optional parameters are enclosed in square +brackets ([ ]): + +`dcgettext(STRING [, DOMAIN [, CATEGORY]])' + This function returns the translation of STRING in text domain + DOMAIN for locale category CATEGORY. The default value for DOMAIN + is the current value of `TEXTDOMAIN'. The default value for + CATEGORY is `"LC_MESSAGES"'. + +`dcngettext(STRING1, STRING2, NUMBER [, DOMAIN [, CATEGORY]])' + This function returns the plural form used for NUMBER of the + translation of STRING1 and STRING2 in text domain DOMAIN for + locale category CATEGORY. STRING1 is the English singular variant + of a message, and STRING2 the English plural variant of the same + message. The default value for DOMAIN is the current value of + `TEXTDOMAIN'. The default value for CATEGORY is `"LC_MESSAGES"'. + +`bindtextdomain(DIRECTORY [, DOMAIN])' + This function allows you to specify the directory in which `gawk' + will look for message translation files, in case they will not or + cannot be placed in the "standard" locations (e.g., during + testing). It returns the directory in which DOMAIN is "bound." + + The default DOMAIN is the value of `TEXTDOMAIN'. If DIRECTORY is + the null string (`""'), then `bindtextdomain' returns the current + binding for the given DOMAIN. + + +File: gawk.info, Node: User-defined, Prev: Built-in, Up: Functions + +8.2 User-Defined Functions +========================== + +Complicated `awk' programs can often be simplified by defining your own +functions. User-defined functions can be called just like built-in +ones (*note Function Calls::), but it is up to you to define them, +i.e., to tell `awk' what they should do. + +* Menu: + +* Definition Syntax:: How to write definitions and what they mean. +* Function Example:: An example function definition and what it + does. +* Function Caveats:: Things to watch out for. +* Return Statement:: Specifying the value a function returns. +* Dynamic Typing:: How variable types can change at runtime. + + +File: gawk.info, Node: Definition Syntax, Next: Function Example, Up: User-defined + +8.2.1 Function Definition Syntax +-------------------------------- + +Definitions of functions can appear anywhere between the rules of an +`awk' program. Thus, the general form of an `awk' program is extended +to include sequences of rules _and_ user-defined function definitions. +There is no need to put the definition of a function before all uses of +the function. This is because `awk' reads the entire program before +starting to execute any of it. + + The definition of a function named NAME looks like this: + + function NAME(PARAMETER-LIST) + { + BODY-OF-FUNCTION + } + +NAME is the name of the function to define. A valid function name is +like a valid variable name: a sequence of letters, digits, and +underscores that doesn't start with a digit. Within a single `awk' +program, any particular name can only be used as a variable, array, or +function. + + PARAMETER-LIST is a list of the function's arguments and local +variable names, separated by commas. When the function is called, the +argument names are used to hold the argument values given in the call. +The local variables are initialized to the empty string. A function +cannot have two parameters with the same name, nor may it have a +parameter with the same name as the function itself. + + The BODY-OF-FUNCTION consists of `awk' statements. It is the most +important part of the definition, because it says what the function +should actually _do_. The argument names exist to give the body a way +to talk about the arguments; local variables exist to give the body +places to keep temporary values. + + Argument names are not distinguished syntactically from local +variable names. Instead, the number of arguments supplied when the +function is called determines how many argument variables there are. +Thus, if three argument values are given, the first three names in +PARAMETER-LIST are arguments and the rest are local variables. + + It follows that if the number of arguments is not the same in all +calls to the function, some of the names in PARAMETER-LIST may be +arguments on some occasions and local variables on others. Another way +to think of this is that omitted arguments default to the null string. + + Usually when you write a function, you know how many names you +intend to use for arguments and how many you intend to use as local +variables. It is conventional to place some extra space between the +arguments and the local variables, in order to document how your +function is supposed to be used. + + During execution of the function body, the arguments and local +variable values hide, or "shadow", any variables of the same names used +in the rest of the program. The shadowed variables are not accessible +in the function definition, because there is no way to name them while +their names have been taken away for the local variables. All other +variables used in the `awk' program can be referenced or set normally +in the function's body. + + The arguments and local variables last only as long as the function +body is executing. Once the body finishes, you can once again access +the variables that were shadowed while the function was running. + + The function body can contain expressions that call functions. They +can even call this function, either directly or by way of another +function. When this happens, we say the function is "recursive". The +act of a function calling itself is called "recursion". + + In many `awk' implementations, including `gawk', the keyword +`function' may be abbreviated `func'. However, POSIX only specifies +the use of the keyword `function'. This actually has some practical +implications. If `gawk' is in POSIX-compatibility mode (*note +Options::), then the following statement does _not_ define a function: + + func foo() { a = sqrt($1) ; print a } + +Instead it defines a rule that, for each record, concatenates the value +of the variable `func' with the return value of the function `foo'. If +the resulting string is non-null, the action is executed. This is +probably not what is desired. (`awk' accepts this input as +syntactically valid, because functions may be used before they are +defined in `awk' programs.) + + To ensure that your `awk' programs are portable, always use the +keyword `function' when defining a function. + + +File: gawk.info, Node: Function Example, Next: Function Caveats, Prev: Definition Syntax, Up: User-defined + +8.2.2 Function Definition Examples +---------------------------------- + +Here is an example of a user-defined function, called `myprint', that +takes a number and prints it in a specific format: + + function myprint(num) + { + printf "%6.3g\n", num + } + +To illustrate, here is an `awk' rule that uses our `myprint' function: + + $3 > 0 { myprint($3) } + +This program prints, in our special format, all the third fields that +contain a positive number in our input. Therefore, when given the +following: + + 1.2 3.4 5.6 7.8 + 9.10 11.12 -13.14 15.16 + 17.18 19.20 21.22 23.24 + +this program, using our function to format the results, prints: + + 5.6 + 21.2 + + This function deletes all the elements in an array: + + function delarray(a, i) + { + for (i in a) + delete a[i] + } + + When working with arrays, it is often necessary to delete all the +elements in an array and start over with a new list of elements (*note +Delete::). Instead of having to repeat this loop everywhere that you +need to clear out an array, your program can just call `delarray'. +(This guarantees portability. The use of `delete ARRAY' to delete the +contents of an entire array is a nonstandard extension.) + + The following is an example of a recursive function. It takes a +string as an input parameter and returns the string in backwards order. +Recursive functions must always have a test that stops the recursion. +In this case, the recursion terminates when the starting position is +zero, i.e., when there are no more characters left in the string. + + function rev(str, start) + { + if (start == 0) + return "" + + return (substr(str, start, 1) rev(str, start - 1)) + } + + If this function is in a file named `rev.awk', it can be tested this +way: + + $ echo "Don't Panic!" | + > gawk --source '{ print rev($0, length($0)) }' -f rev.awk + -| !cinaP t'noD + + The C `ctime' function takes a timestamp and returns it in a string, +formatted in a well-known fashion. The following example uses the +built-in `strftime' function (*note Time Functions::) to create an +`awk' version of `ctime': + + # ctime.awk + # + # awk version of C ctime(3) function + + function ctime(ts, format) + { + format = "%a %b %d %H:%M:%S %Z %Y" + if (ts == 0) + ts = systime() # use current time as default + return strftime(format, ts) + } + + +File: gawk.info, Node: Function Caveats, Next: Return Statement, Prev: Function Example, Up: User-defined + +8.2.3 Calling User-Defined Functions +------------------------------------ + +"Calling a function" means causing the function to run and do its job. +A function call is an expression and its value is the value returned by +the function. + + A function call consists of the function name followed by the +arguments in parentheses. `awk' expressions are what you write in the +call for the arguments. Each time the call is executed, these +expressions are evaluated, and the values are the actual arguments. For +example, here is a call to `foo' with three arguments (the first being +a string concatenation): + + foo(x y, "lose", 4 * z) + + *Caution:* Whitespace characters (spaces and tabs) are not allowed +between the function name and the open-parenthesis of the argument list. +If you write whitespace by mistake, `awk' might think that you mean to +concatenate a variable with an expression in parentheses. However, it +notices that you used a function name and not a variable name, and +reports an error. + + When a function is called, it is given a _copy_ of the values of its +arguments. This is known as "call by value". The caller may use a +variable as the expression for the argument, but the called function +does not know this--it only knows what value the argument had. For +example, if you write the following code: + + foo = "bar" + z = myfunc(foo) + +then you should not think of the argument to `myfunc' as being "the +variable `foo'." Instead, think of the argument as the string value +`"bar"'. If the function `myfunc' alters the values of its local +variables, this has no effect on any other variables. Thus, if `myfunc' +does this: + + function myfunc(str) + { + print str + str = "zzz" + print str + } + +to change its first argument variable `str', it does _not_ change the +value of `foo' in the caller. The role of `foo' in calling `myfunc' +ended when its value (`"bar"') was computed. If `str' also exists +outside of `myfunc', the function body cannot alter this outer value, +because it is shadowed during the execution of `myfunc' and cannot be +seen or changed from there. + + However, when arrays are the parameters to functions, they are _not_ +copied. Instead, the array itself is made available for direct +manipulation by the function. This is usually called "call by +reference". Changes made to an array parameter inside the body of a +function _are_ visible outside that function. + + NOTE: Changing an array parameter inside a function can be very + dangerous if you do not watch what you are doing. For example: + + function changeit(array, ind, nvalue) + { + array[ind] = nvalue + } + + BEGIN { + a[1] = 1; a[2] = 2; a[3] = 3 + changeit(a, 2, "two") + printf "a[1] = %s, a[2] = %s, a[3] = %s\n", + a[1], a[2], a[3] + } + + prints `a[1] = 1, a[2] = two, a[3] = 3', because `changeit' stores + `"two"' in the second element of `a'. + + Some `awk' implementations allow you to call a function that has not +been defined. They only report a problem at runtime when the program +actually tries to call the function. For example: + + BEGIN { + if (0) + foo() + else + bar() + } + function bar() { ... } + # note that `foo' is not defined + +Because the `if' statement will never be true, it is not really a +problem that `foo' has not been defined. Usually, though, it is a +problem if a program calls an undefined function. + + If `--lint' is specified (*note Options::), `gawk' reports calls to +undefined functions. + + Some `awk' implementations generate a runtime error if you use the +`next' statement (*note Next Statement::) inside a user-defined +function. `gawk' does not have this limitation. + + +File: gawk.info, Node: Return Statement, Next: Dynamic Typing, Prev: Function Caveats, Up: User-defined + +8.2.4 The `return' Statement +---------------------------- + +The body of a user-defined function can contain a `return' statement. +This statement returns control to the calling part of the `awk' +program. It can also be used to return a value for use in the rest of +the `awk' program. It looks like this: + + return [EXPRESSION] + + The EXPRESSION part is optional. If it is omitted, then the returned +value is undefined, and therefore, unpredictable. + + A `return' statement with no value expression is assumed at the end +of every function definition. So if control reaches the end of the +function body, then the function returns an unpredictable value. `awk' +does _not_ warn you if you use the return value of such a function. + + Sometimes, you want to write a function for what it does, not for +what it returns. Such a function corresponds to a `void' function in C +or to a `procedure' in Pascal. Thus, it may be appropriate to not +return any value; simply bear in mind that if you use the return value +of such a function, you do so at your own risk. + + The following is an example of a user-defined function that returns +a value for the largest number among the elements of an array: + + function maxelt(vec, i, ret) + { + for (i in vec) { + if (ret == "" || vec[i] > ret) + ret = vec[i] + } + return ret + } + +You call `maxelt' with one argument, which is an array name. The local +variables `i' and `ret' are not intended to be arguments; while there +is nothing to stop you from passing more than one argument to `maxelt', +the results would be strange. The extra space before `i' in the +function parameter list indicates that `i' and `ret' are not supposed +to be arguments. You should follow this convention when defining +functions. + + The following program uses the `maxelt' function. It loads an +array, calls `maxelt', and then reports the maximum number in that +array: + + function maxelt(vec, i, ret) + { + for (i in vec) { + if (ret == "" || vec[i] > ret) + ret = vec[i] + } + return ret + } + + # Load all fields of each record into nums. + { + for(i = 1; i <= NF; i++) + nums[NR, i] = $i + } + + END { + print maxelt(nums) + } + + Given the following input: + + 1 5 23 8 16 + 44 3 5 2 8 26 + 256 291 1396 2962 100 + -6 467 998 1101 + 99385 11 0 225 + +the program reports (predictably) that `99385' is the largest number in +the array. + + +File: gawk.info, Node: Dynamic Typing, Prev: Return Statement, Up: User-defined + +8.2.5 Functions and Their Effects on Variable Typing +---------------------------------------------------- + +`awk' is a very fluid language. It is possible that `awk' can't tell +if an identifier represents a regular variable or an array until +runtime. Here is an annotated sample program: + + function foo(a) + { + a[1] = 1 # parameter is an array + } + + BEGIN { + b = 1 + foo(b) # invalid: fatal type mismatch + + foo(x) # x uninitialized, becomes an array dynamically + x = 1 # now not allowed, runtime error + } + + Usually, such things aren't a big issue, but it's worth being aware +of them. + + +File: gawk.info, Node: Internationalization, Next: Advanced Features, Prev: Functions, Up: Top + +9 Internationalization with `gawk' +********************************** + +Once upon a time, computer makers wrote software that worked only in +English. Eventually, hardware and software vendors noticed that if +their systems worked in the native languages of non-English-speaking +countries, they were able to sell more systems. As a result, +internationalization and localization of programs and software systems +became a common practice. + + Until recently, the ability to provide internationalization was +largely restricted to programs written in C and C++. This major node +describes the underlying library `gawk' uses for internationalization, +as well as how `gawk' makes internationalization features available at +the `awk' program level. Having internationalization available at the +`awk' level gives software developers additional flexibility--they are +no longer required to write in C when internationalization is a +requirement. + +* Menu: + +* I18N and L10N:: Internationalization and Localization. +* Explaining gettext:: How GNU `gettext' works. +* Programmer i18n:: Features for the programmer. +* Translator i18n:: Features for the translator. +* I18N Example:: A simple i18n example. +* Gawk I18N:: `gawk' is also internationalized. + + +File: gawk.info, Node: I18N and L10N, Next: Explaining gettext, Up: Internationalization + +9.1 Internationalization and Localization +========================================= + +"Internationalization" means writing (or modifying) a program once, in +such a way that it can use multiple languages without requiring further +source-code changes. "Localization" means providing the data necessary +for an internationalized program to work in a particular language. +Most typically, these terms refer to features such as the language used +for printing error messages, the language used to read responses, and +information related to how numerical and monetary values are printed +and read. + + +File: gawk.info, Node: Explaining gettext, Next: Programmer i18n, Prev: I18N and L10N, Up: Internationalization + +9.2 GNU `gettext' +================= + +The facilities in GNU `gettext' focus on messages; strings printed by a +program, either directly or via formatting with `printf' or +`sprintf'.(1) + + When using GNU `gettext', each application has its own "text +domain". This is a unique name, such as `kpilot' or `gawk', that +identifies the application. A complete application may have multiple +components--programs written in C or C++, as well as scripts written in +`sh' or `awk'. All of the components use the same text domain. + + To make the discussion concrete, assume we're writing an application +named `guide'. Internationalization consists of the following steps, +in this order: + + 1. The programmer goes through the source for all of `guide''s + components and marks each string that is a candidate for + translation. For example, `"`-F': option required"' is a good + candidate for translation. A table with strings of option names + is not (e.g., `gawk''s `--profile' option should remain the same, + no matter what the local language). + + 2. The programmer indicates the application's text domain (`"guide"') + to the `gettext' library, by calling the `textdomain' function. + + 3. Messages from the application are extracted from the source code + and collected into a portable object file (`guide.po'), which + lists the strings and their translations. The translations are + initially empty. The original (usually English) messages serve as + the key for lookup of the translations. + + 4. For each language with a translator, `guide.po' is copied and + translations are created and shipped with the application. + + 5. Each language's `.po' file is converted into a binary message + object (`.mo') file. A message object file contains the original + messages and their translations in a binary format that allows + fast lookup of translations at runtime. + + 6. When `guide' is built and installed, the binary translation files + are installed in a standard place. + + 7. For testing and development, it is possible to tell `gettext' to + use `.mo' files in a different directory than the standard one by + using the `bindtextdomain' function. + + 8. At runtime, `guide' looks up each string via a call to `gettext'. + The returned string is the translated string if available, or the + original string if not. + + 9. If necessary, it is possible to access messages from a different + text domain than the one belonging to the application, without + having to switch the application's default text domain back and + forth. + + In C (or C++), the string marking and dynamic translation lookup are +accomplished by wrapping each string in a call to `gettext': + + printf(gettext("Don't Panic!\n")); + + The tools that extract messages from source code pull out all +strings enclosed in calls to `gettext'. + + The GNU `gettext' developers, recognizing that typing `gettext' over +and over again is both painful and ugly to look at, use the macro `_' +(an underscore) to make things easier: + + /* In the standard header file: */ + #define _(str) gettext(str) + + /* In the program text: */ + printf(_("Don't Panic!\n")); + +This reduces the typing overhead to just three extra characters per +string and is considerably easier to read as well. There are locale +"categories" for different types of locale-related information. The +defined locale categories that `gettext' knows about are: + +`LC_MESSAGES' + Text messages. This is the default category for `gettext' + operations, but it is possible to supply a different one + explicitly, if necessary. (It is almost never necessary to supply + a different category.) + +`LC_COLLATE' + Text-collation information; i.e., how different characters and/or + groups of characters sort in a given language. + +`LC_CTYPE' + Character-type information (alphabetic, digit, upper- or + lowercase, and so on). This information is accessed via the POSIX + character classes in regular expressions, such as `/[[:alnum:]]/' + (*note Regexp Operators::). + +`LC_MONETARY' + Monetary information, such as the currency symbol, and whether the + symbol goes before or after a number. + +`LC_NUMERIC' + Numeric information, such as which characters to use for the + decimal point and the thousands separator.(2) + +`LC_RESPONSE' + Response information, such as how "yes" and "no" appear in the + local language, and possibly other information as well. + +`LC_TIME' + Time- and date-related information, such as 12- or 24-hour clock, + month printed before or after day in a date, local month + abbreviations, and so on. + +`LC_ALL' + All of the above. (Not too useful in the context of `gettext'.) + + ---------- Footnotes ---------- + + (1) For some operating systems, the `gawk' port doesn't support GNU +`gettext'. This applies most notably to the PC operating systems. As +such, these features are not available if you are using one of those +operating systems. Sorry. + + (2) Americans use a comma every three decimal places and a period +for the decimal point, while many Europeans do exactly the opposite: +`1,234.56' versus `1.234,56'. + + +File: gawk.info, Node: Programmer i18n, Next: Translator i18n, Prev: Explaining gettext, Up: Internationalization + +9.3 Internationalizing `awk' Programs +===================================== + +`gawk' provides the following variables and functions for +internationalization: + +`TEXTDOMAIN' + This variable indicates the application's text domain. For + compatibility with GNU `gettext', the default value is + `"messages"'. + +`_"your message here"' + String constants marked with a leading underscore are candidates + for translation at runtime. String constants without a leading + underscore are not translated. + +`dcgettext(STRING [, DOMAIN [, CATEGORY]])' + This built-in function returns the translation of STRING in text + domain DOMAIN for locale category CATEGORY. The default value for + DOMAIN is the current value of `TEXTDOMAIN'. The default value + for CATEGORY is `"LC_MESSAGES"'. + + If you supply a value for CATEGORY, it must be a string equal to + one of the known locale categories described in *note Explaining + gettext::. You must also supply a text domain. Use `TEXTDOMAIN' + if you want to use the current domain. + + *Caution:* The order of arguments to the `awk' version of the + `dcgettext' function is purposely different from the order for the + C version. The `awk' version's order was chosen to be simple and + to allow for reasonable `awk'-style default arguments. + +`dcngettext(STRING1, STRING2, NUMBER [, DOMAIN [, CATEGORY]])' + This built-in function returns the plural form used for NUMBER of + the translation of STRING1 and STRING2 in text domain DOMAIN for + locale category CATEGORY. STRING1 is the English singular variant + of a message, and STRING2 the English plural variant of the same + message. The default value for DOMAIN is the current value of + `TEXTDOMAIN'. The default value for CATEGORY is `"LC_MESSAGES"'. + + The same remarks as for the `dcgettext' function apply. + +`bindtextdomain(DIRECTORY [, DOMAIN])' + This built-in function allows you to specify the directory in which + `gettext' looks for `.mo' files, in case they will not or cannot + be placed in the standard locations (e.g., during testing). It + returns the directory in which DOMAIN is "bound." + + The default DOMAIN is the value of `TEXTDOMAIN'. If DIRECTORY is + the null string (`""'), then `bindtextdomain' returns the current + binding for the given DOMAIN. + + To use these facilities in your `awk' program, follow the steps +outlined in *note Explaining gettext::, like so: + + 1. Set the variable `TEXTDOMAIN' to the text domain of your program. + This is best done in a `BEGIN' rule (*note BEGIN/END::), or it can + also be done via the `-v' command-line option (*note Options::): + + BEGIN { + TEXTDOMAIN = "guide" + ... + } + + 2. Mark all translatable strings with a leading underscore (`_') + character. It _must_ be adjacent to the opening quote of the + string. For example: + + print _"hello, world" + x = _"you goofed" + printf(_"Number of users is %d\n", nusers) + + 3. If you are creating strings dynamically, you can still translate + them, using the `dcgettext' built-in function: + + message = nusers " users logged in" + message = dcgettext(message, "adminprog") + print message + + Here, the call to `dcgettext' supplies a different text domain + (`"adminprog"') in which to find the message, but it uses the + default `"LC_MESSAGES"' category. + + 4. During development, you might want to put the `.mo' file in a + private directory for testing. This is done with the + `bindtextdomain' built-in function: + + BEGIN { + TEXTDOMAIN = "guide" # our text domain + if (Testing) { + # where to find our files + bindtextdomain("testdir") + # joe is in charge of adminprog + bindtextdomain("../joe/testdir", "adminprog") + } + ... + } + + + *Note I18N Example::, for an example program showing the steps to +create and use translations from `awk'. + + +File: gawk.info, Node: Translator i18n, Next: I18N Example, Prev: Programmer i18n, Up: Internationalization + +9.4 Translating `awk' Programs +============================== + +Once a program's translatable strings have been marked, they must be +extracted to create the initial `.po' file. As part of translation, it +is often helpful to rearrange the order in which arguments to `printf' +are output. + + `gawk''s `--gen-po' command-line option extracts the messages and is +discussed next. After that, `printf''s ability to rearrange the order +for `printf' arguments at runtime is covered. + +* Menu: + +* String Extraction:: Extracting marked strings. +* Printf Ordering:: Rearranging `printf' arguments. +* I18N Portability:: `awk'-level portability issues. + + +File: gawk.info, Node: String Extraction, Next: Printf Ordering, Up: Translator i18n + +9.4.1 Extracting Marked Strings +------------------------------- + +Once your `awk' program is working, and all the strings have been +marked and you've set (and perhaps bound) the text domain, it is time +to produce translations. First, use the `--gen-po' command-line option +to create the initial `.po' file: + + $ gawk --gen-po -f guide.awk > guide.po + + When run with `--gen-po', `gawk' does not execute your program. +Instead, it parses it as usual and prints all marked strings to +standard output in the format of a GNU `gettext' Portable Object file. +Also included in the output are any constant strings that appear as the +first argument to `dcgettext' or as the first and second argument to +`dcngettext'.(1) *Note I18N Example::, for the full list of steps to go +through to create and test translations for `guide'. + + ---------- Footnotes ---------- + + (1) Starting with `gettext' version 0.11.5, the `xgettext' utility +that comes with GNU `gettext' can handle `.awk' files. + + +File: gawk.info, Node: Printf Ordering, Next: I18N Portability, Prev: String Extraction, Up: Translator i18n + +9.4.2 Rearranging `printf' Arguments +------------------------------------ + +Format strings for `printf' and `sprintf' (*note Printf::) present a +special problem for translation. Consider the following:(1) + + printf(_"String `%s' has %d characters\n", + string, length(string))) + + A possible German translation for this might be: + + "%d Zeichen lang ist die Zeichenkette `%s'\n" + + The problem should be obvious: the order of the format +specifications is different from the original! Even though `gettext' +can return the translated string at runtime, it cannot change the +argument order in the call to `printf'. + + To solve this problem, `printf' format specifiers may have an +additional optional element, which we call a "positional specifier". +For example: + + "%2$d Zeichen lang ist die Zeichenkette `%1$s'\n" + + Here, the positional specifier consists of an integer count, which +indicates which argument to use, and a `$'. Counts are one-based, and +the format string itself is _not_ included. Thus, in the following +example, `string' is the first argument and `length(string)' is the +second: + + $ gawk 'BEGIN { + > string = "Dont Panic" + > printf _"%2$d characters live in \"%1$s\"\n", + > string, length(string) + > }' + -| 10 characters live in "Dont Panic" + + If present, positional specifiers come first in the format +specification, before the flags, the field width, and/or the precision. + + Positional specifiers can be used with the dynamic field width and +precision capability: + + $ gawk 'BEGIN { + > printf("%*.*s\n", 10, 20, "hello") + > printf("%3$*2$.*1$s\n", 20, 10, "hello") + > }' + -| hello + -| hello + + NOTE: When using `*' with a positional specifier, the `*' comes + first, then the integer position, and then the `$'. This is + somewhat counterintuitive. + + `gawk' does not allow you to mix regular format specifiers and those +with positional specifiers in the same string: + + $ gawk 'BEGIN { printf _"%d %3$s\n", 1, 2, "hi" }' + error--> gawk: cmd. line:1: fatal: must use `count$' on all formats or none + + NOTE: There are some pathological cases that `gawk' may fail to + diagnose. In such cases, the output may not be what you expect. + It's still a bad idea to try mixing them, even if `gawk' doesn't + detect it. + + Although positional specifiers can be used directly in `awk' +programs, their primary purpose is to help in producing correct +translations of format strings into languages different from the one in +which the program is first written. + + ---------- Footnotes ---------- + + (1) This example is borrowed from the GNU `gettext' manual. + + +File: gawk.info, Node: I18N Portability, Prev: Printf Ordering, Up: Translator i18n + +9.4.3 `awk' Portability Issues +------------------------------ + +`gawk''s internationalization features were purposely chosen to have as +little impact as possible on the portability of `awk' programs that use +them to other versions of `awk'. Consider this program: + + BEGIN { + TEXTDOMAIN = "guide" + if (Test_Guide) # set with -v + bindtextdomain("/test/guide/messages") + print _"don't panic!" + } + +As written, it won't work on other versions of `awk'. However, it is +actually almost portable, requiring very little change: + + * Assignments to `TEXTDOMAIN' won't have any effect, since + `TEXTDOMAIN' is not special in other `awk' implementations. + + * Non-GNU versions of `awk' treat marked strings as the + concatenation of a variable named `_' with the string following + it.(1) Typically, the variable `_' has the null string (`""') as + its value, leaving the original string constant as the result. + + * By defining "dummy" functions to replace `dcgettext', `dcngettext' + and `bindtextdomain', the `awk' program can be made to run, but + all the messages are output in the original language. For example: + + function bindtextdomain(dir, domain) + { + return dir + } + + function dcgettext(string, domain, category) + { + return string + } + + function dcngettext(string1, string2, number, domain, category) + { + return (number == 1 ? string1 : string2) + } + + * The use of positional specifications in `printf' or `sprintf' is + _not_ portable. To support `gettext' at the C level, many + systems' C versions of `sprintf' do support positional specifiers. + But it works only if enough arguments are supplied in the function + call. Many versions of `awk' pass `printf' formats and arguments + unchanged to the underlying C library version of `sprintf', but + only one format and argument at a time. What happens if a + positional specification is used is anybody's guess. However, + since the positional specifications are primarily for use in + _translated_ format strings, and since non-GNU `awk's never + retrieve the translated string, this should not be a problem in + practice. + + ---------- Footnotes ---------- + + (1) This is good fodder for an "Obfuscated `awk'" contest. + + +File: gawk.info, Node: I18N Example, Next: Gawk I18N, Prev: Translator i18n, Up: Internationalization + +9.5 A Simple Internationalization Example +========================================= + +Now let's look at a step-by-step example of how to internationalize and +localize a simple `awk' program, using `guide.awk' as our original +source: + + BEGIN { + TEXTDOMAIN = "guide" + bindtextdomain(".") # for testing + print _"Don't Panic" + print _"The Answer Is", 42 + print "Pardon me, Zaphod who?" + } + +Run `gawk --gen-po' to create the `.po' file: + + $ gawk --gen-po -f guide.awk > guide.po + +This produces: + + #: guide.awk:4 + msgid "Don't Panic" + msgstr "" + + #: guide.awk:5 + msgid "The Answer Is" + msgstr "" + + This original portable object file is saved and reused for each +language into which the application is translated. The `msgid' is the +original string and the `msgstr' is the translation. + + NOTE: Strings not marked with a leading underscore do not appear + in the `guide.po' file. + + Next, the messages must be translated. Here is a translation to a +hypothetical dialect of English, called "Mellow":(1) + + $ cp guide.po guide-mellow.po + ADD TRANSLATIONS TO guide-mellow.po ... + +Following are the translations: + + #: guide.awk:4 + msgid "Don't Panic" + msgstr "Hey man, relax!" + + #: guide.awk:5 + msgid "The Answer Is" + msgstr "Like, the scoop is" + + The next step is to make the directory to hold the binary message +object file and then to create the `guide.mo' file. The directory +layout shown here is standard for GNU `gettext' on GNU/Linux systems. +Other versions of `gettext' may use a different layout: + + $ mkdir en_US en_US/LC_MESSAGES + + The `msgfmt' utility does the conversion from human-readable `.po' +file to machine-readable `.mo' file. By default, `msgfmt' creates a +file named `messages'. This file must be renamed and placed in the +proper directory so that `gawk' can find it: + + $ msgfmt guide-mellow.po + $ mv messages en_US/LC_MESSAGES/guide.mo + + Finally, we run the program to test it: + + $ gawk -f guide.awk + -| Hey man, relax! + -| Like, the scoop is 42 + -| Pardon me, Zaphod who? + + If the three replacement functions for `dcgettext', `dcngettext' and +`bindtextdomain' (*note I18N Portability::) are in a file named +`libintl.awk', then we can run `guide.awk' unchanged as follows: + + $ gawk --posix -f guide.awk -f libintl.awk + -| Don't Panic + -| The Answer Is 42 + -| Pardon me, Zaphod who? + + ---------- Footnotes ---------- + + (1) Perhaps it would be better if it were called "Hippy." Ah, well. + + +File: gawk.info, Node: Gawk I18N, Prev: I18N Example, Up: Internationalization + +9.6 `gawk' Can Speak Your Language +================================== + +As of version 3.1, `gawk' itself has been internationalized using the +GNU `gettext' package. (GNU `gettext' is described in complete detail +in *note Top::.) As of this writing, the latest version of GNU +`gettext' is version 0.11.5 +(ftp://ftp.gnu.org/gnu/gettext/gettext-0.11.5.tar.gz). + + If a translation of `gawk''s messages exists, then `gawk' produces +usage messages, warnings, and fatal errors in the local language. + + +File: gawk.info, Node: Advanced Features, Next: Invoking Gawk, Prev: Internationalization, Up: Top + +10 Advanced Features of `gawk' +****************************** + + Write documentation as if whoever reads it is a violent psychopath + who knows where you live. + Steve English, as quoted by Peter Langston + + This major node discusses advanced features in `gawk'. It's a bit +of a "grab bag" of items that are otherwise unrelated to each other. +First, a command-line option allows `gawk' to recognize nondecimal +numbers in input data, not just in `awk' programs. Next, two-way I/O, +discussed briefly in earlier parts of this Info file, is described in +full detail, along with the basics of TCP/IP networking and BSD portal +files. Finally, `gawk' can "profile" an `awk' program, making it +possible to tune it for performance. + + *note Dynamic Extensions::, discusses the ability to dynamically add +new built-in functions to `gawk'. As this feature is still immature +and likely to change, its description is relegated to an appendix. + +* Menu: + +* Nondecimal Data:: Allowing nondecimal input data. +* Two-way I/O:: Two-way communications with another process. +* TCP/IP Networking:: Using `gawk' for network programming. +* Portal Files:: Using `gawk' with BSD portals. +* Profiling:: Profiling your `awk' programs. + + +File: gawk.info, Node: Nondecimal Data, Next: Two-way I/O, Up: Advanced Features + +10.1 Allowing Nondecimal Input Data +=================================== + +If you run `gawk' with the `--non-decimal-data' option, you can have +nondecimal constants in your input data: + + $ echo 0123 123 0x123 | + > gawk --non-decimal-data '{ printf "%d, %d, %d\n", + > $1, $2, $3 }' + -| 83, 123, 291 + + For this feature to work, write your program so that `gawk' treats +your data as numeric: + + $ echo 0123 123 0x123 | gawk '{ print $1, $2, $3 }' + -| 0123 123 0x123 + +The `print' statement treats its expressions as strings. Although the +fields can act as numbers when necessary, they are still strings, so +`print' does not try to treat them numerically. You may need to add +zero to a field to force it to be treated as a number. For example: + + $ echo 0123 123 0x123 | gawk --non-decimal-data ' + > { print $1, $2, $3 + > print $1 + 0, $2 + 0, $3 + 0 }' + -| 0123 123 0x123 + -| 83 123 291 + + Because it is common to have decimal data with leading zeros, and +because using it could lead to surprising results, the default is to +leave this facility disabled. If you want it, you must explicitly +request it. + + *Caution:* _Use of this option is not recommended._ It can break old +programs very badly. Instead, use the `strtonum' function to convert +your data (*note Nondecimal-numbers::). This makes your programs +easier to write and easier to read, and leads to less surprising +results. + + +File: gawk.info, Node: Two-way I/O, Next: TCP/IP Networking, Prev: Nondecimal Data, Up: Advanced Features + +10.2 Two-Way Communications with Another Process +================================================ + + From: brennan@whidbey.com (Mike Brennan) + Newsgroups: comp.lang.awk + Subject: Re: Learn the SECRET to Attract Women Easily + Date: 4 Aug 1997 17:34:46 GMT + Message-ID: <5s53rm$eca@news.whidbey.com> + + On 3 Aug 1997 13:17:43 GMT, Want More Dates??? + <tracy78@kilgrona.com> wrote: + >Learn the SECRET to Attract Women Easily + > + >The SCENT(tm) Pheromone Sex Attractant For Men to Attract Women + + The scent of awk programmers is a lot more attractive to women than + the scent of perl programmers. + -- + Mike Brennan + + It is often useful to be able to send data to a separate program for +processing and then read the result. This can always be done with +temporary files: + + # write the data for processing + tempfile = ("mydata." PROCINFO["pid"]) + while (NOT DONE WITH DATA) + print DATA | ("subprogram > " tempfile) + close("subprogram > " tempfile) + + # read the results, remove tempfile when done + while ((getline newdata < tempfile) > 0) + PROCESS newdata APPROPRIATELY + close(tempfile) + system("rm " tempfile) + +This works, but not elegantly. Among other things, it requires that +the program be run in a directory that cannot be shared among users; +for example, `/tmp' will not do, as another user might happen to be +using a temporary file with the same name. + + Starting with version 3.1 of `gawk', it is possible to open a +_two-way_ pipe to another process. The second process is termed a +"coprocess", since it runs in parallel with `gawk'. The two-way +connection is created using the new `|&' operator (borrowed from the +Korn shell, `ksh'):(1) + + do { + print DATA |& "subprogram" + "subprogram" |& getline results + } while (DATA LEFT TO PROCESS) + close("subprogram") + + The first time an I/O operation is executed using the `|&' operator, +`gawk' creates a two-way pipeline to a child process that runs the +other program. Output created with `print' or `printf' is written to +the program's standard input, and output from the program's standard +output can be read by the `gawk' program using `getline'. As is the +case with processes started by `|', the subprogram can be any program, +or pipeline of programs, that can be started by the shell. + + There are some cautionary items to be aware of: + + * As the code inside `gawk' currently stands, the coprocess's + standard error goes to the same place that the parent `gawk''s + standard error goes. It is not possible to read the child's + standard error separately. + + * I/O buffering may be a problem. `gawk' automatically flushes all + output down the pipe to the child process. However, if the + coprocess does not flush its output, `gawk' may hang when doing a + `getline' in order to read the coprocess's results. This could + lead to a situation known as "deadlock", where each process is + waiting for the other one to do something. + + It is possible to close just one end of the two-way pipe to a +coprocess, by supplying a second argument to the `close' function of +either `"to"' or `"from"' (*note Close Files And Pipes::). These +strings tell `gawk' to close the end of the pipe that sends data to the +process or the end that reads from it, respectively. + + This is particularly necessary in order to use the system `sort' +utility as part of a coprocess; `sort' must read _all_ of its input +data before it can produce any output. The `sort' program does not +receive an end-of-file indication until `gawk' closes the write end of +the pipe. + + When you have finished writing data to the `sort' utility, you can +close the `"to"' end of the pipe, and then start reading sorted data +via `getline'. For example: + + BEGIN { + command = "LC_ALL=C sort" + n = split("abcdefghijklmnopqrstuvwxyz", a, "") + + for (i = n; i > 0; i--) + print a[i] |& command + close(command, "to") + + while ((command |& getline line) > 0) + print "got", line + close(command) + } + + This program writes the letters of the alphabet in reverse order, one +per line, down the two-way pipe to `sort'. It then closes the write +end of the pipe, so that `sort' receives an end-of-file indication. +This causes `sort' to sort the data and write the sorted data back to +the `gawk' program. Once all of the data has been read, `gawk' +terminates the coprocess and exits. + + As a side note, the assignment `LC_ALL=C' in the `sort' command +ensures traditional Unix (ASCII) sorting from `sort'. + + Beginning with `gawk' 3.1.2, you may use Pseudo-ttys (ptys) for +two-way communication instead of pipes, if your system supports them. +This is done on a per-command basis, by setting a special element in +the `PROCINFO' array (*note Auto-set::), like so: + + command = "sort -nr" # command, saved in variable for convenience + PROCINFO[command, "pty"] = 1 # update PROCINFO + print ... |& command # start two-way pipe + ... + +Using ptys avoids the buffer deadlock issues described earlier, at some +loss in performance. If your system does not have ptys, or if all the +system's ptys are in use, `gawk' automatically falls back to using +regular pipes. + + ---------- Footnotes ---------- + + (1) This is very different from the same operator in the C shell, +`csh'. + + +File: gawk.info, Node: TCP/IP Networking, Next: Portal Files, Prev: Two-way I/O, Up: Advanced Features + +10.3 Using `gawk' for Network Programming +========================================= + + `EMISTERED': A host is a host from coast to coast, + and no-one can talk to host that's close, + unless the host that isn't close + is busy hung or dead. + + In addition to being able to open a two-way pipeline to a coprocess +on the same system (*note Two-way I/O::), it is possible to make a +two-way connection to another process on another system across an IP +networking connection. + + You can think of this as just a _very long_ two-way pipeline to a +coprocess. The way `gawk' decides that you want to use TCP/IP +networking is by recognizing special file names that begin with +`/inet/'. + + The full syntax of the special file name is +`/inet/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT'. The components +are: + +PROTOCOL + The protocol to use over IP. This must be either `tcp', `udp', or + `raw', for a TCP, UDP, or raw IP connection, respectively. The + use of TCP is recommended for most applications. + + *Caution:* The use of raw sockets is not currently supported in + version 3.1 of `gawk'. + +LOCAL-PORT + The local TCP or UDP port number to use. Use a port number of `0' + when you want the system to pick a port. This is what you should do + when writing a TCP or UDP client. You may also use a well-known + service name, such as `smtp' or `http', in which case `gawk' + attempts to determine the predefined port number using the C + `getservbyname' function. + +REMOTE-HOST + The IP address or fully-qualified domain name of the Internet host + to which you want to connect. + +REMOTE-PORT + The TCP or UDP port number to use on the given REMOTE-HOST. + Again, use `0' if you don't care, or else a well-known service + name. + + Consider the following very simple example: + + BEGIN { + Service = "/inet/tcp/0/localhost/daytime" + Service |& getline + print $0 + close(Service) + } + + This program reads the current date and time from the local system's +TCP `daytime' server. It then prints the results and closes the +connection. + + Because this topic is extensive, the use of `gawk' for TCP/IP +programming is documented separately. *Note Top::, for a much more +complete introduction and discussion, as well as extensive examples. + + +File: gawk.info, Node: Portal Files, Next: Profiling, Prev: TCP/IP Networking, Up: Advanced Features + +10.4 Using `gawk' with BSD Portals +================================== + +Similar to the `/inet' special files, if `gawk' is configured with the +`--enable-portals' option (*note Quick Installation::), then `gawk' +treats files whose pathnames begin with `/p' as 4.4 BSD-style portals. + + When used with the `|&' operator, `gawk' opens the file for two-way +communications. The operating system's portal mechanism then manages +creating the process associated with the portal and the corresponding +communications with the portal's process. + + +File: gawk.info, Node: Profiling, Prev: Portal Files, Up: Advanced Features + +10.5 Profiling Your `awk' Programs +================================== + +Beginning with version 3.1 of `gawk', you may produce execution traces +of your `awk' programs. This is done with a specially compiled version +of `gawk', called `pgawk' ("profiling `gawk'"). + + `pgawk' is identical in every way to `gawk', except that when it has +finished running, it creates a profile of your program in a file named +`awkprof.out'. Because it is profiling, it also executes up to 45% +slower than `gawk' normally does. + + As shown in the following example, the `--profile' option can be +used to change the name of the file where `pgawk' will write the +profile: + + $ pgawk --profile=myprog.prof -f myprog.awk data1 data2 + +In the above example, `pgawk' places the profile in `myprog.prof' +instead of in `awkprof.out'. + + Regular `gawk' also accepts this option. When called with just +`--profile', `gawk' "pretty prints" the program into `awkprof.out', +without any execution counts. You may supply an option to `--profile' +to change the file name. Here is a sample session showing a simple +`awk' program, its input data, and the results from running `pgawk'. +First, the `awk' program: + + BEGIN { print "First BEGIN rule" } + + END { print "First END rule" } + + /foo/ { + print "matched /foo/, gosh" + for (i = 1; i <= 3; i++) + sing() + } + + { + if (/foo/) + print "if is true" + else + print "else is true" + } + + BEGIN { print "Second BEGIN rule" } + + END { print "Second END rule" } + + function sing( dummy) + { + print "I gotta be me!" + } + + Following is the input data: + + foo + bar + baz + foo + junk + + Here is the `awkprof.out' that results from running `pgawk' on this +program and data (this example also illustrates that `awk' programmers +sometimes have to work late): + + # gawk profile, created Sun Aug 13 00:00:15 2000 + + # BEGIN block(s) + + BEGIN { + 1 print "First BEGIN rule" + 1 print "Second BEGIN rule" + } + + # Rule(s) + + 5 /foo/ { # 2 + 2 print "matched /foo/, gosh" + 6 for (i = 1; i <= 3; i++) { + 6 sing() + } + } + + 5 { + 5 if (/foo/) { # 2 + 2 print "if is true" + 3 } else { + 3 print "else is true" + } + } + + # END block(s) + + END { + 1 print "First END rule" + 1 print "Second END rule" + } + + # Functions, listed alphabetically + + 6 function sing(dummy) + { + 6 print "I gotta be me!" + } + + This example illustrates many of the basic rules for profiling +output. The rules are as follows: + + * The program is printed in the order `BEGIN' rule, pattern/action + rules, `END' rule and functions, listed alphabetically. Multiple + `BEGIN' and `END' rules are merged together. + + * Pattern-action rules have two counts. The first count, to the + left of the rule, shows how many times the rule's pattern was + _tested_. The second count, to the right of the rule's opening + left brace in a comment, shows how many times the rule's action + was _executed_. The difference between the two indicates how many + times the rule's pattern evaluated to false. + + * Similarly, the count for an `if'-`else' statement shows how many + times the condition was tested. To the right of the opening left + brace for the `if''s body is a count showing how many times the + condition was true. The count for the `else' indicates how many + times the test failed. + + * The count for a loop header (such as `for' or `while') shows how + many times the loop test was executed. (Because of this, you + can't just look at the count on the first statement in a rule to + determine how many times the rule was executed. If the first + statement is a loop, the count is misleading.) + + * For user-defined functions, the count next to the `function' + keyword indicates how many times the function was called. The + counts next to the statements in the body show how many times + those statements were executed. + + * The layout uses "K&R" style with tabs. Braces are used + everywhere, even when the body of an `if', `else', or loop is only + a single statement. + + * Parentheses are used only where needed, as indicated by the + structure of the program and the precedence rules. For example, + `(3 + 5) * 4' means add three plus five, then multiply the total + by four. However, `3 + 5 * 4' has no parentheses, and means `3 + + (5 * 4)'. + + * Parentheses are used around the arguments to `print' and `printf' + only when the `print' or `printf' statement is followed by a + redirection. Similarly, if the target of a redirection isn't a + scalar, it gets parenthesized. + + * `pgawk' supplies leading comments in front of the `BEGIN' and + `END' rules, the pattern/action rules, and the functions. + + + The profiled version of your program may not look exactly like what +you typed when you wrote it. This is because `pgawk' creates the +profiled version by "pretty printing" its internal representation of +the program. The advantage to this is that `pgawk' can produce a +standard representation. The disadvantage is that all source-code +comments are lost, as are the distinctions among multiple `BEGIN' and +`END' rules. Also, things such as: + + /foo/ + +come out as: + + /foo/ { + print $0 + } + +which is correct, but possibly surprising. + + Besides creating profiles when a program has completed, `pgawk' can +produce a profile while it is running. This is useful if your `awk' +program goes into an infinite loop and you want to see what has been +executed. To use this feature, run `pgawk' in the background: + + $ pgawk -f myprog & + [1] 13992 + +The shell prints a job number and process ID number; in this case, +13992. Use the `kill' command to send the `USR1' signal to `pgawk': + + $ kill -USR1 13992 + +As usual, the profiled version of the program is written to +`awkprof.out', or to a different file if you use the `--profile' option. + + Along with the regular profile, as shown earlier, the profile +includes a trace of any active functions: + + # Function Call Stack: + + # 3. baz + # 2. bar + # 1. foo + # -- main -- + + You may send `pgawk' the `USR1' signal as many times as you like. +Each time, the profile and function call trace are appended to the +output profile file. + + If you use the `HUP' signal instead of the `USR1' signal, `pgawk' +produces the profile and the function call trace and then exits. + + When `pgawk' runs on MS-DOS or MS-Windows, it uses the `INT' and +`QUIT' signals for producing the profile and, in the case of the `INT' +signal, `pgawk' exits. This is because these systems don't support the +`kill' command, so the only signals you can deliver to a program are +those generated by the keyboard. The `INT' signal is generated by the +`Ctrl-<C>' or `Ctrl-<BREAK>' key, while the `QUIT' signal is generated +by the `Ctrl-<\>' key. + + +File: gawk.info, Node: Invoking Gawk, Next: Library Functions, Prev: Advanced Features, Up: Top + +11 Running `awk' and `gawk' +*************************** + +This major node covers how to run awk, both POSIX-standard and +`gawk'-specific command-line options, and what `awk' and `gawk' do with +non-option arguments. It then proceeds to cover how `gawk' searches +for source files, obsolete options and/or features, and known bugs in +`gawk'. This major node rounds out the discussion of `awk' as a +program and as a language. + + While a number of the options and features described here were +discussed in passing earlier in the book, this major node provides the +full details. + +* Menu: + +* Command Line:: How to run `awk'. +* Options:: Command-line options and their meanings. +* Other Arguments:: Input file names and variable assignments. +* AWKPATH Variable:: Searching directories for `awk' + programs. +* Obsolete:: Obsolete Options and/or features. +* Undocumented:: Undocumented Options and Features. +* Known Bugs:: Known Bugs in `gawk'. + + +File: gawk.info, Node: Command Line, Next: Options, Up: Invoking Gawk + +11.1 Invoking `awk' +=================== + +There are two ways to run `awk'--with an explicit program or with one +or more program files. Here are templates for both of them; items +enclosed in [...] in these templates are optional: + + awk [OPTIONS] -f progfile [`--'] FILE ... + awk [OPTIONS] [`--'] 'PROGRAM' FILE ... + + Besides traditional one-letter POSIX-style options, `gawk' also +supports GNU long options. + + It is possible to invoke `awk' with an empty program: + + awk '' datafile1 datafile2 + +Doing so makes little sense, though; `awk' exits silently when given an +empty program. (d.c.) If `--lint' has been specified on the command +line, `gawk' issues a warning that the program is empty. + + +File: gawk.info, Node: Options, Next: Other Arguments, Prev: Command Line, Up: Invoking Gawk + +11.2 Command-Line Options +========================= + +Options begin with a dash and consist of a single character. GNU-style +long options consist of two dashes and a keyword. The keyword can be +abbreviated, as long as the abbreviation allows the option to be +uniquely identified. If the option takes an argument, then the keyword +is either immediately followed by an equals sign (`=') and the +argument's value, or the keyword and the argument's value are separated +by whitespace. If a particular option with a value is given more than +once, it is the last value that counts. + + Each long option for `gawk' has a corresponding POSIX-style option. +The long and short options are interchangeable in all contexts. The +options and their meanings are as follows: + +`-F FS' +`--field-separator FS' + Sets the `FS' variable to FS (*note Field Separators::). + +`-f SOURCE-FILE' +`--file SOURCE-FILE' + Indicates that the `awk' program is to be found in SOURCE-FILE + instead of in the first non-option argument. + +`-v VAR=VAL' +`--assign VAR=VAL' + Sets the variable VAR to the value VAL _before_ execution of the + program begins. Such variable values are available inside the + `BEGIN' rule (*note Other Arguments::). + + The `-v' option can only set one variable, but it can be used more + than once, setting another variable each time, like this: `awk + -v foo=1 -v bar=2 ...'. + + *Caution:* Using `-v' to set the values of the built-in variables + may lead to surprising results. `awk' will reset the values of + those variables as it needs to, possibly ignoring any predefined + value you may have given. + +`-mf N' +`-mr N' + Sets various memory limits to the value N. The `f' flag sets the + maximum number of fields and the `r' flag sets the maximum record + size. These two flags and the `-m' option are from the Bell + Laboratories research version of Unix `awk'. They are provided + for compatibility but otherwise ignored by `gawk', since `gawk' + has no predefined limits. (The Bell Laboratories `awk' no longer + needs these options; it continues to accept them to avoid breaking + old programs.) + +`-W GAWK-OPT' + Following the POSIX standard, implementation-specific options are + supplied as arguments to the `-W' option. These options also have + corresponding GNU-style long options. Note that the long options + may be abbreviated, as long as the abbreviations remain unique. + The full list of `gawk'-specific options is provided next. + +`--' + Signals the end of the command-line options. The following + arguments are not treated as options even if they begin with `-'. + This interpretation of `--' follows the POSIX argument parsing + conventions. + + This is useful if you have file names that start with `-', or in + shell scripts, if you have file names that will be specified by + the user that could start with `-'. + + The previous list described options mandated by the POSIX standard, +as well as options available in the Bell Laboratories version of `awk'. +The following list describes `gawk'-specific options: + +`-W compat' +`-W traditional' +`--compat' +`--traditional' + Specifies "compatibility mode", in which the GNU extensions to the + `awk' language are disabled, so that `gawk' behaves just like the + Bell Laboratories research version of Unix `awk'. `--traditional' + is the preferred form of this option. *Note POSIX/GNU::, which + summarizes the extensions. Also see *note Compatibility Mode::. + +`-W copyright' +`--copyright' + Print the short version of the General Public License and then + exit. + +`-W copyleft' +`--copyleft' + Just like `--copyright'. This option may disappear in a future + version of `gawk'. + +`-W dump-variables[=FILE]' +`--dump-variables[=FILE]' + Prints a sorted list of global variables, their types, and final + values to FILE. If no FILE is provided, `gawk' prints this list + to the file named `awkvars.out' in the current directory. + + Having a list of all global variables is a good way to look for + typographical errors in your programs. You would also use this + option if you have a large program with a lot of functions, and + you want to be sure that your functions don't inadvertently use + global variables that you meant to be local. (This is a + particularly easy mistake to make with simple variable names like + `i', `j', etc.) + +`-W exec FILE' +`--exec FILE' + Similar to `-f', reads `awk' program text from FILE. There are + two differences. The fist is that this option also terminates + option processing; anything else on the command line is passed on + directly to the `awk' program. The second is that command line + variable assignments of the form `VAR=VALUE' are disallowed. + + This option is particularly necessary for World Wide Web CGI + applications that pass arguments through the URL; using this + option prevents a malicious (or other) user from passing in + options, assignments, or `awk' source code (via `--source') to the + CGI application. This option should be used with `#!' scripts + (*note Executable Scripts::), like so: + + #! /usr/local/bin/gawk --exec + + AWK PROGRAM HERE ... + +`-W gen-po' +`--gen-po' + Analyzes the source program and generates a GNU `gettext' Portable + Object file on standard output for all string constants that have + been marked for translation. *Note Internationalization::, for + information about this option. + +`-W help' +`-W usage' +`--help' +`--usage' + Prints a "usage" message summarizing the short and long style + options that `gawk' accepts and then exit. + +`-W lint[=fatal]' +`--lint[=fatal]' + Warns about constructs that are dubious or nonportable to other + `awk' implementations. Some warnings are issued when `gawk' first + reads your program. Others are issued at runtime, as your program + executes. With an optional argument of `fatal', lint warnings + become fatal errors. This may be drastic, but its use will + certainly encourage the development of cleaner `awk' programs. + With an optional argument of `invalid', only warnings about things + that are actually invalid are issued. (This is not fully + implemented yet.) + + Some warnings are only printed once, even if the dubious + constructs they warn about occur multiple times in your `awk' + program. Thus, when eliminating problems pointed out by `--lint', + you should take care to search for all occurrences of each + inappropriate construct. As `awk' programs are usually short, + doing so is not burdensome. + +`-W lint-old' +`--lint-old' + Warns about constructs that are not available in the original + version of `awk' from Version 7 Unix (*note V7/SVR3.1::). + +`-W non-decimal-data' +`--non-decimal-data' + Enable automatic interpretation of octal and hexadecimal values in + input data (*note Nondecimal Data::). + + *Caution:* This option can severely break old programs. Use with + care. + +`-W posix' +`--posix' + Operates in strict POSIX mode. This disables all `gawk' + extensions (just like `--traditional') and adds the following + additional restrictions: + + * `\x' escape sequences are not recognized (*note Escape + Sequences::). + + * Newlines do not act as whitespace to separate fields when + `FS' is equal to a single space (*note Fields::). + + * Newlines are not allowed after `?' or `:' (*note Conditional + Exp::). + + * The synonym `func' for the keyword `function' is not + recognized (*note Definition Syntax::). + + * The `**' and `**=' operators cannot be used in place of `^' + and `^=' (*note Arithmetic Ops::, and also *note Assignment + Ops::). + + * Specifying `-Ft' on the command-line does not set the value + of `FS' to be a single TAB character (*note Field + Separators::). + + * The locale's decimal point character is used for parsing input + data (*note Locales::). + + * The `fflush' built-in function is not supported (*note I/O + Functions::). + + If you supply both `--traditional' and `--posix' on the command + line, `--posix' takes precedence. `gawk' also issues a warning if + both options are supplied. + +`-W profile[=FILE]' +`--profile[=FILE]' + Enable profiling of `awk' programs (*note Profiling::). By + default, profiles are created in a file named `awkprof.out'. The + optional FILE argument allows you to specify a different file name + for the profile file. + + When run with `gawk', the profile is just a "pretty printed" + version of the program. When run with `pgawk', the profile + contains execution counts for each statement in the program in the + left margin, and function call counts for each function. + +`-W re-interval' +`--re-interval' + Allows interval expressions (*note Regexp Operators::) in regexps. + Because interval expressions were traditionally not available in + `awk', `gawk' does not provide them by default. This prevents old + `awk' programs from breaking. + +`-W source PROGRAM-TEXT' +`--source PROGRAM-TEXT' + Allows you to mix source code in files with source code that you + enter on the command line. Program source code is taken from the + PROGRAM-TEXT. This is particularly useful when you have library + functions that you want to use from your command-line programs + (*note AWKPATH Variable::). + +`-W use-lc-numeric' +`--use-lc-numeric' + This option forces the use of the locale's decimal point character + when parsing numeric input data (*note Locales::). + +`-W version' +`--version' + Prints version information for this particular copy of `gawk'. + This allows you to determine if your copy of `gawk' is up to date + with respect to whatever the Free Software Foundation is currently + distributing. It is also useful for bug reports (*note Bugs::). + + As long as program text has been supplied, any other options are +flagged as invalid with a warning message but are otherwise ignored. + + In compatibility mode, as a special case, if the value of FS supplied +to the `-F' option is `t', then `FS' is set to the TAB character +(`"\t"'). This is true only for `--traditional' and not for `--posix' +(*note Field Separators::). + + The `-f' option may be used more than once on the command line. If +it is, `awk' reads its program source from all of the named files, as +if they had been concatenated together into one big file. This is +useful for creating libraries of `awk' functions. These functions can +be written once and then retrieved from a standard place, instead of +having to be included into each individual program. (As mentioned in +*note Definition Syntax::, function names must be unique.) + + Library functions can still be used, even if the program is entered +at the terminal, by specifying `-f /dev/tty'. After typing your +program, type `Ctrl-d' (the end-of-file character) to terminate it. +(You may also use `-f -' to read program source from the standard input +but then you will not be able to also use the standard input as a +source of data.) + + Because it is clumsy using the standard `awk' mechanisms to mix +source file and command-line `awk' programs, `gawk' provides the +`--source' option. This does not require you to pre-empt the standard +input for your source code; it allows you to easily mix command-line +and library source code (*note AWKPATH Variable::). + + If no `-f' or `--source' option is specified, then `gawk' uses the +first non-option command-line argument as the text of the program +source code. + + If the environment variable `POSIXLY_CORRECT' exists, then `gawk' +behaves in strict POSIX mode, exactly as if you had supplied the +`--posix' command-line option. Many GNU programs look for this +environment variable to turn on strict POSIX mode. If `--lint' is +supplied on the command line and `gawk' turns on POSIX mode because of +`POSIXLY_CORRECT', then it issues a warning message indicating that +POSIX mode is in effect. You would typically set this variable in your +shell's startup file. For a Bourne-compatible shell (such as `bash'), +you would add these lines to the `.profile' file in your home directory: + + POSIXLY_CORRECT=true + export POSIXLY_CORRECT + + For a `csh'-compatible shell,(1) you would add this line to the +`.login' file in your home directory: + + setenv POSIXLY_CORRECT true + + Having `POSIXLY_CORRECT' set is not recommended for daily use, but +it is good for testing the portability of your programs to other +environments. + + ---------- Footnotes ---------- + + (1) Not recommended. + + +File: gawk.info, Node: Other Arguments, Next: AWKPATH Variable, Prev: Options, Up: Invoking Gawk + +11.3 Other Command-Line Arguments +================================= + +Any additional arguments on the command line are normally treated as +input files to be processed in the order specified. However, an +argument that has the form `VAR=VALUE', assigns the value VALUE to the +variable VAR--it does not specify a file at all. (This was discussed +earlier in *note Assignment Options::.) + + All these arguments are made available to your `awk' program in the +`ARGV' array (*note Built-in Variables::). Command-line options and +the program text (if present) are omitted from `ARGV'. All other +arguments, including variable assignments, are included. As each +element of `ARGV' is processed, `gawk' sets the variable `ARGIND' to +the index in `ARGV' of the current element. + + The distinction between file name arguments and variable-assignment +arguments is made when `awk' is about to open the next input file. At +that point in execution, it checks the file name to see whether it is +really a variable assignment; if so, `awk' sets the variable instead of +reading a file. + + Therefore, the variables actually receive the given values after all +previously specified files have been read. In particular, the values of +variables assigned in this fashion are _not_ available inside a `BEGIN' +rule (*note BEGIN/END::), because such rules are run before `awk' +begins scanning the argument list. + + The variable values given on the command line are processed for +escape sequences (*note Escape Sequences::). (d.c.) + + In some earlier implementations of `awk', when a variable assignment +occurred before any file names, the assignment would happen _before_ +the `BEGIN' rule was executed. `awk''s behavior was thus inconsistent; +some command-line assignments were available inside the `BEGIN' rule, +while others were not. Unfortunately, some applications came to depend +upon this "feature." When `awk' was changed to be more consistent, the +`-v' option was added to accommodate applications that depended upon +the old behavior. + + The variable assignment feature is most useful for assigning to +variables such as `RS', `OFS', and `ORS', which control input and +output formats before scanning the data files. It is also useful for +controlling state if multiple passes are needed over a data file. For +example: + + awk 'pass == 1 { PASS 1 STUFF } + pass == 2 { PASS 2 STUFF }' pass=1 mydata pass=2 mydata + + Given the variable assignment feature, the `-F' option for setting +the value of `FS' is not strictly necessary. It remains for historical +compatibility. + + +File: gawk.info, Node: AWKPATH Variable, Next: Obsolete, Prev: Other Arguments, Up: Invoking Gawk + +11.4 The `AWKPATH' Environment Variable +======================================= + +The previous minor node described how `awk' program files can be named +on the command-line with the `-f' option. In most `awk' +implementations, you must supply a precise path name for each program +file, unless the file is in the current directory. But in `gawk', if +the file name supplied to the `-f' option does not contain a `/', then +`gawk' searches a list of directories (called the "search path"), one +by one, looking for a file with the specified name. + +The search path is a string consisting of directory names separated by +colons. `gawk' gets its search path from the `AWKPATH' environment +variable. If that variable does not exist, `gawk' uses a default path, +`.:/usr/local/share/awk'.(1) (Programs written for use by system +administrators should use an `AWKPATH' variable that does not include +the current directory, `.'.) + + The search path feature is particularly useful for building libraries +of useful `awk' functions. The library files can be placed in a +standard directory in the default path and then specified on the +command line with a short file name. Otherwise, the full file name +would have to be typed for each file. + + By using both the `--source' and `-f' options, your command-line +`awk' programs can use facilities in `awk' library files (*note Library +Functions::). Path searching is not done if `gawk' is in compatibility +mode. This is true for both `--traditional' and `--posix'. *Note +Options::. + + NOTE: If you want files in the current directory to be found, you + must include the current directory in the path, either by including + `.' explicitly in the path or by writing a null entry in the path. + (A null entry is indicated by starting or ending the path with a + colon or by placing two colons next to each other (`::').) If the + current directory is not included in the path, then files cannot be + found in the current directory. This path search mechanism is + identical to the shell's. + + Starting with version 3.0, if `AWKPATH' is not defined in the +environment, `gawk' places its default search path into +`ENVIRON["AWKPATH"]'. This makes it easy to determine the actual search +path that `gawk' will use from within an `awk' program. + + While you can change `ENVIRON["AWKPATH"]' within your `awk' program, +this has no effect on the running program's behavior. This makes +sense: the `AWKPATH' environment variable is used to find the program +source files. Once your program is running, all the files have been +found, and `gawk' no longer needs to use `AWKPATH'. + + ---------- Footnotes ---------- + + (1) Your version of `gawk' may use a different directory; it will +depend upon how `gawk' was built and installed. The actual directory is +the value of `$(datadir)' generated when `gawk' was configured. You +probably don't need to worry about this, though. + + +File: gawk.info, Node: Obsolete, Next: Undocumented, Prev: AWKPATH Variable, Up: Invoking Gawk + +11.5 Obsolete Options and/or Features +===================================== + +This minor node describes features and/or command-line options from +previous releases of `gawk' that are either not available in the +current version or that are still supported but deprecated (meaning that +they will _not_ be in the next release). + + For version 3.1 of `gawk', there are no deprecated command-line +options from the previous version of `gawk'. The use of `next file' +(two words) for `nextfile' was deprecated in `gawk' 3.0 but still +worked. Starting with version 3.1, the two-word usage is no longer +accepted. + + The process-related special files described in *note Special +Process::, work as described, but are now considered deprecated. +`gawk' prints a warning message every time they are used. (Use +`PROCINFO' instead; see *note Auto-set::.) They will be removed from +the next release of `gawk'. + + +File: gawk.info, Node: Undocumented, Next: Known Bugs, Prev: Obsolete, Up: Invoking Gawk + +11.6 Undocumented Options and Features +====================================== + + Use the Source, Luke! + Obi-Wan + + This minor node intentionally left blank. + + +File: gawk.info, Node: Known Bugs, Prev: Undocumented, Up: Invoking Gawk + +11.7 Known Bugs in `gawk' +========================= + + * The `-F' option for changing the value of `FS' (*note Options::) + is not necessary given the command-line variable assignment + feature; it remains only for backward compatibility. + + * Syntactically invalid single-character programs tend to overflow + the parse stack, generating a rather unhelpful message. Such + programs are surprisingly difficult to diagnose in the completely + general case, and the effort to do so really is not worth it. + + +File: gawk.info, Node: Library Functions, Next: Sample Programs, Prev: Invoking Gawk, Up: Top + +12 A Library of `awk' Functions +******************************* + +*note User-defined::, describes how to write your own `awk' functions. +Writing functions is important, because it allows you to encapsulate +algorithms and program tasks in a single place. It simplifies +programming, making program development more manageable, and making +programs more readable. + + One valuable way to learn a new programming language is to _read_ +programs in that language. To that end, this major node and *note +Sample Programs::, provide a good-sized body of code for you to read, +and hopefully, to learn from. + + This major node presents a library of useful `awk' functions. Many +of the sample programs presented later in this Info file use these +functions. The functions are presented here in a progression from +simple to complex. + + *note Extract Program::, presents a program that you can use to +extract the source code for these example library functions and +programs from the Texinfo source for this Info file. (This has already +been done as part of the `gawk' distribution.) + + If you have written one or more useful, general-purpose `awk' +functions and would like to contribute them to the author's collection +of `awk' programs, see *note How To Contribute::, for more information. + + The programs in this major node and in *note Sample Programs::, +freely use features that are `gawk'-specific. Rewriting these programs +for different implementations of awk is pretty straightforward. + + Diagnostic error messages are sent to `/dev/stderr'. Use `| "cat +1>&2"' instead of `> "/dev/stderr"' if your system does not have a +`/dev/stderr', or if you cannot use `gawk'. + + A number of programs use `nextfile' (*note Nextfile Statement::) to +skip any remaining input in the input file. *note Nextfile Function::, +shows you how to write a function that does the same thing. + + Finally, some of the programs choose to ignore upper- and lowercase +distinctions in their input. They do so by assigning one to +`IGNORECASE'. You can achieve almost the same effect(1) by adding the +following rule to the beginning of the program: + + # ignore case + { $0 = tolower($0) } + +Also, verify that all regexp and string constants used in comparisons +use only lowercase letters. + +* Menu: + +* Library Names:: How to best name private global variables in + library functions. +* General Functions:: Functions that are of general use. +* Data File Management:: Functions for managing command-line data + files. +* Getopt Function:: A function for processing command-line + arguments. +* Passwd Functions:: Functions for getting user information. +* Group Functions:: Functions for getting group information. + + ---------- Footnotes ---------- + + (1) The effects are not identical. Output of the transformed record +will be in all lowercase, while `IGNORECASE' preserves the original +contents of the input record. + + +File: gawk.info, Node: Library Names, Next: General Functions, Up: Library Functions + +12.1 Naming Library Function Global Variables +============================================= + +Due to the way the `awk' language evolved, variables are either +"global" (usable by the entire program) or "local" (usable just by a +specific function). There is no intermediate state analogous to +`static' variables in C. + + Library functions often need to have global variables that they can +use to preserve state information between calls to the function--for +example, `getopt''s variable `_opti' (*note Getopt Function::). Such +variables are called "private", since the only functions that need to +use them are the ones in the library. + + When writing a library function, you should try to choose names for +your private variables that will not conflict with any variables used by +either another library function or a user's main program. For example, +a name like `i' or `j' is not a good choice, because user programs +often use variable names like these for their own purposes. + + The example programs shown in this major node all start the names of +their private variables with an underscore (`_'). Users generally +don't use leading underscores in their variable names, so this +convention immediately decreases the chances that the variable name +will be accidentally shared with the user's program. + + In addition, several of the library functions use a prefix that helps +indicate what function or set of functions use the variables--for +example, `_pw_byname' in the user database routines (*note Passwd +Functions::). This convention is recommended, since it even further +decreases the chance of inadvertent conflict among variable names. +Note that this convention is used equally well for variable names and +for private function names as well.(1) + + As a final note on variable naming, if a function makes global +variables available for use by a main program, it is a good convention +to start that variable's name with a capital letter--for example, +`getopt''s `Opterr' and `Optind' variables (*note Getopt Function::). +The leading capital letter indicates that it is global, while the fact +that the variable name is not all capital letters indicates that the +variable is not one of `awk''s built-in variables, such as `FS'. + + It is also important that _all_ variables in library functions that +do not need to save state are, in fact, declared local.(2) If this is +not done, the variable could accidentally be used in the user's +program, leading to bugs that are very difficult to track down: + + function lib_func(x, y, l1, l2) + { + ... + USE VARIABLE some_var # some_var should be local + ... # but is not by oversight + } + + A different convention, common in the Tcl community, is to use a +single associative array to hold the values needed by the library +function(s), or "package." This significantly decreases the number of +actual global names in use. For example, the functions described in +*note Passwd Functions::, might have used array elements +`PW_data["inited"]', `PW_data["total"]', `PW_data["count"]', and +`PW_data["awklib"]', instead of `_pw_inited', `_pw_awklib', `_pw_total', +and `_pw_count'. + + The conventions presented in this minor node are exactly that: +conventions. You are not required to write your programs this way--we +merely recommend that you do so. + + ---------- Footnotes ---------- + + (1) While all the library routines could have been rewritten to use +this convention, this was not done, in order to show how my own `awk' +programming style has evolved and to provide some basis for this +discussion. + + (2) `gawk''s `--dump-variables' command-line option is useful for +verifying this. + + +File: gawk.info, Node: General Functions, Next: Data File Management, Prev: Library Names, Up: Library Functions + +12.2 General Programming +======================== + +This minor node presents a number of functions that are of general +programming use. + +* Menu: + +* Nextfile Function:: Two implementations of a `nextfile' + function. +* Strtonum Function:: A replacement for the built-in `strtonum' + function. +* Assert Function:: A function for assertions in `awk' + programs. +* Round Function:: A function for rounding if `sprintf' does + not do it correctly. +* Cliff Random Function:: The Cliff Random Number Generator. +* Ordinal Functions:: Functions for using characters as numbers and + vice versa. +* Join Function:: A function to join an array into a string. +* Gettimeofday Function:: A function to get formatted times. + + +File: gawk.info, Node: Nextfile Function, Next: Strtonum Function, Up: General Functions + +12.2.1 Implementing `nextfile' as a Function +-------------------------------------------- + +The `nextfile' statement, presented in *note Nextfile Statement::, is a +`gawk'-specific extension--it is not available in most other +implementations of `awk'. This minor node shows two versions of a +`nextfile' function that you can use to simulate `gawk''s `nextfile' +statement if you cannot use `gawk'. + + A first attempt at writing a `nextfile' function is as follows: + + # nextfile --- skip remaining records in current file + # this should be read in before the "main" awk program + + function nextfile() { _abandon_ = FILENAME; next } + _abandon_ == FILENAME { next } + + Because it supplies a rule that must be executed first, this file +should be included before the main program. This rule compares the +current data file's name (which is always in the `FILENAME' variable) to +a private variable named `_abandon_'. If the file name matches, then +the action part of the rule executes a `next' statement to go on to the +next record. (The use of `_' in the variable name is a convention. It +is discussed more fully in *note Library Names::.) + + The use of the `next' statement effectively creates a loop that reads +all the records from the current data file. The end of the file is +eventually reached and a new data file is opened, changing the value of +`FILENAME'. Once this happens, the comparison of `_abandon_' to +`FILENAME' fails, and execution continues with the first rule of the +"real" program. + + The `nextfile' function itself simply sets the value of `_abandon_' +and then executes a `next' statement to start the loop. + + This initial version has a subtle problem. If the same data file is +listed _twice_ on the command line, one right after the other or even +with just a variable assignment between them, this code skips right +through the file a second time, even though it should stop when it gets +to the end of the first occurrence. A second version of `nextfile' +that remedies this problem is shown here: + + # nextfile --- skip remaining records in current file + # correctly handle successive occurrences of the same file + # this should be read in before the "main" awk program + + function nextfile() { _abandon_ = FILENAME; next } + + _abandon_ == FILENAME { + if (FNR == 1) + _abandon_ = "" + else + next + } + + The `nextfile' function has not changed. It makes `_abandon_' equal +to the current file name and then executes a `next' statement. The +`next' statement reads the next record and increments `FNR' so that +`FNR' is guaranteed to have a value of at least two. However, if +`nextfile' is called for the last record in the file, then `awk' closes +the current data file and moves on to the next one. Upon doing so, +`FILENAME' is set to the name of the new file and `FNR' is reset to +one. If this next file is the same as the previous one, `_abandon_' is +still equal to `FILENAME'. However, `FNR' is equal to one, telling us +that this is a new occurrence of the file and not the one we were +reading when the `nextfile' function was executed. In that case, +`_abandon_' is reset to the empty string, so that further executions of +this rule fail (until the next time that `nextfile' is called). + + If `FNR' is not one, then we are still in the original data file and +the program executes a `next' statement to skip through it. + + An important question to ask at this point is: given that the +functionality of `nextfile' can be provided with a library file, why is +it built into `gawk'? Adding features for little reason leads to +larger, slower programs that are harder to maintain. The answer is +that building `nextfile' into `gawk' provides significant gains in +efficiency. If the `nextfile' function is executed at the beginning of +a large data file, `awk' still has to scan the entire file, splitting +it up into records, just to skip over it. The built-in `nextfile' can +simply close the file immediately and proceed to the next one, which +saves a lot of time. This is particularly important in `awk', because +`awk' programs are generally I/O-bound (i.e., they spend most of their +time doing input and output, instead of performing computations). + + +File: gawk.info, Node: Strtonum Function, Next: Assert Function, Prev: Nextfile Function, Up: General Functions + +12.2.2 Converting Strings To Numbers +------------------------------------ + +The `strtonum' function (*note String Functions::) is a `gawk' +extension. The following function provides an implementation for other +versions of `awk': + + # strtonum --- convert string to number + function mystrtonum(str, ret, chars, n, i, k, c) + { + if (str ~ /^0[0-7]*$/) { + # octal + n = length(str) + ret = 0 + for (i = 1; i <= n; i++) { + c = substr(str, i, 1) + if ((k = index("01234567", c)) > 0) + k-- # adjust for 1-basing in awk + + ret = ret * 8 + k + } + } else if (str ~ /^0[xX][0-9a-fA-f]+/) { + # hexadecimal + str = substr(str, 3) # lop off leading 0x + n = length(str) + ret = 0 + for (i = 1; i <= n; i++) { + c = substr(str, i, 1) + c = tolower(c) + if ((k = index("0123456789", c)) > 0) + k-- # adjust for 1-basing in awk + else if ((k = index("abcdef", c)) > 0) + k += 9 + + ret = ret * 16 + k + } + } else if (str ~ /^[-+]?([0-9]+([.][0-9]*([Ee][0-9]+)?)?|([.][0-9]+([Ee][-+]?[0-9]+)?))$/) { + # decimal number, possibly floating point + ret = str + 0 + } else + ret = "NOT-A-NUMBER" + + return ret + } + + # BEGIN { # gawk test harness + # a[1] = "25" + # a[2] = ".31" + # a[3] = "0123" + # a[4] = "0xdeadBEEF" + # a[5] = "123.45" + # a[6] = "1.e3" + # a[7] = "1.32" + # a[7] = "1.32E2" + # + # for (i = 1; i in a; i++) + # print a[i], strtonum(a[i]), mystrtonum(a[i]) + # } + + The function first looks for C-style octal numbers (base 8). If the +input string matches a regular expression describing octal numbers, +then `mystrtonum' loops through each character in the string. It sets +`k' to the index in `"01234567"' of the current octal digit. Since the +return value is one-based, the `k--' adjusts `k' so it can be used in +computing the return value. + + Similar logic applies to the code that checks for and converts a +hexadecimal value, which starts with `0x' or `0X'. The use of +`tolower' simplifies the computation for finding the correct numeric +value for each hexadecimal digit. + + Finally, if the string matches the (rather complicated) regex for a +regular decimal integer or floating-point number, the computation `ret += str + 0' lets `awk' convert the value to a number. + + A commented-out test program is included, so that the function can +be tested with `gawk' and the results compared to the built-in +`strtonum' function. + + +File: gawk.info, Node: Assert Function, Next: Round Function, Prev: Strtonum Function, Up: General Functions + +12.2.3 Assertions +----------------- + +When writing large programs, it is often useful to know that a +condition or set of conditions is true. Before proceeding with a +particular computation, you make a statement about what you believe to +be the case. Such a statement is known as an "assertion". The C +language provides an `<assert.h>' header file and corresponding +`assert' macro that the programmer can use to make assertions. If an +assertion fails, the `assert' macro arranges to print a diagnostic +message describing the condition that should have been true but was +not, and then it kills the program. In C, using `assert' looks this: + + #include <assert.h> + + int myfunc(int a, double b) + { + assert(a <= 5 && b >= 17.1); + ... + } + + If the assertion fails, the program prints a message similar to this: + + prog.c:5: assertion failed: a <= 5 && b >= 17.1 + + The C language makes it possible to turn the condition into a string +for use in printing the diagnostic message. This is not possible in +`awk', so this `assert' function also requires a string version of the +condition that is being tested. Following is the function: + + # assert --- assert that a condition is true. Otherwise exit. + function assert(condition, string) + { + if (! condition) { + printf("%s:%d: assertion failed: %s\n", + FILENAME, FNR, string) > "/dev/stderr" + _assert_exit = 1 + exit 1 + } + } + + END { + if (_assert_exit) + exit 1 + } + + The `assert' function tests the `condition' parameter. If it is +false, it prints a message to standard error, using the `string' +parameter to describe the failed condition. It then sets the variable +`_assert_exit' to one and executes the `exit' statement. The `exit' +statement jumps to the `END' rule. If the `END' rules finds +`_assert_exit' to be true, it exits immediately. + + The purpose of the test in the `END' rule is to keep any other `END' +rules from running. When an assertion fails, the program should exit +immediately. If no assertions fail, then `_assert_exit' is still false +when the `END' rule is run normally, and the rest of the program's +`END' rules execute. For all of this to work correctly, `assert.awk' +must be the first source file read by `awk'. The function can be used +in a program in the following way: + + function myfunc(a, b) + { + assert(a <= 5 && b >= 17.1, "a <= 5 && b >= 17.1") + ... + } + +If the assertion fails, you see a message similar to the following: + + mydata:1357: assertion failed: a <= 5 && b >= 17.1 + + There is a small problem with this version of `assert'. An `END' +rule is automatically added to the program calling `assert'. Normally, +if a program consists of just a `BEGIN' rule, the input files and/or +standard input are not read. However, now that the program has an `END' +rule, `awk' attempts to read the input data files or standard input +(*note Using BEGIN/END::), most likely causing the program to hang as +it waits for input. + + There is a simple workaround to this: make sure the `BEGIN' rule +always ends with an `exit' statement. + + +File: gawk.info, Node: Round Function, Next: Cliff Random Function, Prev: Assert Function, Up: General Functions + +12.2.4 Rounding Numbers +----------------------- + +The way `printf' and `sprintf' (*note Printf::) perform rounding often +depends upon the system's C `sprintf' subroutine. On many machines, +`sprintf' rounding is "unbiased," which means it doesn't always round a +trailing `.5' up, contrary to naive expectations. In unbiased +rounding, `.5' rounds to even, rather than always up, so 1.5 rounds to +2 but 4.5 rounds to 4. This means that if you are using a format that +does rounding (e.g., `"%.0f"'), you should check what your system does. +The following function does traditional rounding; it might be useful if +your awk's `printf' does unbiased rounding: + + # round.awk --- do normal rounding + function round(x, ival, aval, fraction) + { + ival = int(x) # integer part, int() truncates + + # see if fractional part + if (ival == x) # no fraction + return x + + if (x < 0) { + aval = -x # absolute value + ival = int(aval) + fraction = aval - ival + if (fraction >= .5) + return int(x) - 1 # -2.5 --> -3 + else + return int(x) # -2.3 --> -2 + } else { + fraction = x - ival + if (fraction >= .5) + return ival + 1 + else + return ival + } + } + + # test harness + { print $0, round($0) } + + +File: gawk.info, Node: Cliff Random Function, Next: Ordinal Functions, Prev: Round Function, Up: General Functions + +12.2.5 The Cliff Random Number Generator +---------------------------------------- + +The Cliff random number generator(1) is a very simple random number +generator that "passes the noise sphere test for randomness by showing +no structure." It is easily programmed, in less than 10 lines of `awk' +code: + + # cliff_rand.awk --- generate Cliff random numbers + BEGIN { _cliff_seed = 0.1 } + + function cliff_rand() + { + _cliff_seed = (100 * log(_cliff_seed)) % 1 + if (_cliff_seed < 0) + _cliff_seed = - _cliff_seed + return _cliff_seed + } + + This algorithm requires an initial "seed" of 0.1. Each new value +uses the current seed as input for the calculation. If the built-in +`rand' function (*note Numeric Functions::) isn't random enough, you +might try using this function instead. + + ---------- Footnotes ---------- + + (1) `http://mathworld.wolfram.com/CliffRandomNumberGenerator.html' + + +File: gawk.info, Node: Ordinal Functions, Next: Join Function, Prev: Cliff Random Function, Up: General Functions + +12.2.6 Translating Between Characters and Numbers +------------------------------------------------- + +One commercial implementation of `awk' supplies a built-in function, +`ord', which takes a character and returns the numeric value for that +character in the machine's character set. If the string passed to +`ord' has more than one character, only the first one is used. + + The inverse of this function is `chr' (from the function of the same +name in Pascal), which takes a number and returns the corresponding +character. Both functions are written very nicely in `awk'; there is +no real reason to build them into the `awk' interpreter: + + # ord.awk --- do ord and chr + + # Global identifiers: + # _ord_: numerical values indexed by characters + # _ord_init: function to initialize _ord_ + BEGIN { _ord_init() } + + function _ord_init( low, high, i, t) + { + low = sprintf("%c", 7) # BEL is ascii 7 + if (low == "\a") { # regular ascii + low = 0 + high = 127 + } else if (sprintf("%c", 128 + 7) == "\a") { + # ascii, mark parity + low = 128 + high = 255 + } else { # ebcdic(!) + low = 0 + high = 255 + } + + for (i = low; i <= high; i++) { + t = sprintf("%c", i) + _ord_[t] = i + } + } + + Some explanation of the numbers used by `chr' is worthwhile. The +most prominent character set in use today is ASCII. Although an 8-bit +byte can hold 256 distinct values (from 0 to 255), ASCII only defines +characters that use the values from 0 to 127.(1) In the now distant +past, at least one minicomputer manufacturer used ASCII, but with mark +parity, meaning that the leftmost bit in the byte is always 1. This +means that on those systems, characters have numeric values from 128 to +255. Finally, large mainframe systems use the EBCDIC character set, +which uses all 256 values. While there are other character sets in use +on some older systems, they are not really worth worrying about: + + function ord(str, c) + { + # only first character is of interest + c = substr(str, 1, 1) + return _ord_[c] + } + + function chr(c) + { + # force c to be numeric by adding 0 + return sprintf("%c", c + 0) + } + + #### test code #### + # BEGIN \ + # { + # for (;;) { + # printf("enter a character: ") + # if (getline var <= 0) + # break + # printf("ord(%s) = %d\n", var, ord(var)) + # } + # } + + An obvious improvement to these functions is to move the code for the +`_ord_init' function into the body of the `BEGIN' rule. It was written +this way initially for ease of development. There is a "test program" +in a `BEGIN' rule, to test the function. It is commented out for +production use. + + ---------- Footnotes ---------- + + (1) ASCII has been extended in many countries to use the values from +128 to 255 for country-specific characters. If your system uses these +extensions, you can simplify `_ord_init' to simply loop from 0 to 255. + + +File: gawk.info, Node: Join Function, Next: Gettimeofday Function, Prev: Ordinal Functions, Up: General Functions + +12.2.7 Merging an Array into a String +------------------------------------- + +When doing string processing, it is often useful to be able to join all +the strings in an array into one long string. The following function, +`join', accomplishes this task. It is used later in several of the +application programs (*note Sample Programs::). + + Good function design is important; this function needs to be general +but it should also have a reasonable default behavior. It is called +with an array as well as the beginning and ending indices of the +elements in the array to be merged. This assumes that the array +indices are numeric--a reasonable assumption since the array was likely +created with `split' (*note String Functions::): + + # join.awk --- join an array into a string + function join(array, start, end, sep, result, i) + { + if (sep == "") + sep = " " + else if (sep == SUBSEP) # magic value + sep = "" + result = array[start] + for (i = start + 1; i <= end; i++) + result = result sep array[i] + return result + } + + An optional additional argument is the separator to use when joining +the strings back together. If the caller supplies a nonempty value, +`join' uses it; if it is not supplied, it has a null value. In this +case, `join' uses a single blank as a default separator for the +strings. If the value is equal to `SUBSEP', then `join' joins the +strings with no separator between them. `SUBSEP' serves as a "magic" +value to indicate that there should be no separation between the +component strings.(1) + + ---------- Footnotes ---------- + + (1) It would be nice if `awk' had an assignment operator for +concatenation. The lack of an explicit operator for concatenation +makes string operations more difficult than they really need to be. + + +File: gawk.info, Node: Gettimeofday Function, Prev: Join Function, Up: General Functions + +12.2.8 Managing the Time of Day +------------------------------- + +The `systime' and `strftime' functions described in *note Time +Functions::, provide the minimum functionality necessary for dealing +with the time of day in human readable form. While `strftime' is +extensive, the control formats are not necessarily easy to remember or +intuitively obvious when reading a program. + + The following function, `gettimeofday', populates a user-supplied +array with preformatted time information. It returns a string with the +current time formatted in the same way as the `date' utility: + + # gettimeofday.awk --- get the time of day in a usable format + + # Returns a string in the format of output of date(1) + # Populates the array argument time with individual values: + # time["second"] -- seconds (0 - 59) + # time["minute"] -- minutes (0 - 59) + # time["hour"] -- hours (0 - 23) + # time["althour"] -- hours (0 - 12) + # time["monthday"] -- day of month (1 - 31) + # time["month"] -- month of year (1 - 12) + # time["monthname"] -- name of the month + # time["shortmonth"] -- short name of the month + # time["year"] -- year modulo 100 (0 - 99) + # time["fullyear"] -- full year + # time["weekday"] -- day of week (Sunday = 0) + # time["altweekday"] -- day of week (Monday = 0) + # time["dayname"] -- name of weekday + # time["shortdayname"] -- short name of weekday + # time["yearday"] -- day of year (0 - 365) + # time["timezone"] -- abbreviation of timezone name + # time["ampm"] -- AM or PM designation + # time["weeknum"] -- week number, Sunday first day + # time["altweeknum"] -- week number, Monday first day + + function gettimeofday(time, ret, now, i) + { + # get time once, avoids unnecessary system calls + now = systime() + + # return date(1)-style output + ret = strftime("%a %b %d %H:%M:%S %Z %Y", now) + + # clear out target array + delete time + + # fill in values, force numeric values to be + # numeric by adding 0 + time["second"] = strftime("%S", now) + 0 + time["minute"] = strftime("%M", now) + 0 + time["hour"] = strftime("%H", now) + 0 + time["althour"] = strftime("%I", now) + 0 + time["monthday"] = strftime("%d", now) + 0 + time["month"] = strftime("%m", now) + 0 + time["monthname"] = strftime("%B", now) + time["shortmonth"] = strftime("%b", now) + time["year"] = strftime("%y", now) + 0 + time["fullyear"] = strftime("%Y", now) + 0 + time["weekday"] = strftime("%w", now) + 0 + time["altweekday"] = strftime("%u", now) + 0 + time["dayname"] = strftime("%A", now) + time["shortdayname"] = strftime("%a", now) + time["yearday"] = strftime("%j", now) + 0 + time["timezone"] = strftime("%Z", now) + time["ampm"] = strftime("%p", now) + time["weeknum"] = strftime("%U", now) + 0 + time["altweeknum"] = strftime("%W", now) + 0 + + return ret + } + + The string indices are easier to use and read than the various +formats required by `strftime'. The `alarm' program presented in *note +Alarm Program::, uses this function. A more general design for the +`gettimeofday' function would have allowed the user to supply an +optional timestamp value to use instead of the current time. + + +File: gawk.info, Node: Data File Management, Next: Getopt Function, Prev: General Functions, Up: Library Functions + +12.3 Data File Management +========================= + +This minor node presents functions that are useful for managing +command-line data files. + +* Menu: + +* Filetrans Function:: A function for handling data file transitions. +* Rewind Function:: A function for rereading the current file. +* File Checking:: Checking that data files are readable. +* Empty Files:: Checking for zero-length files. +* Ignoring Assigns:: Treating assignments as file names. + + +File: gawk.info, Node: Filetrans Function, Next: Rewind Function, Up: Data File Management + +12.3.1 Noting Data File Boundaries +---------------------------------- + +The `BEGIN' and `END' rules are each executed exactly once at the +beginning and end of your `awk' program, respectively (*note +BEGIN/END::). We (the `gawk' authors) once had a user who mistakenly +thought that the `BEGIN' rule is executed at the beginning of each data +file and the `END' rule is executed at the end of each data file. When +informed that this was not the case, the user requested that we add new +special patterns to `gawk', named `BEGIN_FILE' and `END_FILE', that +would have the desired behavior. He even supplied us the code to do so. + + Adding these special patterns to `gawk' wasn't necessary; the job +can be done cleanly in `awk' itself, as illustrated by the following +library program. It arranges to call two user-supplied functions, +`beginfile' and `endfile', at the beginning and end of each data file. +Besides solving the problem in only nine(!) lines of code, it does so +_portably_; this works with any implementation of `awk': + + # transfile.awk + # + # Give the user a hook for filename transitions + # + # The user must supply functions beginfile() and endfile() + # that each take the name of the file being started or + # finished, respectively. + + FILENAME != _oldfilename \ + { + if (_oldfilename != "") + endfile(_oldfilename) + _oldfilename = FILENAME + beginfile(FILENAME) + } + + END { endfile(FILENAME) } + + This file must be loaded before the user's "main" program, so that +the rule it supplies is executed first. + + This rule relies on `awk''s `FILENAME' variable that automatically +changes for each new data file. The current file name is saved in a +private variable, `_oldfilename'. If `FILENAME' does not equal +`_oldfilename', then a new data file is being processed and it is +necessary to call `endfile' for the old file. Because `endfile' should +only be called if a file has been processed, the program first checks +to make sure that `_oldfilename' is not the null string. The program +then assigns the current file name to `_oldfilename' and calls +`beginfile' for the file. Because, like all `awk' variables, +`_oldfilename' is initialized to the null string, this rule executes +correctly even for the first data file. + + The program also supplies an `END' rule to do the final processing +for the last file. Because this `END' rule comes before any `END' rules +supplied in the "main" program, `endfile' is called first. Once again +the value of multiple `BEGIN' and `END' rules should be clear. + + This version has same problem as the first version of `nextfile' +(*note Nextfile Function::). If the same data file occurs twice in a +row on the command line, then `endfile' and `beginfile' are not +executed at the end of the first pass and at the beginning of the +second pass. The following version solves the problem: + + # ftrans.awk --- handle data file transitions + # + # user supplies beginfile() and endfile() functions + FNR == 1 { + if (_filename_ != "") + endfile(_filename_) + _filename_ = FILENAME + beginfile(FILENAME) + } + + END { endfile(_filename_) } + + *note Wc Program::, shows how this library function can be used and +how it simplifies writing the main program. + + +File: gawk.info, Node: Rewind Function, Next: File Checking, Prev: Filetrans Function, Up: Data File Management + +12.3.2 Rereading the Current File +--------------------------------- + +Another request for a new built-in function was for a `rewind' function +that would make it possible to reread the current file. The requesting +user didn't want to have to use `getline' (*note Getline::) inside a +loop. + + However, as long as you are not in the `END' rule, it is quite easy +to arrange to immediately close the current input file and then start +over with it from the top. For lack of a better name, we'll call it +`rewind': + + # rewind.awk --- rewind the current file and start over + function rewind( i) + { + # shift remaining arguments up + for (i = ARGC; i > ARGIND; i--) + ARGV[i] = ARGV[i-1] + + # make sure gawk knows to keep going + ARGC++ + + # make current file next to get done + ARGV[ARGIND+1] = FILENAME + + # do it + nextfile + } + + This code relies on the `ARGIND' variable (*note Auto-set::), which +is specific to `gawk'. If you are not using `gawk', you can use ideas +presented in *note Filetrans Function::, to either update `ARGIND' on +your own or modify this code as appropriate. + + The `rewind' function also relies on the `nextfile' keyword (*note +Nextfile Statement::). *Note Nextfile Function::, for a function +version of `nextfile'. + + +File: gawk.info, Node: File Checking, Next: Empty Files, Prev: Rewind Function, Up: Data File Management + +12.3.3 Checking for Readable Data Files +--------------------------------------- + +Normally, if you give `awk' a data file that isn't readable, it stops +with a fatal error. There are times when you might want to just ignore +such files and keep going. You can do this by prepending the following +program to your `awk' program: + + # readable.awk --- library file to skip over unreadable files + BEGIN { + for (i = 1; i < ARGC; i++) { + if (ARGV[i] ~ /^[A-Za-z_][A-Za-z0-9_]*=.*/ \ + || ARGV[i] == "-") + continue # assignment or standard input + else if ((getline junk < ARGV[i]) < 0) # unreadable + delete ARGV[i] + else + close(ARGV[i]) + } + } + + In `gawk', the `getline' won't be fatal (unless `--posix' is in +force). Removing the element from `ARGV' with `delete' skips the file +(since it's no longer in the list). + + +File: gawk.info, Node: Empty Files, Next: Ignoring Assigns, Prev: File Checking, Up: Data File Management + +12.3.4 Checking For Zero-length Files +------------------------------------- + +All known `awk' implementations silently skip over zero-length files. +This is a by-product of `awk''s implicit +read-a-record-and-match-against-the-rules loop: when `awk' tries to +read a record from an empty file, it immediately receives an end of +file indication, closes the file, and proceeds on to the next +command-line data file, _without_ executing any user-level `awk' +program code. + + Using `gawk''s `ARGIND' variable (*note Built-in Variables::), it is +possible to detect when an empty data file has been skipped. Similar +to the library file presented in *note Filetrans Function::, the +following library file calls a function named `zerofile' that the user +must provide. The arguments passed are the file name and the position +in `ARGV' where it was found: + + # zerofile.awk --- library file to process empty input files + BEGIN { Argind = 0 } + + ARGIND > Argind + 1 { + for (Argind++; Argind < ARGIND; Argind++) + zerofile(ARGV[Argind], Argind) + } + + ARGIND != Argind { Argind = ARGIND } + + END { + if (ARGIND > Argind) + for (Argind++; Argind <= ARGIND; Argind++) + zerofile(ARGV[Argind], Argind) + } + + The user-level variable `Argind' allows the `awk' program to track +its progress through `ARGV'. Whenever the program detects that +`ARGIND' is greater than `Argind + 1', it means that one or more empty +files were skipped. The action then calls `zerofile' for each such +file, incrementing `Argind' along the way. + + The `Argind != ARGIND' rule simply keeps `Argind' up to date in the +normal case. + + Finally, the `END' rule catches the case of any empty files at the +end of the command-line arguments. Note that the test in the condition +of the `for' loop uses the `<=' operator, not `<'. + + As an exercise, you might consider whether this same problem can be +solved without relying on `gawk''s `ARGIND' variable. + + As a second exercise, revise this code to handle the case where an +intervening value in `ARGV' is a variable assignment. + + +File: gawk.info, Node: Ignoring Assigns, Prev: Empty Files, Up: Data File Management + +12.3.5 Treating Assignments as File Names +----------------------------------------- + +Occasionally, you might not want `awk' to process command-line variable +assignments (*note Assignment Options::). In particular, if you have +file names that contain an `=' character, `awk' treats the file name as +an assignment, and does not process it. + + Some users have suggested an additional command-line option for +`gawk' to disable command-line assignments. However, some simple +programming with a library file does the trick: + + # noassign.awk --- library file to avoid the need for a + # special option that disables command-line assignments + function disable_assigns(argc, argv, i) + { + for (i = 1; i < argc; i++) + if (argv[i] ~ /^[A-Za-z_][A-Za-z_0-9]*=.*/) + argv[i] = ("./" argv[i]) + } + + BEGIN { + if (No_command_assign) + disable_assigns(ARGC, ARGV) + } + + You then run your program this way: + + awk -v No_command_assign=1 -f noassign.awk -f yourprog.awk * + + The function works by looping through the arguments. It prepends +`./' to any argument that matches the form of a variable assignment, +turning that argument into a file name. + + The use of `No_command_assign' allows you to disable command-line +assignments at invocation time, by giving the variable a true value. +When not set, it is initially zero (i.e., false), so the command-line +arguments are left alone. + + +File: gawk.info, Node: Getopt Function, Next: Passwd Functions, Prev: Data File Management, Up: Library Functions + +12.4 Processing Command-Line Options +==================================== + +Most utilities on POSIX compatible systems take options, or "switches," +on the command line that can be used to change the way a program +behaves. `awk' is an example of such a program (*note Options::). +Often, options take "arguments"; i.e., data that the program needs to +correctly obey the command-line option. For example, `awk''s `-F' +option requires a string to use as the field separator. The first +occurrence on the command line of either `--' or a string that does not +begin with `-' ends the options. + + Modern Unix systems provide a C function named `getopt' for +processing command-line arguments. The programmer provides a string +describing the one-letter options. If an option requires an argument, +it is followed in the string with a colon. `getopt' is also passed the +count and values of the command-line arguments and is called in a loop. +`getopt' processes the command-line arguments for option letters. Each +time around the loop, it returns a single character representing the +next option letter that it finds, or `?' if it finds an invalid option. +When it returns -1, there are no options left on the command line. + + When using `getopt', options that do not take arguments can be +grouped together. Furthermore, options that take arguments require +that the argument is present. The argument can immediately follow the +option letter, or it can be a separate command-line argument. + + Given a hypothetical program that takes three command-line options, +`-a', `-b', and `-c', where `-b' requires an argument, all of the +following are valid ways of invoking the program: + + prog -a -b foo -c data1 data2 data3 + prog -ac -bfoo -- data1 data2 data3 + prog -acbfoo data1 data2 data3 + + Notice that when the argument is grouped with its option, the rest of +the argument is considered to be the option's argument. In this +example, `-acbfoo' indicates that all of the `-a', `-b', and `-c' +options were supplied, and that `foo' is the argument to the `-b' +option. + + `getopt' provides four external variables that the programmer can +use: + +`optind' + The index in the argument value array (`argv') where the first + nonoption command-line argument can be found. + +`optarg' + The string value of the argument to an option. + +`opterr' + Usually `getopt' prints an error message when it finds an invalid + option. Setting `opterr' to zero disables this feature. (An + application might want to print its own error message.) + +`optopt' + The letter representing the command-line option. + + The following C fragment shows how `getopt' might process +command-line arguments for `awk': + + int + main(int argc, char *argv[]) + { + ... + /* print our own message */ + opterr = 0; + while ((c = getopt(argc, argv, "v:f:F:W:")) != -1) { + switch (c) { + case 'f': /* file */ + ... + break; + case 'F': /* field separator */ + ... + break; + case 'v': /* variable assignment */ + ... + break; + case 'W': /* extension */ + ... + break; + case '?': + default: + usage(); + break; + } + } + ... + } + + As a side point, `gawk' actually uses the GNU `getopt_long' function +to process both normal and GNU-style long options (*note Options::). + + The abstraction provided by `getopt' is very useful and is quite +handy in `awk' programs as well. Following is an `awk' version of +`getopt'. This function highlights one of the greatest weaknesses in +`awk', which is that it is very poor at manipulating single characters. +Repeated calls to `substr' are necessary for accessing individual +characters (*note String Functions::).(1) + + The discussion that follows walks through the code a bit at a time: + + # getopt.awk --- do C library getopt(3) function in awk + # External variables: + # Optind -- index in ARGV of first nonoption argument + # Optarg -- string value of argument to current option + # Opterr -- if nonzero, print our own diagnostic + # Optopt -- current option letter + + # Returns: + # -1 at end of options + # ? for unrecognized option + # <c> a character representing the current option + + # Private Data: + # _opti -- index in multi-flag option, e.g., -abc + + The function starts out with a list of the global variables it uses, +what the return values are, what they mean, and any global variables +that are "private" to this library function. Such documentation is +essential for any program, and particularly for library functions. + + The `getopt' function first checks that it was indeed called with a +string of options (the `options' parameter). If `options' has a zero +length, `getopt' immediately returns -1: + + function getopt(argc, argv, options, thisopt, i) + { + if (length(options) == 0) # no options given + return -1 + + if (argv[Optind] == "--") { # all done + Optind++ + _opti = 0 + return -1 + } else if (argv[Optind] !~ /^-[^: \t\n\f\r\v\b]/) { + _opti = 0 + return -1 + } + + The next thing to check for is the end of the options. A `--' ends +the command-line options, as does any command-line argument that does +not begin with a `-'. `Optind' is used to step through the array of +command-line arguments; it retains its value across calls to `getopt', +because it is a global variable. + + The regular expression that is used, `/^-[^: \t\n\f\r\v\b]/', is +perhaps a bit of overkill; it checks for a `-' followed by anything +that is not whitespace and not a colon. If the current command-line +argument does not match this pattern, it is not an option, and it ends +option processing: + + if (_opti == 0) + _opti = 2 + thisopt = substr(argv[Optind], _opti, 1) + Optopt = thisopt + i = index(options, thisopt) + if (i == 0) { + if (Opterr) + printf("%c -- invalid option\n", + thisopt) > "/dev/stderr" + if (_opti >= length(argv[Optind])) { + Optind++ + _opti = 0 + } else + _opti++ + return "?" + } + + The `_opti' variable tracks the position in the current command-line +argument (`argv[Optind]'). If multiple options are grouped together +with one `-' (e.g., `-abx'), it is necessary to return them to the user +one at a time. + + If `_opti' is equal to zero, it is set to two, which is the index in +the string of the next character to look at (we skip the `-', which is +at position one). The variable `thisopt' holds the character, obtained +with `substr'. It is saved in `Optopt' for the main program to use. + + If `thisopt' is not in the `options' string, then it is an invalid +option. If `Opterr' is nonzero, `getopt' prints an error message on +the standard error that is similar to the message from the C version of +`getopt'. + + Because the option is invalid, it is necessary to skip it and move +on to the next option character. If `_opti' is greater than or equal +to the length of the current command-line argument, it is necessary to +move on to the next argument, so `Optind' is incremented and `_opti' is +reset to zero. Otherwise, `Optind' is left alone and `_opti' is merely +incremented. + + In any case, because the option is invalid, `getopt' returns `?'. +The main program can examine `Optopt' if it needs to know what the +invalid option letter actually is. Continuing on: + + if (substr(options, i + 1, 1) == ":") { + # get option argument + if (length(substr(argv[Optind], _opti + 1)) > 0) + Optarg = substr(argv[Optind], _opti + 1) + else + Optarg = argv[++Optind] + _opti = 0 + } else + Optarg = "" + + If the option requires an argument, the option letter is followed by +a colon in the `options' string. If there are remaining characters in +the current command-line argument (`argv[Optind]'), then the rest of +that string is assigned to `Optarg'. Otherwise, the next command-line +argument is used (`-xFOO' versus `-x FOO'). In either case, `_opti' is +reset to zero, because there are no more characters left to examine in +the current command-line argument. Continuing: + + if (_opti == 0 || _opti >= length(argv[Optind])) { + Optind++ + _opti = 0 + } else + _opti++ + return thisopt + } + + Finally, if `_opti' is either zero or greater than the length of the +current command-line argument, it means this element in `argv' is +through being processed, so `Optind' is incremented to point to the +next element in `argv'. If neither condition is true, then only +`_opti' is incremented, so that the next option letter can be processed +on the next call to `getopt'. + + The `BEGIN' rule initializes both `Opterr' and `Optind' to one. +`Opterr' is set to one, since the default behavior is for `getopt' to +print a diagnostic message upon seeing an invalid option. `Optind' is +set to one, since there's no reason to look at the program name, which +is in `ARGV[0]': + + BEGIN { + Opterr = 1 # default is to diagnose + Optind = 1 # skip ARGV[0] + + # test program + if (_getopt_test) { + while ((_go_c = getopt(ARGC, ARGV, "ab:cd")) != -1) + printf("c = <%c>, optarg = <%s>\n", + _go_c, Optarg) + printf("non-option arguments:\n") + for (; Optind < ARGC; Optind++) + printf("\tARGV[%d] = <%s>\n", + Optind, ARGV[Optind]) + } + } + + The rest of the `BEGIN' rule is a simple test program. Here is the +result of two sample runs of the test program: + + $ awk -f getopt.awk -v _getopt_test=1 -- -a -cbARG bax -x + -| c = <a>, optarg = <> + -| c = <c>, optarg = <> + -| c = <b>, optarg = <ARG> + -| non-option arguments: + -| ARGV[3] = <bax> + -| ARGV[4] = <-x> + + $ awk -f getopt.awk -v _getopt_test=1 -- -a -x -- xyz abc + -| c = <a>, optarg = <> + error--> x -- invalid option + -| c = <?>, optarg = <> + -| non-option arguments: + -| ARGV[4] = <xyz> + -| ARGV[5] = <abc> + + In both runs, the first `--' terminates the arguments to `awk', so +that it does not try to interpret the `-a', etc., as its own options. + + NOTE: After `getopt' is through, it is the responsibility of the + user level code to clear out all the elements of `ARGV' from 1 to + `Optind', so that `awk' does not try to process the command-line + options as file names. + + Several of the sample programs presented in *note Sample Programs::, +use `getopt' to process their arguments. + + ---------- Footnotes ---------- + + (1) This function was written before `gawk' acquired the ability to +split strings into single characters using `""' as the separator. We +have left it alone, since using `substr' is more portable. + + +File: gawk.info, Node: Passwd Functions, Next: Group Functions, Prev: Getopt Function, Up: Library Functions + +12.5 Reading the User Database +============================== + +The `PROCINFO' array (*note Built-in Variables::) provides access to +the current user's real and effective user and group ID numbers, and if +available, the user's supplementary group set. However, because these +are numbers, they do not provide very useful information to the average +user. There needs to be some way to find the user information +associated with the user and group ID numbers. This minor node +presents a suite of functions for retrieving information from the user +database. *Note Group Functions::, for a similar suite that retrieves +information from the group database. + + The POSIX standard does not define the file where user information is +kept. Instead, it provides the `<pwd.h>' header file and several C +language subroutines for obtaining user information. The primary +function is `getpwent', for "get password entry." The "password" comes +from the original user database file, `/etc/passwd', which stores user +information, along with the encrypted passwords (hence the name). + + While an `awk' program could simply read `/etc/passwd' directly, +this file may not contain complete information about the system's set +of users.(1) To be sure you are able to produce a readable and complete +version of the user database, it is necessary to write a small C +program that calls `getpwent'. `getpwent' is defined as returning a +pointer to a `struct passwd'. Each time it is called, it returns the +next entry in the database. When there are no more entries, it returns +`NULL', the null pointer. When this happens, the C program should call +`endpwent' to close the database. Following is `pwcat', a C program +that "cats" the password database: + + /* + * pwcat.c + * + * Generate a printable version of the password database + */ + #include <stdio.h> + #include <pwd.h> + + int + main(argc, argv) + int argc; + char **argv; + { + struct passwd *p; + + while ((p = getpwent()) != NULL) + printf("%s:%s:%ld:%ld:%s:%s:%s\n", + p->pw_name, p->pw_passwd, (long) p->pw_uid, + (long) p->pw_gid, p->pw_gecos, p->pw_dir, p->pw_shell); + + endpwent(); + return 0; + } + + If you don't understand C, don't worry about it. The output from +`pwcat' is the user database, in the traditional `/etc/passwd' format +of colon-separated fields. The fields are: + +Login name The user's login name. +Encrypted password The user's encrypted password. This may not be + available on some systems. +User-ID The user's numeric user ID number. +Group-ID The user's numeric group ID number. +Full name The user's full name, and perhaps other + information associated with the user. +Home directory The user's login (or "home") directory + (familiar to shell programmers as `$HOME'). +Login shell The program that is run when the user logs in. + This is usually a shell, such as `bash'. + + A few lines representative of `pwcat''s output are as follows: + + $ pwcat + -| root:3Ov02d5VaUPB6:0:1:Operator:/:/bin/sh + -| nobody:*:65534:65534::/: + -| daemon:*:1:1::/: + -| sys:*:2:2::/:/bin/csh + -| bin:*:3:3::/bin: + -| arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/sh + -| miriam:yxaay:112:10:Miriam Robbins:/home/miriam:/bin/sh + -| andy:abcca2:113:10:Andy Jacobs:/home/andy:/bin/sh + ... + + With that introduction, following is a group of functions for +getting user information. There are several functions here, +corresponding to the C functions of the same names: + + # passwd.awk --- access password file information + BEGIN { + # tailor this to suit your system + _pw_awklib = "/usr/local/libexec/awk/" + } + + function _pw_init( oldfs, oldrs, olddol0, pwcat, using_fw) + { + if (_pw_inited) + return + + oldfs = FS + oldrs = RS + olddol0 = $0 + using_fw = (PROCINFO["FS"] == "FIELDWIDTHS") + FS = ":" + RS = "\n" + + pwcat = _pw_awklib "pwcat" + while ((pwcat | getline) > 0) { + _pw_byname[$1] = $0 + _pw_byuid[$3] = $0 + _pw_bycount[++_pw_total] = $0 + } + close(pwcat) + _pw_count = 0 + _pw_inited = 1 + FS = oldfs + if (using_fw) + FIELDWIDTHS = FIELDWIDTHS + RS = oldrs + $0 = olddol0 + } + + The `BEGIN' rule sets a private variable to the directory where +`pwcat' is stored. Because it is used to help out an `awk' library +routine, we have chosen to put it in `/usr/local/libexec/awk'; however, +you might want it to be in a different directory on your system. + + The function `_pw_init' keeps three copies of the user information +in three associative arrays. The arrays are indexed by username +(`_pw_byname'), by user ID number (`_pw_byuid'), and by order of +occurrence (`_pw_bycount'). The variable `_pw_inited' is used for +efficiency; `_pw_init' needs only to be called once. + + Because this function uses `getline' to read information from +`pwcat', it first saves the values of `FS', `RS', and `$0'. It notes +in the variable `using_fw' whether field splitting with `FIELDWIDTHS' +is in effect or not. Doing so is necessary, since these functions +could be called from anywhere within a user's program, and the user may +have his or her own way of splitting records and fields. + + The `using_fw' variable checks `PROCINFO["FS"]', which is +`"FIELDWIDTHS"' if field splitting is being done with `FIELDWIDTHS'. +This makes it possible to restore the correct field-splitting mechanism +later. The test can only be true for `gawk'. It is false if using +`FS' or on some other `awk' implementation. + + The main part of the function uses a loop to read database lines, +split the line into fields, and then store the line into each array as +necessary. When the loop is done, `_pw_init' cleans up by closing the +pipeline, setting `_pw_inited' to one, and restoring `FS' (and +`FIELDWIDTHS' if necessary), `RS', and `$0'. The use of `_pw_count' is +explained shortly. + + The `getpwnam' function takes a username as a string argument. If +that user is in the database, it returns the appropriate line. +Otherwise, it returns the null string: + + function getpwnam(name) + { + _pw_init() + if (name in _pw_byname) + return _pw_byname[name] + return "" + } + + Similarly, the `getpwuid' function takes a user ID number argument. +If that user number is in the database, it returns the appropriate +line. Otherwise, it returns the null string: + + function getpwuid(uid) + { + _pw_init() + if (uid in _pw_byuid) + return _pw_byuid[uid] + return "" + } + + The `getpwent' function simply steps through the database, one entry +at a time. It uses `_pw_count' to track its current position in the +`_pw_bycount' array: + + function getpwent() + { + _pw_init() + if (_pw_count < _pw_total) + return _pw_bycount[++_pw_count] + return "" + } + + The `endpwent' function resets `_pw_count' to zero, so that +subsequent calls to `getpwent' start over again: + + function endpwent() + { + _pw_count = 0 + } + + A conscious design decision in this suite was made that each +subroutine calls `_pw_init' to initialize the database arrays. The +overhead of running a separate process to generate the user database, +and the I/O to scan it, are only incurred if the user's main program +actually calls one of these functions. If this library file is loaded +along with a user's program, but none of the routines are ever called, +then there is no extra runtime overhead. (The alternative is move the +body of `_pw_init' into a `BEGIN' rule, which always runs `pwcat'. +This simplifies the code but runs an extra process that may never be +needed.) + + In turn, calling `_pw_init' is not too expensive, because the +`_pw_inited' variable keeps the program from reading the data more than +once. If you are worried about squeezing every last cycle out of your +`awk' program, the check of `_pw_inited' could be moved out of +`_pw_init' and duplicated in all the other functions. In practice, +this is not necessary, since most `awk' programs are I/O-bound, and it +clutters up the code. + + The `id' program in *note Id Program::, uses these functions. + + ---------- Footnotes ---------- + + (1) It is often the case that password information is stored in a +network database. + + +File: gawk.info, Node: Group Functions, Prev: Passwd Functions, Up: Library Functions + +12.6 Reading the Group Database +=============================== + +Much of the discussion presented in *note Passwd Functions::, applies +to the group database as well. Although there has traditionally been a +well-known file (`/etc/group') in a well-known format, the POSIX +standard only provides a set of C library routines (`<grp.h>' and +`getgrent') for accessing the information. Even though this file may +exist, it likely does not have complete information. Therefore, as +with the user database, it is necessary to have a small C program that +generates the group database as its output. + + `grcat', a C program that "cats" the group database, is as follows: + + /* + * grcat.c + * + * Generate a printable version of the group database + */ + #include <stdio.h> + #include <grp.h> + + int + main(argc, argv) + int argc; + char **argv; + { + struct group *g; + int i; + + while ((g = getgrent()) != NULL) { + printf("%s:%s:%ld:", g->gr_name, g->gr_passwd, + (long) g->gr_gid); + for (i = 0; g->gr_mem[i] != NULL; i++) { + printf("%s", g->gr_mem[i]); + if (g->gr_mem[i+1] != NULL) + putchar(','); + } + putchar('\n'); + } + endgrent(); + return 0; + } + + Each line in the group database represents one group. The fields are +separated with colons and represent the following information: + +Group name The group's name. +Group password The group's encrypted password. In practice, + this field is never used; it is usually empty + or set to `*'. +Group-ID The group's numeric group ID number; this + number should be unique within the file. +Group member list A comma-separated list of user names. These + users are members of the group. Modern Unix + systems allow users to be members of several + groups simultaneously. If your system does, + then there are elements `"group1"' through + `"groupN"' in `PROCINFO' for those group ID + numbers. (Note that `PROCINFO' is a `gawk' + extension; *note Built-in Variables::.) + + Here is what running `grcat' might produce: + + $ grcat + -| wheel:*:0:arnold + -| nogroup:*:65534: + -| daemon:*:1: + -| kmem:*:2: + -| staff:*:10:arnold,miriam,andy + -| other:*:20: + ... + + Here are the functions for obtaining information from the group +database. There are several, modeled after the C library functions of +the same names: + + # group.awk --- functions for dealing with the group file + BEGIN \ + { + # Change to suit your system + _gr_awklib = "/usr/local/libexec/awk/" + } + + function _gr_init( oldfs, oldrs, olddol0, grcat, + using_fw, n, a, i) + { + if (_gr_inited) + return + + oldfs = FS + oldrs = RS + olddol0 = $0 + using_fw = (PROCINFO["FS"] == "FIELDWIDTHS") + FS = ":" + RS = "\n" + + grcat = _gr_awklib "grcat" + while ((grcat | getline) > 0) { + if ($1 in _gr_byname) + _gr_byname[$1] = _gr_byname[$1] "," $4 + else + _gr_byname[$1] = $0 + if ($3 in _gr_bygid) + _gr_bygid[$3] = _gr_bygid[$3] "," $4 + else + _gr_bygid[$3] = $0 + + n = split($4, a, "[ \t]*,[ \t]*") + for (i = 1; i <= n; i++) + if (a[i] in _gr_groupsbyuser) + _gr_groupsbyuser[a[i]] = \ + _gr_groupsbyuser[a[i]] " " $1 + else + _gr_groupsbyuser[a[i]] = $1 + + _gr_bycount[++_gr_count] = $0 + } + close(grcat) + _gr_count = 0 + _gr_inited++ + FS = oldfs + if (using_fw) + FIELDWIDTHS = FIELDWIDTHS + RS = oldrs + $0 = olddol0 + } + + The `BEGIN' rule sets a private variable to the directory where +`grcat' is stored. Because it is used to help out an `awk' library +routine, we have chosen to put it in `/usr/local/libexec/awk'. You +might want it to be in a different directory on your system. + + These routines follow the same general outline as the user database +routines (*note Passwd Functions::). The `_gr_inited' variable is used +to ensure that the database is scanned no more than once. The +`_gr_init' function first saves `FS', `FIELDWIDTHS', `RS', and `$0', +and then sets `FS' and `RS' to the correct values for scanning the +group information. + + The group information is stored is several associative arrays. The +arrays are indexed by group name (`_gr_byname'), by group ID number +(`_gr_bygid'), and by position in the database (`_gr_bycount'). There +is an additional array indexed by user name (`_gr_groupsbyuser'), which +is a space-separated list of groups to which each user belongs. + + Unlike the user database, it is possible to have multiple records in +the database for the same group. This is common when a group has a +large number of members. A pair of such entries might look like the +following: + + tvpeople:*:101:johnny,jay,arsenio + tvpeople:*:101:david,conan,tom,joan + + For this reason, `_gr_init' looks to see if a group name or group ID +number is already seen. If it is, then the user names are simply +concatenated onto the previous list of users. (There is actually a +subtle problem with the code just presented. Suppose that the first +time there were no names. This code adds the names with a leading +comma. It also doesn't check that there is a `$4'.) + + Finally, `_gr_init' closes the pipeline to `grcat', restores `FS' +(and `FIELDWIDTHS' if necessary), `RS', and `$0', initializes +`_gr_count' to zero (it is used later), and makes `_gr_inited' nonzero. + + The `getgrnam' function takes a group name as its argument, and if +that group exists, it is returned. Otherwise, `getgrnam' returns the +null string: + + function getgrnam(group) + { + _gr_init() + if (group in _gr_byname) + return _gr_byname[group] + return "" + } + + The `getgrgid' function is similar, it takes a numeric group ID and +looks up the information associated with that group ID: + + function getgrgid(gid) + { + _gr_init() + if (gid in _gr_bygid) + return _gr_bygid[gid] + return "" + } + + The `getgruser' function does not have a C counterpart. It takes a +user name and returns the list of groups that have the user as a member: + + function getgruser(user) + { + _gr_init() + if (user in _gr_groupsbyuser) + return _gr_groupsbyuser[user] + return "" + } + + The `getgrent' function steps through the database one entry at a +time. It uses `_gr_count' to track its position in the list: + + function getgrent() + { + _gr_init() + if (++_gr_count in _gr_bycount) + return _gr_bycount[_gr_count] + return "" + } + + The `endgrent' function resets `_gr_count' to zero so that +`getgrent' can start over again: + + function endgrent() + { + _gr_count = 0 + } + + As with the user database routines, each function calls `_gr_init' to +initialize the arrays. Doing so only incurs the extra overhead of +running `grcat' if these functions are used (as opposed to moving the +body of `_gr_init' into a `BEGIN' rule). + + Most of the work is in scanning the database and building the various +associative arrays. The functions that the user calls are themselves +very simple, relying on `awk''s associative arrays to do work. + + The `id' program in *note Id Program::, uses these functions. + + +File: gawk.info, Node: Sample Programs, Next: Language History, Prev: Library Functions, Up: Top + +13 Practical `awk' Programs +*************************** + +*note Library Functions::, presents the idea that reading programs in a +language contributes to learning that language. This major node +continues that theme, presenting a potpourri of `awk' programs for your +reading enjoyment. + + Many of these programs use the library functions presented in *note +Library Functions::. + +* Menu: + +* Running Examples:: How to run these examples. +* Clones:: Clones of common utilities. +* Miscellaneous Programs:: Some interesting `awk' programs. + + +File: gawk.info, Node: Running Examples, Next: Clones, Up: Sample Programs + +13.1 Running the Example Programs +================================= + +To run a given program, you would typically do something like this: + + awk -f PROGRAM -- OPTIONS FILES + +Here, PROGRAM is the name of the `awk' program (such as `cut.awk'), +OPTIONS are any command-line options for the program that start with a +`-', and FILES are the actual data files. + + If your system supports the `#!' executable interpreter mechanism +(*note Executable Scripts::), you can instead run your program directly: + + cut.awk -c1-8 myfiles > results + + If your `awk' is not `gawk', you may instead need to use this: + + cut.awk -- -c1-8 myfiles > results + + +File: gawk.info, Node: Clones, Next: Miscellaneous Programs, Prev: Running Examples, Up: Sample Programs + +13.2 Reinventing Wheels for Fun and Profit +========================================== + +This minor node presents a number of POSIX utilities that are +implemented in `awk'. Reinventing these programs in `awk' is often +enjoyable, because the algorithms can be very clearly expressed, and +the code is usually very concise and simple. This is true because +`awk' does so much for you. + + It should be noted that these programs are not necessarily intended +to replace the installed versions on your system. Instead, their +purpose is to illustrate `awk' language programming for "real world" +tasks. + + The programs are presented in alphabetical order. + +* Menu: + +* Cut Program:: The `cut' utility. +* Egrep Program:: The `egrep' utility. +* Id Program:: The `id' utility. +* Split Program:: The `split' utility. +* Tee Program:: The `tee' utility. +* Uniq Program:: The `uniq' utility. +* Wc Program:: The `wc' utility. + + +File: gawk.info, Node: Cut Program, Next: Egrep Program, Up: Clones + +13.2.1 Cutting out Fields and Columns +------------------------------------- + +The `cut' utility selects, or "cuts," characters or fields from its +standard input and sends them to its standard output. Fields are +separated by tabs by default, but you may supply a command-line option +to change the field "delimiter" (i.e., the field-separator character). +`cut''s definition of fields is less general than `awk''s. + + A common use of `cut' might be to pull out just the login name of +logged-on users from the output of `who'. For example, the following +pipeline generates a sorted, unique list of the logged-on users: + + who | cut -c1-8 | sort | uniq + + The options for `cut' are: + +`-c LIST' + Use LIST as the list of characters to cut out. Items within the + list may be separated by commas, and ranges of characters can be + separated with dashes. The list `1-8,15,22-35' specifies + characters 1 through 8, 15, and 22 through 35. + +`-f LIST' + Use LIST as the list of fields to cut out. + +`-d DELIM' + Use DELIM as the field-separator character instead of the tab + character. + +`-s' + Suppress printing of lines that do not contain the field delimiter. + + The `awk' implementation of `cut' uses the `getopt' library function +(*note Getopt Function::) and the `join' library function (*note Join +Function::). + + The program begins with a comment describing the options, the library +functions needed, and a `usage' function that prints out a usage +message and exits. `usage' is called if invalid arguments are supplied: + + # cut.awk --- implement cut in awk + # Options: + # -f list Cut fields + # -d c Field delimiter character + # -c list Cut characters + # + # -s Suppress lines without the delimiter + # + # Requires getopt and join library functions + + function usage( e1, e2) + { + e1 = "usage: cut [-f list] [-d c] [-s] [files...]" + e2 = "usage: cut [-c list] [files...]" + print e1 > "/dev/stderr" + print e2 > "/dev/stderr" + exit 1 + } + +The variables `e1' and `e2' are used so that the function fits nicely +on the screen. + + Next comes a `BEGIN' rule that parses the command-line options. It +sets `FS' to a single TAB character, because that is `cut''s default +field separator. The output field separator is also set to be the same +as the input field separator. Then `getopt' is used to step through +the command-line options. Exactly one of the variables `by_fields' or +`by_chars' is set to true, to indicate that processing should be done +by fields or by characters, respectively. When cutting by characters, +the output field separator is set to the null string: + + BEGIN \ + { + FS = "\t" # default + OFS = FS + while ((c = getopt(ARGC, ARGV, "sf:c:d:")) != -1) { + if (c == "f") { + by_fields = 1 + fieldlist = Optarg + } else if (c == "c") { + by_chars = 1 + fieldlist = Optarg + OFS = "" + } else if (c == "d") { + if (length(Optarg) > 1) { + printf("Using first character of %s" \ + " for delimiter\n", Optarg) > "/dev/stderr" + Optarg = substr(Optarg, 1, 1) + } + FS = Optarg + OFS = FS + if (FS == " ") # defeat awk semantics + FS = "[ ]" + } else if (c == "s") + suppress++ + else + usage() + } + + for (i = 1; i < Optind; i++) + ARGV[i] = "" + + Special care is taken when the field delimiter is a space. Using a +single space (`" "') for the value of `FS' is incorrect--`awk' would +separate fields with runs of spaces, tabs, and/or newlines, and we want +them to be separated with individual spaces. Also remember that after +`getopt' is through (as described in *note Getopt Function::), we have +to clear out all the elements of `ARGV' from 1 to `Optind', so that +`awk' does not try to process the command-line options as file names. + + After dealing with the command-line options, the program verifies +that the options make sense. Only one or the other of `-c' and `-f' +should be used, and both require a field list. Then the program calls +either `set_fieldlist' or `set_charlist' to pull apart the list of +fields or characters: + + if (by_fields && by_chars) + usage() + + if (by_fields == 0 && by_chars == 0) + by_fields = 1 # default + + if (fieldlist == "") { + print "cut: needs list for -c or -f" > "/dev/stderr" + exit 1 + } + + if (by_fields) + set_fieldlist() + else + set_charlist() + } + + `set_fieldlist' is used to split the field list apart at the commas +and into an array. Then, for each element of the array, it looks to +see if it is actually a range, and if so, splits it apart. The range is +verified to make sure the first number is smaller than the second. +Each number in the list is added to the `flist' array, which simply +lists the fields that will be printed. Normal field splitting is used. +The program lets `awk' handle the job of doing the field splitting: + + function set_fieldlist( n, m, i, j, k, f, g) + { + n = split(fieldlist, f, ",") + j = 1 # index in flist + for (i = 1; i <= n; i++) { + if (index(f[i], "-") != 0) { # a range + m = split(f[i], g, "-") + if (m != 2 || g[1] >= g[2]) { + printf("bad field list: %s\n", + f[i]) > "/dev/stderr" + exit 1 + } + for (k = g[1]; k <= g[2]; k++) + flist[j++] = k + } else + flist[j++] = f[i] + } + nfields = j - 1 + } + + The `set_charlist' function is more complicated than `set_fieldlist'. +The idea here is to use `gawk''s `FIELDWIDTHS' variable (*note Constant +Size::), which describes constant-width input. When using a character +list, that is exactly what we have. + + Setting up `FIELDWIDTHS' is more complicated than simply listing the +fields that need to be printed. We have to keep track of the fields to +print and also the intervening characters that have to be skipped. For +example, suppose you wanted characters 1 through 8, 15, and 22 through +35. You would use `-c 1-8,15,22-35'. The necessary value for +`FIELDWIDTHS' is `"8 6 1 6 14"'. This yields five fields, and the +fields to print are `$1', `$3', and `$5'. The intermediate fields are +"filler", which is stuff in between the desired data. `flist' lists +the fields to print, and `t' tracks the complete field list, including +filler fields: + + function set_charlist( field, i, j, f, g, t, + filler, last, len) + { + field = 1 # count total fields + n = split(fieldlist, f, ",") + j = 1 # index in flist + for (i = 1; i <= n; i++) { + if (index(f[i], "-") != 0) { # range + m = split(f[i], g, "-") + if (m != 2 || g[1] >= g[2]) { + printf("bad character list: %s\n", + f[i]) > "/dev/stderr" + exit 1 + } + len = g[2] - g[1] + 1 + if (g[1] > 1) # compute length of filler + filler = g[1] - last - 1 + else + filler = 0 + if (filler) + t[field++] = filler + t[field++] = len # length of field + last = g[2] + flist[j++] = field - 1 + } else { + if (f[i] > 1) + filler = f[i] - last - 1 + else + filler = 0 + if (filler) + t[field++] = filler + t[field++] = 1 + last = f[i] + flist[j++] = field - 1 + } + } + FIELDWIDTHS = join(t, 1, field - 1) + nfields = j - 1 + } + + Next is the rule that actually processes the data. If the `-s' +option is given, then `suppress' is true. The first `if' statement +makes sure that the input record does have the field separator. If +`cut' is processing fields, `suppress' is true, and the field separator +character is not in the record, then the record is skipped. + + If the record is valid, then `gawk' has split the data into fields, +either using the character in `FS' or using fixed-length fields and +`FIELDWIDTHS'. The loop goes through the list of fields that should be +printed. The corresponding field is printed if it contains data. If +the next field also has data, then the separator character is written +out between the fields: + + { + if (by_fields && suppress && index($0, FS) != 0) + next + + for (i = 1; i <= nfields; i++) { + if ($flist[i] != "") { + printf "%s", $flist[i] + if (i < nfields && $flist[i+1] != "") + printf "%s", OFS + } + } + print "" + } + + This version of `cut' relies on `gawk''s `FIELDWIDTHS' variable to +do the character-based cutting. While it is possible in other `awk' +implementations to use `substr' (*note String Functions::), it is also +extremely painful. The `FIELDWIDTHS' variable supplies an elegant +solution to the problem of picking the input line apart by characters. + + +File: gawk.info, Node: Egrep Program, Next: Id Program, Prev: Cut Program, Up: Clones + +13.2.2 Searching for Regular Expressions in Files +------------------------------------------------- + +The `egrep' utility searches files for patterns. It uses regular +expressions that are almost identical to those available in `awk' +(*note Regexp::). It is used in the following manner: + + egrep [ OPTIONS ] 'PATTERN' FILES ... + + The PATTERN is a regular expression. In typical usage, the regular +expression is quoted to prevent the shell from expanding any of the +special characters as file name wildcards. Normally, `egrep' prints +the lines that matched. If multiple file names are provided on the +command line, each output line is preceded by the name of the file and +a colon. + + The options to `egrep' are as follows: + +`-c' + Print out a count of the lines that matched the pattern, instead + of the lines themselves. + +`-s' + Be silent. No output is produced and the exit value indicates + whether the pattern was matched. + +`-v' + Invert the sense of the test. `egrep' prints the lines that do + _not_ match the pattern and exits successfully if the pattern is + not matched. + +`-i' + Ignore case distinctions in both the pattern and the input data. + +`-l' + Only print (list) the names of the files that matched, not the + lines that matched. + +`-e PATTERN' + Use PATTERN as the regexp to match. The purpose of the `-e' + option is to allow patterns that start with a `-'. + + This version uses the `getopt' library function (*note Getopt +Function::) and the file transition library program (*note Filetrans +Function::). + + The program begins with a descriptive comment and then a `BEGIN' rule +that processes the command-line arguments with `getopt'. The `-i' +(ignore case) option is particularly easy with `gawk'; we just use the +`IGNORECASE' built-in variable (*note Built-in Variables::): + + # egrep.awk --- simulate egrep in awk + # Options: + # -c count of lines + # -s silent - use exit value + # -v invert test, success if no match + # -i ignore case + # -l print filenames only + # -e argument is pattern + # + # Requires getopt and file transition library functions + + BEGIN { + while ((c = getopt(ARGC, ARGV, "ce:svil")) != -1) { + if (c == "c") + count_only++ + else if (c == "s") + no_print++ + else if (c == "v") + invert++ + else if (c == "i") + IGNORECASE = 1 + else if (c == "l") + filenames_only++ + else if (c == "e") + pattern = Optarg + else + usage() + } + + Next comes the code that handles the `egrep'-specific behavior. If no +pattern is supplied with `-e', the first nonoption on the command line +is used. The `awk' command-line arguments up to `ARGV[Optind]' are +cleared, so that `awk' won't try to process them as files. If no files +are specified, the standard input is used, and if multiple files are +specified, we make sure to note this so that the file names can precede +the matched lines in the output: + + if (pattern == "") + pattern = ARGV[Optind++] + + for (i = 1; i < Optind; i++) + ARGV[i] = "" + if (Optind >= ARGC) { + ARGV[1] = "-" + ARGC = 2 + } else if (ARGC - Optind > 1) + do_filenames++ + + # if (IGNORECASE) + # pattern = tolower(pattern) + } + + The last two lines are commented out, since they are not needed in +`gawk'. They should be uncommented if you have to use another version +of `awk'. + + The next set of lines should be uncommented if you are not using +`gawk'. This rule translates all the characters in the input line into +lowercase if the `-i' option is specified.(1) The rule is commented out +since it is not necessary with `gawk': + + #{ + # if (IGNORECASE) + # $0 = tolower($0) + #} + + The `beginfile' function is called by the rule in `ftrans.awk' when +each new file is processed. In this case, it is very simple; all it +does is initialize a variable `fcount' to zero. `fcount' tracks how +many lines in the current file matched the pattern (naming the +parameter `junk' shows we know that `beginfile' is called with a +parameter, but that we're not interested in its value): + + function beginfile(junk) + { + fcount = 0 + } + + The `endfile' function is called after each file has been processed. +It affects the output only when the user wants a count of the number of +lines that matched. `no_print' is true only if the exit status is +desired. `count_only' is true if line counts are desired. `egrep' +therefore only prints line counts if printing and counting are enabled. +The output format must be adjusted depending upon the number of files to +process. Finally, `fcount' is added to `total', so that we know the +total number of lines that matched the pattern: + + function endfile(file) + { + if (! no_print && count_only) + if (do_filenames) + print file ":" fcount + else + print fcount + + total += fcount + } + + The following rule does most of the work of matching lines. The +variable `matches' is true if the line matched the pattern. If the user +wants lines that did not match, the sense of `matches' is inverted +using the `!' operator. `fcount' is incremented with the value of +`matches', which is either one or zero, depending upon a successful or +unsuccessful match. If the line does not match, the `next' statement +just moves on to the next record. + + A number of additional tests are made, but they are only done if we +are not counting lines. First, if the user only wants exit status +(`no_print' is true), then it is enough to know that _one_ line in this +file matched, and we can skip on to the next file with `nextfile'. +Similarly, if we are only printing file names, we can print the file +name, and then skip to the next file with `nextfile'. Finally, each +line is printed, with a leading file name and colon if necessary: + + { + matches = ($0 ~ pattern) + if (invert) + matches = ! matches + + fcount += matches # 1 or 0 + + if (! matches) + next + + if (! count_only) { + if (no_print) + nextfile + + if (filenames_only) { + print FILENAME + nextfile + } + + if (do_filenames) + print FILENAME ":" $0 + else + print + } + } + + The `END' rule takes care of producing the correct exit status. If +there are no matches, the exit status is one; otherwise it is zero: + + END \ + { + if (total == 0) + exit 1 + exit 0 + } + + The `usage' function prints a usage message in case of invalid +options, and then exits: + + function usage( e) + { + e = "Usage: egrep [-csvil] [-e pat] [files ...]" + e = e "\n\tegrep [-csvil] pat [files ...]" + print e > "/dev/stderr" + exit 1 + } + + The variable `e' is used so that the function fits nicely on the +printed page. + + Just a note on programming style: you may have noticed that the `END' +rule uses backslash continuation, with the open brace on a line by +itself. This is so that it more closely resembles the way functions +are written. Many of the examples in this major node use this style. +You can decide for yourself if you like writing your `BEGIN' and `END' +rules this way or not. + + ---------- Footnotes ---------- + + (1) It also introduces a subtle bug; if a match happens, we output +the translated line, not the original. + + +File: gawk.info, Node: Id Program, Next: Split Program, Prev: Egrep Program, Up: Clones + +13.2.3 Printing out User Information +------------------------------------ + +The `id' utility lists a user's real and effective user ID numbers, +real and effective group ID numbers, and the user's group set, if any. +`id' only prints the effective user ID and group ID if they are +different from the real ones. If possible, `id' also supplies the +corresponding user and group names. The output might look like this: + + $ id + -| uid=2076(arnold) gid=10(staff) groups=10(staff),4(tty) + + This information is part of what is provided by `gawk''s `PROCINFO' +array (*note Built-in Variables::). However, the `id' utility provides +a more palatable output than just individual numbers. + + Here is a simple version of `id' written in `awk'. It uses the user +database library functions (*note Passwd Functions::) and the group +database library functions (*note Group Functions::): + + The program is fairly straightforward. All the work is done in the +`BEGIN' rule. The user and group ID numbers are obtained from +`PROCINFO'. The code is repetitive. The entry in the user database +for the real user ID number is split into parts at the `:'. The name is +the first field. Similar code is used for the effective user ID number +and the group numbers: + + # id.awk --- implement id in awk + # + # Requires user and group library functions + # output is: + # uid=12(foo) euid=34(bar) gid=3(baz) \ + # egid=5(blat) groups=9(nine),2(two),1(one) + + BEGIN \ + { + uid = PROCINFO["uid"] + euid = PROCINFO["euid"] + gid = PROCINFO["gid"] + egid = PROCINFO["egid"] + + printf("uid=%d", uid) + pw = getpwuid(uid) + if (pw != "") { + split(pw, a, ":") + printf("(%s)", a[1]) + } + + if (euid != uid) { + printf(" euid=%d", euid) + pw = getpwuid(euid) + if (pw != "") { + split(pw, a, ":") + printf("(%s)", a[1]) + } + } + + printf(" gid=%d", gid) + pw = getgrgid(gid) + if (pw != "") { + split(pw, a, ":") + printf("(%s)", a[1]) + } + + if (egid != gid) { + printf(" egid=%d", egid) + pw = getgrgid(egid) + if (pw != "") { + split(pw, a, ":") + printf("(%s)", a[1]) + } + } + + for (i = 1; ("group" i) in PROCINFO; i++) { + if (i == 1) + printf(" groups=") + group = PROCINFO["group" i] + printf("%d", group) + pw = getgrgid(group) + if (pw != "") { + split(pw, a, ":") + printf("(%s)", a[1]) + } + if (("group" (i+1)) in PROCINFO) + printf(",") + } + + print "" + } + + The test in the `for' loop is worth noting. Any supplementary +groups in the `PROCINFO' array have the indices `"group1"' through +`"groupN"' for some N, i.e., the total number of supplementary groups. +However, we don't know in advance how many of these groups there are. + + This loop works by starting at one, concatenating the value with +`"group"', and then using `in' to see if that value is in the array. +Eventually, `i' is incremented past the last group in the array and the +loop exits. + + The loop is also correct if there are _no_ supplementary groups; +then the condition is false the first time it's tested, and the loop +body never executes. + + +File: gawk.info, Node: Split Program, Next: Tee Program, Prev: Id Program, Up: Clones + +13.2.4 Splitting a Large File into Pieces +----------------------------------------- + +The `split' program splits large text files into smaller pieces. Usage +is as follows: + + split [-COUNT] file [ PREFIX ] + + By default, the output files are named `xaa', `xab', and so on. Each +file has 1000 lines in it, with the likely exception of the last file. +To change the number of lines in each file, supply a number on the +command line preceded with a minus; e.g., `-500' for files with 500 +lines in them instead of 1000. To change the name of the output files +to something like `myfileaa', `myfileab', and so on, supply an +additional argument that specifies the file name prefix. + + Here is a version of `split' in `awk'. It uses the `ord' and `chr' +functions presented in *note Ordinal Functions::. + + The program first sets its defaults, and then tests to make sure +there are not too many arguments. It then looks at each argument in +turn. The first argument could be a minus sign followed by a number. +If it is, this happens to look like a negative number, so it is made +positive, and that is the count of lines. The data file name is +skipped over and the final argument is used as the prefix for the +output file names: + + # split.awk --- do split in awk + # + # Requires ord and chr library functions + # usage: split [-num] [file] [outname] + + BEGIN { + outfile = "x" # default + count = 1000 + if (ARGC > 4) + usage() + + i = 1 + if (ARGV[i] ~ /^-[0-9]+$/) { + count = -ARGV[i] + ARGV[i] = "" + i++ + } + # test argv in case reading from stdin instead of file + if (i in ARGV) + i++ # skip data file name + if (i in ARGV) { + outfile = ARGV[i] + ARGV[i] = "" + } + + s1 = s2 = "a" + out = (outfile s1 s2) + } + + The next rule does most of the work. `tcount' (temporary count) +tracks how many lines have been printed to the output file so far. If +it is greater than `count', it is time to close the current file and +start a new one. `s1' and `s2' track the current suffixes for the file +name. If they are both `z', the file is just too big. Otherwise, `s1' +moves to the next letter in the alphabet and `s2' starts over again at +`a': + + { + if (++tcount > count) { + close(out) + if (s2 == "z") { + if (s1 == "z") { + printf("split: %s is too large to split\n", + FILENAME) > "/dev/stderr" + exit 1 + } + s1 = chr(ord(s1) + 1) + s2 = "a" + } + else + s2 = chr(ord(s2) + 1) + out = (outfile s1 s2) + tcount = 1 + } + print > out + } + +The `usage' function simply prints an error message and exits: + + function usage( e) + { + e = "usage: split [-num] [file] [outname]" + print e > "/dev/stderr" + exit 1 + } + +The variable `e' is used so that the function fits nicely on the screen. + + This program is a bit sloppy; it relies on `awk' to automatically +close the last file instead of doing it in an `END' rule. It also +assumes that letters are contiguous in the character set, which isn't +true for EBCDIC systems. + + +File: gawk.info, Node: Tee Program, Next: Uniq Program, Prev: Split Program, Up: Clones + +13.2.5 Duplicating Output into Multiple Files +--------------------------------------------- + +The `tee' program is known as a "pipe fitting." `tee' copies its +standard input to its standard output and also duplicates it to the +files named on the command line. Its usage is as follows: + + tee [-a] file ... + + The `-a' option tells `tee' to append to the named files, instead of +truncating them and starting over. + + The `BEGIN' rule first makes a copy of all the command-line arguments +into an array named `copy'. `ARGV[0]' is not copied, since it is not +needed. `tee' cannot use `ARGV' directly, since `awk' attempts to +process each file name in `ARGV' as input data. + + If the first argument is `-a', then the flag variable `append' is +set to true, and both `ARGV[1]' and `copy[1]' are deleted. If `ARGC' is +less than two, then no file names were supplied and `tee' prints a +usage message and exits. Finally, `awk' is forced to read the standard +input by setting `ARGV[1]' to `"-"' and `ARGC' to two: + + # tee.awk --- tee in awk + BEGIN \ + { + for (i = 1; i < ARGC; i++) + copy[i] = ARGV[i] + + if (ARGV[1] == "-a") { + append = 1 + delete ARGV[1] + delete copy[1] + ARGC-- + } + if (ARGC < 2) { + print "usage: tee [-a] file ..." > "/dev/stderr" + exit 1 + } + ARGV[1] = "-" + ARGC = 2 + } + + The single rule does all the work. Since there is no pattern, it is +executed for each line of input. The body of the rule simply prints the +line into each file on the command line, and then to the standard +output: + + { + # moving the if outside the loop makes it run faster + if (append) + for (i in copy) + print >> copy[i] + else + for (i in copy) + print > copy[i] + print + } + +It is also possible to write the loop this way: + + for (i in copy) + if (append) + print >> copy[i] + else + print > copy[i] + +This is more concise but it is also less efficient. The `if' is tested +for each record and for each output file. By duplicating the loop +body, the `if' is only tested once for each input record. If there are +N input records and M output files, the first method only executes N +`if' statements, while the second executes N`*'M `if' statements. + + Finally, the `END' rule cleans up by closing all the output files: + + END \ + { + for (i in copy) + close(copy[i]) + } + + +File: gawk.info, Node: Uniq Program, Next: Wc Program, Prev: Tee Program, Up: Clones + +13.2.6 Printing Nonduplicated Lines of Text +------------------------------------------- + +The `uniq' utility reads sorted lines of data on its standard input, +and by default removes duplicate lines. In other words, it only prints +unique lines--hence the name. `uniq' has a number of options. The +usage is as follows: + + uniq [-udc [-N]] [+N] [ INPUT FILE [ OUTPUT FILE ]] + + The options for `uniq' are: + +`-d' + Pnly print only repeated lines. + +`-u' + Print only nonrepeated lines. + +`-c' + Count lines. This option overrides `-d' and `-u'. Both repeated + and nonrepeated lines are counted. + +`-N' + Skip N fields before comparing lines. The definition of fields is + similar to `awk''s default: nonwhitespace characters separated by + runs of spaces and/or tabs. + +`+N' + Skip N characters before comparing lines. Any fields specified + with `-N' are skipped first. + +`INPUT FILE' + Data is read from the input file named on the command line, + instead of from the standard input. + +`OUTPUT FILE' + The generated output is sent to the named output file, instead of + to the standard output. + + Normally `uniq' behaves as if both the `-d' and `-u' options are +provided. + + `uniq' uses the `getopt' library function (*note Getopt Function::) +and the `join' library function (*note Join Function::). + + The program begins with a `usage' function and then a brief outline +of the options and their meanings in a comment. The `BEGIN' rule deals +with the command-line arguments and options. It uses a trick to get +`getopt' to handle options of the form `-25', treating such an option +as the option letter `2' with an argument of `5'. If indeed two or more +digits are supplied (`Optarg' looks like a number), `Optarg' is +concatenated with the option digit and then the result is added to zero +to make it into a number. If there is only one digit in the option, +then `Optarg' is not needed. In this case, `Optind' must be decremented +so that `getopt' processes it next time. This code is admittedly a bit +tricky. + + If no options are supplied, then the default is taken, to print both +repeated and nonrepeated lines. The output file, if provided, is +assigned to `outputfile'. Early on, `outputfile' is initialized to the +standard output, `/dev/stdout': + + # uniq.awk --- do uniq in awk + # + # Requires getopt and join library functions + function usage( e) + { + e = "Usage: uniq [-udc [-n]] [+n] [ in [ out ]]" + print e > "/dev/stderr" + exit 1 + } + + # -c count lines. overrides -d and -u + # -d only repeated lines + # -u only non-repeated lines + # -n skip n fields + # +n skip n characters, skip fields first + + BEGIN \ + { + count = 1 + outputfile = "/dev/stdout" + opts = "udc0:1:2:3:4:5:6:7:8:9:" + while ((c = getopt(ARGC, ARGV, opts)) != -1) { + if (c == "u") + non_repeated_only++ + else if (c == "d") + repeated_only++ + else if (c == "c") + do_count++ + else if (index("0123456789", c) != 0) { + # getopt requires args to options + # this messes us up for things like -5 + if (Optarg ~ /^[0-9]+$/) + fcount = (c Optarg) + 0 + else { + fcount = c + 0 + Optind-- + } + } else + usage() + } + + if (ARGV[Optind] ~ /^\+[0-9]+$/) { + charcount = substr(ARGV[Optind], 2) + 0 + Optind++ + } + + for (i = 1; i < Optind; i++) + ARGV[i] = "" + + if (repeated_only == 0 && non_repeated_only == 0) + repeated_only = non_repeated_only = 1 + + if (ARGC - Optind == 2) { + outputfile = ARGV[ARGC - 1] + ARGV[ARGC - 1] = "" + } + } + + The following function, `are_equal', compares the current line, +`$0', to the previous line, `last'. It handles skipping fields and +characters. If no field count and no character count are specified, +`are_equal' simply returns one or zero depending upon the result of a +simple string comparison of `last' and `$0'. Otherwise, things get more +complicated. If fields have to be skipped, each line is broken into an +array using `split' (*note String Functions::); the desired fields are +then joined back into a line using `join'. The joined lines are stored +in `clast' and `cline'. If no fields are skipped, `clast' and `cline' +are set to `last' and `$0', respectively. Finally, if characters are +skipped, `substr' is used to strip off the leading `charcount' +characters in `clast' and `cline'. The two strings are then compared +and `are_equal' returns the result: + + function are_equal( n, m, clast, cline, alast, aline) + { + if (fcount == 0 && charcount == 0) + return (last == $0) + + if (fcount > 0) { + n = split(last, alast) + m = split($0, aline) + clast = join(alast, fcount+1, n) + cline = join(aline, fcount+1, m) + } else { + clast = last + cline = $0 + } + if (charcount) { + clast = substr(clast, charcount + 1) + cline = substr(cline, charcount + 1) + } + + return (clast == cline) + } + + The following two rules are the body of the program. The first one +is executed only for the very first line of data. It sets `last' equal +to `$0', so that subsequent lines of text have something to be compared +to. + + The second rule does the work. The variable `equal' is one or zero, +depending upon the results of `are_equal''s comparison. If `uniq' is +counting repeated lines, and the lines are equal, then it increments +the `count' variable. Otherwise, it prints the line and resets `count', +since the two lines are not equal. + + If `uniq' is not counting, and if the lines are equal, `count' is +incremented. Nothing is printed, since the point is to remove +duplicates. Otherwise, if `uniq' is counting repeated lines and more +than one line is seen, or if `uniq' is counting nonrepeated lines and +only one line is seen, then the line is printed, and `count' is reset. + + Finally, similar logic is used in the `END' rule to print the final +line of input data: + + NR == 1 { + last = $0 + next + } + + { + equal = are_equal() + + if (do_count) { # overrides -d and -u + if (equal) + count++ + else { + printf("%4d %s\n", count, last) > outputfile + last = $0 + count = 1 # reset + } + next + } + + if (equal) + count++ + else { + if ((repeated_only && count > 1) || + (non_repeated_only && count == 1)) + print last > outputfile + last = $0 + count = 1 + } + } + + END { + if (do_count) + printf("%4d %s\n", count, last) > outputfile + else if ((repeated_only && count > 1) || + (non_repeated_only && count == 1)) + print last > outputfile + } + + +File: gawk.info, Node: Wc Program, Prev: Uniq Program, Up: Clones + +13.2.7 Counting Things +---------------------- + +The `wc' (word count) utility counts lines, words, and characters in +one or more input files. Its usage is as follows: + + wc [-lwc] [ FILES ... ] + + If no files are specified on the command line, `wc' reads its +standard input. If there are multiple files, it also prints total +counts for all the files. The options and their meanings are shown in +the following list: + +`-l' + Count only lines. + +`-w' + Count only words. A "word" is a contiguous sequence of + nonwhitespace characters, separated by spaces and/or tabs. + Luckily, this is the normal way `awk' separates fields in its + input data. + +`-c' + Count only characters. + + Implementing `wc' in `awk' is particularly elegant, since `awk' does +a lot of the work for us; it splits lines into words (i.e., fields) and +counts them, it counts lines (i.e., records), and it can easily tell us +how long a line is. + + This uses the `getopt' library function (*note Getopt Function::) +and the file-transition functions (*note Filetrans Function::). + + This version has one notable difference from traditional versions of +`wc': it always prints the counts in the order lines, words, and +characters. Traditional versions note the order of the `-l', `-w', and +`-c' options on the command line, and print the counts in that order. + + The `BEGIN' rule does the argument processing. The variable +`print_total' is true if more than one file is named on the command +line: + + # wc.awk --- count lines, words, characters + + # Options: + # -l only count lines + # -w only count words + # -c only count characters + # + # Default is to count lines, words, characters + # + # Requires getopt and file transition library functions + + BEGIN { + # let getopt print a message about + # invalid options. we ignore them + while ((c = getopt(ARGC, ARGV, "lwc")) != -1) { + if (c == "l") + do_lines = 1 + else if (c == "w") + do_words = 1 + else if (c == "c") + do_chars = 1 + } + for (i = 1; i < Optind; i++) + ARGV[i] = "" + + # if no options, do all + if (! do_lines && ! do_words && ! do_chars) + do_lines = do_words = do_chars = 1 + + print_total = (ARGC - i > 2) + } + + The `beginfile' function is simple; it just resets the counts of +lines, words, and characters to zero, and saves the current file name in +`fname': + + function beginfile(file) + { + chars = lines = words = 0 + fname = FILENAME + } + + The `endfile' function adds the current file's numbers to the running +totals of lines, words, and characters.(1) It then prints out those +numbers for the file that was just read. It relies on `beginfile' to +reset the numbers for the following data file: + + function endfile(file) + { + tchars += chars + tlines += lines + twords += words + if (do_lines) + printf "\t%d", lines + if (do_words) + printf "\t%d", words + if (do_chars) + printf "\t%d", chars + printf "\t%s\n", fname + } + + There is one rule that is executed for each line. It adds the length +of the record, plus one, to `chars'. Adding one plus the record length +is needed because the newline character separating records (the value +of `RS') is not part of the record itself, and thus not included in its +length. Next, `lines' is incremented for each line read, and `words' +is incremented by the value of `NF', which is the number of "words" on +this line: + + # do per line + { + chars += length($0) + 1 # get newline + lines++ + words += NF + } + + Finally, the `END' rule simply prints the totals for all the files: + + END { + if (print_total) { + if (do_lines) + printf "\t%d", tlines + if (do_words) + printf "\t%d", twords + if (do_chars) + printf "\t%d", tchars + print "\ttotal" + } + } + + ---------- Footnotes ---------- + + (1) `wc' can't just use the value of `FNR' in `endfile'. If you +examine the code in *note Filetrans Function::, you will see that `FNR' +has already been reset by the time `endfile' is called. + + +File: gawk.info, Node: Miscellaneous Programs, Prev: Clones, Up: Sample Programs + +13.3 A Grab Bag of `awk' Programs +================================= + +This minor node is a large "grab bag" of miscellaneous programs. We +hope you find them both interesting and enjoyable. + +* Menu: + +* Dupword Program:: Finding duplicated words in a document. +* Alarm Program:: An alarm clock. +* Translate Program:: A program similar to the `tr' utility. +* Labels Program:: Printing mailing labels. +* Word Sorting:: A program to produce a word usage count. +* History Sorting:: Eliminating duplicate entries from a history + file. +* Extract Program:: Pulling out programs from Texinfo source + files. +* Simple Sed:: A Simple Stream Editor. +* Igawk Program:: A wrapper for `awk' that includes + files. + + +File: gawk.info, Node: Dupword Program, Next: Alarm Program, Up: Miscellaneous Programs + +13.3.1 Finding Duplicated Words in a Document +--------------------------------------------- + +A common error when writing large amounts of prose is to accidentally +duplicate words. Typically you will see this in text as something like +"the the program does the following..." When the text is online, often +the duplicated words occur at the end of one line and the beginning of +another, making them very difficult to spot. + + This program, `dupword.awk', scans through a file one line at a time +and looks for adjacent occurrences of the same word. It also saves the +last word on a line (in the variable `prev') for comparison with the +first word on the next line. + + The first two statements make sure that the line is all lowercase, +so that, for example, "The" and "the" compare equal to each other. The +next statement replaces nonalphanumeric and nonwhitespace characters +with spaces, so that punctuation does not affect the comparison either. +The characters are replaced with spaces so that formatting controls +don't create nonsense words (e.g., the Texinfo `@code{NF}' becomes +`codeNF' if punctuation is simply deleted). The record is then resplit +into fields, yielding just the actual words on the line, and ensuring +that there are no empty fields. + + If there are no fields left after removing all the punctuation, the +current record is skipped. Otherwise, the program loops through each +word, comparing it to the previous one: + + # dupword.awk --- find duplicate words in text + { + $0 = tolower($0) + gsub(/[^[:alnum:][:blank:]]/, " "); + $0 = $0 # re-split + if (NF == 0) + next + if ($1 == prev) + printf("%s:%d: duplicate %s\n", + FILENAME, FNR, $1) + for (i = 2; i <= NF; i++) + if ($i == $(i-1)) + printf("%s:%d: duplicate %s\n", + FILENAME, FNR, $i) + prev = $NF + } + + +File: gawk.info, Node: Alarm Program, Next: Translate Program, Prev: Dupword Program, Up: Miscellaneous Programs + +13.3.2 An Alarm Clock Program +----------------------------- + + Nothing cures insomnia like a ringing alarm clock. + Arnold Robbins + + The following program is a simple "alarm clock" program. You give +it a time of day and an optional message. At the specified time, it +prints the message on the standard output. In addition, you can give it +the number of times to repeat the message as well as a delay between +repetitions. + + This program uses the `gettimeofday' function from *note +Gettimeofday Function::. + + All the work is done in the `BEGIN' rule. The first part is argument +checking and setting of defaults: the delay, the count, and the message +to print. If the user supplied a message without the ASCII BEL +character (known as the "alert" character, `"\a"'), then it is added to +the message. (On many systems, printing the ASCII BEL generates an +audible alert. Thus when the alarm goes off, the system calls attention +to itself in case the user is not looking at the computer or terminal.) +Here is the program: + + # alarm.awk --- set an alarm + # + # Requires gettimeofday library function + # usage: alarm time [ "message" [ count [ delay ] ] ] + + BEGIN \ + { + # Initial argument sanity checking + usage1 = "usage: alarm time ['message' [count [delay]]]" + usage2 = sprintf("\t(%s) time ::= hh:mm", ARGV[1]) + + if (ARGC < 2) { + print usage1 > "/dev/stderr" + print usage2 > "/dev/stderr" + exit 1 + } else if (ARGC == 5) { + delay = ARGV[4] + 0 + count = ARGV[3] + 0 + message = ARGV[2] + } else if (ARGC == 4) { + count = ARGV[3] + 0 + message = ARGV[2] + } else if (ARGC == 3) { + message = ARGV[2] + } else if (ARGV[1] !~ /[0-9]?[0-9]:[0-9][0-9]/) { + print usage1 > "/dev/stderr" + print usage2 > "/dev/stderr" + exit 1 + } + + # set defaults for once we reach the desired time + if (delay == 0) + delay = 180 # 3 minutes + if (count == 0) + count = 5 + if (message == "") + message = sprintf("\aIt is now %s!\a", ARGV[1]) + else if (index(message, "\a") == 0) + message = "\a" message "\a" + + The next minor node of code turns the alarm time into hours and +minutes, converts it (if necessary) to a 24-hour clock, and then turns +that time into a count of the seconds since midnight. Next it turns +the current time into a count of seconds since midnight. The +difference between the two is how long to wait before setting off the +alarm: + + # split up alarm time + split(ARGV[1], atime, ":") + hour = atime[1] + 0 # force numeric + minute = atime[2] + 0 # force numeric + + # get current broken down time + gettimeofday(now) + + # if time given is 12-hour hours and it's after that + # hour, e.g., `alarm 5:30' at 9 a.m. means 5:30 p.m., + # then add 12 to real hour + if (hour < 12 && now["hour"] > hour) + hour += 12 + + # set target time in seconds since midnight + target = (hour * 60 * 60) + (minute * 60) + + # get current time in seconds since midnight + current = (now["hour"] * 60 * 60) + \ + (now["minute"] * 60) + now["second"] + + # how long to sleep for + naptime = target - current + if (naptime <= 0) { + print "time is in the past!" > "/dev/stderr" + exit 1 + } + + Finally, the program uses the `system' function (*note I/O +Functions::) to call the `sleep' utility. The `sleep' utility simply +pauses for the given number of seconds. If the exit status is not zero, +the program assumes that `sleep' was interrupted and exits. If `sleep' +exited with an OK status (zero), then the program prints the message in +a loop, again using `sleep' to delay for however many seconds are +necessary: + + # zzzzzz..... go away if interrupted + if (system(sprintf("sleep %d", naptime)) != 0) + exit 1 + + # time to notify! + command = sprintf("sleep %d", delay) + for (i = 1; i <= count; i++) { + print message + # if sleep command interrupted, go away + if (system(command) != 0) + break + } + + exit 0 + } + + +File: gawk.info, Node: Translate Program, Next: Labels Program, Prev: Alarm Program, Up: Miscellaneous Programs + +13.3.3 Transliterating Characters +--------------------------------- + +The system `tr' utility transliterates characters. For example, it is +often used to map uppercase letters into lowercase for further +processing: + + GENERATE DATA | tr 'A-Z' 'a-z' | PROCESS DATA ... + + `tr' requires two lists of characters.(1) When processing the +input, the first character in the first list is replaced with the first +character in the second list, the second character in the first list is +replaced with the second character in the second list, and so on. If +there are more characters in the "from" list than in the "to" list, the +last character of the "to" list is used for the remaining characters in +the "from" list. + + Some time ago, a user proposed that a transliteration function should +be added to `gawk'. The following program was written to prove that +character transliteration could be done with a user-level function. +This program is not as complete as the system `tr' utility but it does +most of the job. + + The `translate' program demonstrates one of the few weaknesses of +standard `awk': dealing with individual characters is very painful, +requiring repeated use of the `substr', `index', and `gsub' built-in +functions (*note String Functions::).(2) There are two functions. The +first, `stranslate', takes three arguments: + +`from' + A list of characters from which to translate. + +`to' + A list of characters to which to translate. + +`target' + The string on which to do the translation. + + Associative arrays make the translation part fairly easy. `t_ar' +holds the "to" characters, indexed by the "from" characters. Then a +simple loop goes through `from', one character at a time. For each +character in `from', if the character appears in `target', `gsub' is +used to change it to the corresponding `to' character. + + The `translate' function simply calls `stranslate' using `$0' as the +target. The main program sets two global variables, `FROM' and `TO', +from the command line, and then changes `ARGV' so that `awk' reads from +the standard input. + + Finally, the processing rule simply calls `translate' for each +record: + + # translate.awk --- do tr-like stuff + # Bugs: does not handle things like: tr A-Z a-z, it has + # to be spelled out. However, if `to' is shorter than `from', + # the last character in `to' is used for the rest of `from'. + + function stranslate(from, to, target, lf, lt, t_ar, i, c) + { + lf = length(from) + lt = length(to) + for (i = 1; i <= lt; i++) + t_ar[substr(from, i, 1)] = substr(to, i, 1) + if (lt < lf) + for (; i <= lf; i++) + t_ar[substr(from, i, 1)] = substr(to, lt, 1) + for (i = 1; i <= lf; i++) { + c = substr(from, i, 1) + if (index(target, c) > 0) + gsub(c, t_ar[c], target) + } + return target + } + + function translate(from, to) + { + return $0 = stranslate(from, to, $0) + } + + # main program + BEGIN { + if (ARGC < 3) { + print "usage: translate from to" > "/dev/stderr" + exit + } + FROM = ARGV[1] + TO = ARGV[2] + ARGC = 2 + ARGV[1] = "-" + } + + { + translate(FROM, TO) + print + } + + While it is possible to do character transliteration in a user-level +function, it is not necessarily efficient, and we (the `gawk' authors) +started to consider adding a built-in function. However, shortly after +writing this program, we learned that the System V Release 4 `awk' had +added the `toupper' and `tolower' functions (*note String Functions::). +These functions handle the vast majority of the cases where character +transliteration is necessary, and so we chose to simply add those +functions to `gawk' as well and then leave well enough alone. + + An obvious improvement to this program would be to set up the `t_ar' +array only once, in a `BEGIN' rule. However, this assumes that the +"from" and "to" lists will never change throughout the lifetime of the +program. + + ---------- Footnotes ---------- + + (1) On some older System V systems, `tr' may require that the lists +be written as range expressions enclosed in square brackets (`[a-z]') +and quoted, to prevent the shell from attempting a file name expansion. +This is not a feature. + + (2) This program was written before `gawk' acquired the ability to +split each character in a string into separate array elements. + + +File: gawk.info, Node: Labels Program, Next: Word Sorting, Prev: Translate Program, Up: Miscellaneous Programs + +13.3.4 Printing Mailing Labels +------------------------------ + +Here is a "real world"(1) program. This script reads lists of names and +addresses and generates mailing labels. Each page of labels has 20 +labels on it, 2 across and 10 down. The addresses are guaranteed to be +no more than 5 lines of data. Each address is separated from the next +by a blank line. + + The basic idea is to read 20 labels worth of data. Each line of +each label is stored in the `line' array. The single rule takes care +of filling the `line' array and printing the page when 20 labels have +been read. + + The `BEGIN' rule simply sets `RS' to the empty string, so that `awk' +splits records at blank lines (*note Records::). It sets `MAXLINES' to +100, since 100 is the maximum number of lines on the page (20 * 5 = +100). + + Most of the work is done in the `printpage' function. The label +lines are stored sequentially in the `line' array. But they have to +print horizontally; `line[1]' next to `line[6]', `line[2]' next to +`line[7]', and so on. Two loops are used to accomplish this. The +outer loop, controlled by `i', steps through every 10 lines of data; +this is each row of labels. The inner loop, controlled by `j', goes +through the lines within the row. As `j' goes from 0 to 4, `i+j' is +the `j'-th line in the row, and `i+j+5' is the entry next to it. The +output ends up looking something like this: + + line 1 line 6 + line 2 line 7 + line 3 line 8 + line 4 line 9 + line 5 line 10 + ... + + As a final note, an extra blank line is printed at lines 21 and 61, +to keep the output lined up on the labels. This is dependent on the +particular brand of labels in use when the program was written. You +will also note that there are 2 blank lines at the top and 2 blank +lines at the bottom. + + The `END' rule arranges to flush the final page of labels; there may +not have been an even multiple of 20 labels in the data: + + # labels.awk --- print mailing labels + + # Each label is 5 lines of data that may have blank lines. + # The label sheets have 2 blank lines at the top and 2 at + # the bottom. + + BEGIN { RS = "" ; MAXLINES = 100 } + + function printpage( i, j) + { + if (Nlines <= 0) + return + + printf "\n\n" # header + + for (i = 1; i <= Nlines; i += 10) { + if (i == 21 || i == 61) + print "" + for (j = 0; j < 5; j++) { + if (i + j > MAXLINES) + break + printf " %-41s %s\n", line[i+j], line[i+j+5] + } + print "" + } + + printf "\n\n" # footer + + for (i in line) + line[i] = "" + } + + # main rule + { + if (Count >= 20) { + printpage() + Count = 0 + Nlines = 0 + } + n = split($0, a, "\n") + for (i = 1; i <= n; i++) + line[++Nlines] = a[i] + for (; i <= 5; i++) + line[++Nlines] = "" + Count++ + } + + END \ + { + printpage() + } + + ---------- Footnotes ---------- + + (1) "Real world" is defined as "a program actually used to get +something done." + + +File: gawk.info, Node: Word Sorting, Next: History Sorting, Prev: Labels Program, Up: Miscellaneous Programs + +13.3.5 Generating Word-Usage Counts +----------------------------------- + +The following `awk' program prints the number of occurrences of each +word in its input. It illustrates the associative nature of `awk' +arrays by using strings as subscripts. It also demonstrates the `for +INDEX in ARRAY' mechanism. Finally, it shows how `awk' is used in +conjunction with other utility programs to do a useful task of some +complexity with a minimum of effort. Some explanations follow the +program listing: + + # Print list of word frequencies + { + for (i = 1; i <= NF; i++) + freq[$i]++ + } + + END { + for (word in freq) + printf "%s\t%d\n", word, freq[word] + } + + This program has two rules. The first rule, because it has an empty +pattern, is executed for every input line. It uses `awk''s +field-accessing mechanism (*note Fields::) to pick out the individual +words from the line, and the built-in variable `NF' (*note Built-in +Variables::) to know how many fields are available. For each input +word, it increments an element of the array `freq' to reflect that the +word has been seen an additional time. + + The second rule, because it has the pattern `END', is not executed +until the input has been exhausted. It prints out the contents of the +`freq' table that has been built up inside the first action. This +program has several problems that would prevent it from being useful by +itself on real text files: + + * Words are detected using the `awk' convention that fields are + separated just by whitespace. Other characters in the input + (except newlines) don't have any special meaning to `awk'. This + means that punctuation characters count as part of words. + + * The `awk' language considers upper- and lowercase characters to be + distinct. Therefore, "bartender" and "Bartender" are not treated + as the same word. This is undesirable, since in normal text, words + are capitalized if they begin sentences, and a frequency analyzer + should not be sensitive to capitalization. + + * The output does not come out in any useful order. You're more + likely to be interested in which words occur most frequently or in + having an alphabetized table of how frequently each word occurs. + + The way to solve these problems is to use some of `awk''s more +advanced features. First, we use `tolower' to remove case +distinctions. Next, we use `gsub' to remove punctuation characters. +Finally, we use the system `sort' utility to process the output of the +`awk' script. Here is the new version of the program: + + # wordfreq.awk --- print list of word frequencies + + { + $0 = tolower($0) # remove case distinctions + # remove punctuation + gsub(/[^[:alnum:]_[:blank:]]/, "", $0) + for (i = 1; i <= NF; i++) + freq[$i]++ + } + + END { + for (word in freq) + printf "%s\t%d\n", word, freq[word] + } + + Assuming we have saved this program in a file named `wordfreq.awk', +and that the data is in `file1', the following pipeline: + + awk -f wordfreq.awk file1 | sort -k 2nr + +produces a table of the words appearing in `file1' in order of +decreasing frequency. The `awk' program suitably massages the data and +produces a word frequency table, which is not ordered. + + The `awk' script's output is then sorted by the `sort' utility and +printed on the terminal. The options given to `sort' specify a sort +that uses the second field of each input line (skipping one field), +that the sort keys should be treated as numeric quantities (otherwise +`15' would come before `5'), and that the sorting should be done in +descending (reverse) order. + + The `sort' could even be done from within the program, by changing +the `END' action to: + + END { + sort = "sort -k 2nr" + for (word in freq) + printf "%s\t%d\n", word, freq[word] | sort + close(sort) + } + + This way of sorting must be used on systems that do not have true +pipes at the command-line (or batch-file) level. See the general +operating system documentation for more information on how to use the +`sort' program. + + +File: gawk.info, Node: History Sorting, Next: Extract Program, Prev: Word Sorting, Up: Miscellaneous Programs + +13.3.6 Removing Duplicates from Unsorted Text +--------------------------------------------- + +The `uniq' program (*note Uniq Program::), removes duplicate lines from +_sorted_ data. + + Suppose, however, you need to remove duplicate lines from a data +file but that you want to preserve the order the lines are in. A good +example of this might be a shell history file. The history file keeps +a copy of all the commands you have entered, and it is not unusual to +repeat a command several times in a row. Occasionally you might want +to compact the history by removing duplicate entries. Yet it is +desirable to maintain the order of the original commands. + + This simple program does the job. It uses two arrays. The `data' +array is indexed by the text of each line. For each line, `data[$0]' +is incremented. If a particular line has not been seen before, then +`data[$0]' is zero. In this case, the text of the line is stored in +`lines[count]'. Each element of `lines' is a unique command, and the +indices of `lines' indicate the order in which those lines are +encountered. The `END' rule simply prints out the lines, in order: + + # histsort.awk --- compact a shell history file + # Thanks to Byron Rakitzis for the general idea + { + if (data[$0]++ == 0) + lines[++count] = $0 + } + + END { + for (i = 1; i <= count; i++) + print lines[i] + } + + This program also provides a foundation for generating other useful +information. For example, using the following `print' statement in the +`END' rule indicates how often a particular command is used: + + print data[lines[i]], lines[i] + + This works because `data[$0]' is incremented each time a line is +seen. + + +File: gawk.info, Node: Extract Program, Next: Simple Sed, Prev: History Sorting, Up: Miscellaneous Programs + +13.3.7 Extracting Programs from Texinfo Source Files +---------------------------------------------------- + +The nodes *note Library Functions::, and *note Sample Programs::, are +the top level nodes for a large number of `awk' programs. If you want +to experiment with these programs, it is tedious to have to type them +in by hand. Here we present a program that can extract parts of a +Texinfo input file into separate files. + +This Info file is written in Texinfo, the GNU project's document +formatting language. A single Texinfo source file can be used to +produce both printed and online documentation. The Texinfo language is +described fully, starting with *note Top::. + + For our purposes, it is enough to know three things about Texinfo +input files: + + * The "at" symbol (`@') is special in Texinfo, much as the backslash + (`\') is in C or `awk'. Literal `@' symbols are represented in + Texinfo source files as `@@'. + + * Comments start with either `@c' or `@comment'. The + file-extraction program works by using special comments that start + at the beginning of a line. + + * Lines containing `@group' and `@end group' commands bracket + example text that should not be split across a page boundary. + (Unfortunately, TeX isn't always smart enough to do things exactly + right, and we have to give it some help.) + + The following program, `extract.awk', reads through a Texinfo source +file and does two things, based on the special comments. Upon seeing +`@c system ...', it runs a command, by extracting the command text from +the control line and passing it on to the `system' function (*note I/O +Functions::). Upon seeing `@c file FILENAME', each subsequent line is +sent to the file FILENAME, until `@c endfile' is encountered. The +rules in `extract.awk' match either `@c' or `@comment' by letting the +`omment' part be optional. Lines containing `@group' and `@end group' +are simply removed. `extract.awk' uses the `join' library function +(*note Join Function::). + + The example programs in the online Texinfo source for `GAWK: +Effective AWK Programming' (`gawk.texi') have all been bracketed inside +`file' and `endfile' lines. The `gawk' distribution uses a copy of +`extract.awk' to extract the sample programs and install many of them +in a standard directory where `gawk' can find them. The Texinfo file +looks something like this: + + ... + This program has a @code{BEGIN} rule, + that prints a nice message: + + @example + @c file examples/messages.awk + BEGIN @{ print "Don't panic!" @} + @c end file + @end example + + It also prints some final advice: + + @example + @c file examples/messages.awk + END @{ print "Always avoid bored archeologists!" @} + @c end file + @end example + ... + + `extract.awk' begins by setting `IGNORECASE' to one, so that mixed +upper- and lowercase letters in the directives won't matter. + + The first rule handles calling `system', checking that a command is +given (`NF' is at least three) and also checking that the command exits +with a zero exit status, signifying OK: + + # extract.awk --- extract files and run programs + # from texinfo files + BEGIN { IGNORECASE = 1 } + + /^@c(omment)?[ \t]+system/ \ + { + if (NF < 3) { + e = (FILENAME ":" FNR) + e = (e ": badly formed `system' line") + print e > "/dev/stderr" + next + } + $1 = "" + $2 = "" + stat = system($0) + if (stat != 0) { + e = (FILENAME ":" FNR) + e = (e ": warning: system returned " stat) + print e > "/dev/stderr" + } + } + +The variable `e' is used so that the function fits nicely on the screen. + + The second rule handles moving data into files. It verifies that a +file name is given in the directive. If the file named is not the +current file, then the current file is closed. Keeping the current file +open until a new file is encountered allows the use of the `>' +redirection for printing the contents, keeping open file management +simple. + + The `for' loop does the work. It reads lines using `getline' (*note +Getline::). For an unexpected end of file, it calls the +`unexpected_eof' function. If the line is an "endfile" line, then it +breaks out of the loop. If the line is an `@group' or `@end group' +line, then it ignores it and goes on to the next line. Similarly, +comments within examples are also ignored. + + Most of the work is in the following few lines. If the line has no +`@' symbols, the program can print it directly. Otherwise, each +leading `@' must be stripped off. To remove the `@' symbols, the line +is split into separate elements of the array `a', using the `split' +function (*note String Functions::). The `@' symbol is used as the +separator character. Each element of `a' that is empty indicates two +successive `@' symbols in the original line. For each two empty +elements (`@@' in the original file), we have to add a single `@' +symbol back in. + + When the processing of the array is finished, `join' is called with +the value of `SUBSEP', to rejoin the pieces back into a single line. +That line is then printed to the output file: + + /^@c(omment)?[ \t]+file/ \ + { + if (NF != 3) { + e = (FILENAME ":" FNR ": badly formed `file' line") + print e > "/dev/stderr" + next + } + if ($3 != curfile) { + if (curfile != "") + close(curfile) + curfile = $3 + } + + for (;;) { + if ((getline line) <= 0) + unexpected_eof() + if (line ~ /^@c(omment)?[ \t]+endfile/) + break + else if (line ~ /^@(end[ \t]+)?group/) + continue + else if (line ~ /^@c(omment+)?[ \t]+/) + continue + if (index(line, "@") == 0) { + print line > curfile + continue + } + n = split(line, a, "@") + # if a[1] == "", means leading @, + # don't add one back in. + for (i = 2; i <= n; i++) { + if (a[i] == "") { # was an @@ + a[i] = "@" + if (a[i+1] == "") + i++ + } + } + print join(a, 1, n, SUBSEP) > curfile + } + } + + An important thing to note is the use of the `>' redirection. +Output done with `>' only opens the file once; it stays open and +subsequent output is appended to the file (*note Redirection::). This +makes it easy to mix program text and explanatory prose for the same +sample source file (as has been done here!) without any hassle. The +file is only closed when a new data file name is encountered or at the +end of the input file. + + Finally, the function `unexpected_eof' prints an appropriate error +message and then exits. The `END' rule handles the final cleanup, +closing the open file: + + function unexpected_eof() { + printf("%s:%d: unexpected EOF or error\n", + FILENAME, FNR) > "/dev/stderr" + exit 1 + } + + END { + if (curfile) + close(curfile) + } + + +File: gawk.info, Node: Simple Sed, Next: Igawk Program, Prev: Extract Program, Up: Miscellaneous Programs + +13.3.8 A Simple Stream Editor +----------------------------- + +The `sed' utility is a stream editor, a program that reads a stream of +data, makes changes to it, and passes it on. It is often used to make +global changes to a large file or to a stream of data generated by a +pipeline of commands. While `sed' is a complicated program in its own +right, its most common use is to perform global substitutions in the +middle of a pipeline: + + command1 < orig.data | sed 's/old/new/g' | command2 > result + + Here, `s/old/new/g' tells `sed' to look for the regexp `old' on each +input line and globally replace it with the text `new', i.e., all the +occurrences on a line. This is similar to `awk''s `gsub' function +(*note String Functions::). + + The following program, `awksed.awk', accepts at least two +command-line arguments: the pattern to look for and the text to replace +it with. Any additional arguments are treated as data file names to +process. If none are provided, the standard input is used: + + # awksed.awk --- do s/foo/bar/g using just print + # Thanks to Michael Brennan for the idea + function usage() + { + print "usage: awksed pat repl [files...]" > "/dev/stderr" + exit 1 + } + + BEGIN { + # validate arguments + if (ARGC < 3) + usage() + + RS = ARGV[1] + ORS = ARGV[2] + + # don't use arguments as files + ARGV[1] = ARGV[2] = "" + } + + # look ma, no hands! + { + if (RT == "") + printf "%s", $0 + else + print + } + + The program relies on `gawk''s ability to have `RS' be a regexp, as +well as on the setting of `RT' to the actual text that terminates the +record (*note Records::). + + The idea is to have `RS' be the pattern to look for. `gawk' +automatically sets `$0' to the text between matches of the pattern. +This is text that we want to keep, unmodified. Then, by setting `ORS' +to the replacement text, a simple `print' statement outputs the text we +want to keep, followed by the replacement text. + + There is one wrinkle to this scheme, which is what to do if the last +record doesn't end with text that matches `RS'. Using a `print' +statement unconditionally prints the replacement text, which is not +correct. However, if the file did not end in text that matches `RS', +`RT' is set to the null string. In this case, we can print `$0' using +`printf' (*note Printf::). + + The `BEGIN' rule handles the setup, checking for the right number of +arguments and calling `usage' if there is a problem. Then it sets `RS' +and `ORS' from the command-line arguments and sets `ARGV[1]' and +`ARGV[2]' to the null string, so that they are not treated as file names +(*note ARGC and ARGV::). + + The `usage' function prints an error message and exits. Finally, +the single rule handles the printing scheme outlined above, using +`print' or `printf' as appropriate, depending upon the value of `RT'. + + +File: gawk.info, Node: Igawk Program, Prev: Simple Sed, Up: Miscellaneous Programs + +13.3.9 An Easy Way to Use Library Functions +------------------------------------------- + +Using library functions in `awk' can be very beneficial. It encourages +code reuse and the writing of general functions. Programs are smaller +and therefore clearer. However, using library functions is only easy +when writing `awk' programs; it is painful when running them, requiring +multiple `-f' options. If `gawk' is unavailable, then so too is the +`AWKPATH' environment variable and the ability to put `awk' functions +into a library directory (*note Options::). It would be nice to be +able to write programs in the following manner: + + # library functions + @include getopt.awk + @include join.awk + ... + + # main program + BEGIN { + while ((c = getopt(ARGC, ARGV, "a:b:cde")) != -1) + ... + ... + } + + The following program, `igawk.sh', provides this service. It +simulates `gawk''s searching of the `AWKPATH' variable and also allows +"nested" includes; i.e., a file that is included with `@include' can +contain further `@include' statements. `igawk' makes an effort to only +include files once, so that nested includes don't accidentally include +a library function twice. + + `igawk' should behave just like `gawk' externally. This means it +should accept all of `gawk''s command-line arguments, including the +ability to have multiple source files specified via `-f', and the +ability to mix command-line and library source files. + + The program is written using the POSIX Shell (`sh') command +language.(1) It works as follows: + + 1. Loop through the arguments, saving anything that doesn't represent + `awk' source code for later, when the expanded program is run. + + 2. For any arguments that do represent `awk' text, put the arguments + into a shell variable that will be expanded. There are two cases: + + a. Literal text, provided with `--source' or `--source='. This + text is just appended directly. + + b. Source file names, provided with `-f'. We use a neat trick + and append `@include FILENAME' to the shell variable's + contents. Since the file-inclusion program works the way + `gawk' does, this gets the text of the file included into the + program at the correct point. + + 3. Run an `awk' program (naturally) over the shell variable's + contents to expand `@include' statements. The expanded program is + placed in a second shell variable. + + 4. Run the expanded program with `gawk' and any other original + command-line arguments that the user supplied (such as the data + file names). + + This program uses shell variables extensively; for storing command +line arguments, the text of the `awk' program that will expand the +user's program, for the user's original program, and for the expanded +program. Doing so removes some potential problems that might arise +were we to use temporary files instead, at the cost of making the +script somewhat more complicated. + + The initial part of the program turns on shell tracing if the first +argument is `debug'. + + The next part loops through all the command-line arguments. There +are several cases of interest: + +`--' + This ends the arguments to `igawk'. Anything else should be + passed on to the user's `awk' program without being evaluated. + +`-W' + This indicates that the next option is specific to `gawk'. To make + argument processing easier, the `-W' is appended to the front of + the remaining arguments and the loop continues. (This is an `sh' + programming trick. Don't worry about it if you are not familiar + with `sh'.) + +`-v, -F' + These are saved and passed on to `gawk'. + +`-f, --file, --file=, -Wfile=' + The file name is appended to the shell variable `program' with an + `@include' statement. The `expr' utility is used to remove the + leading option part of the argument (e.g., `--file='). (Typical + `sh' usage would be to use the `echo' and `sed' utilities to do + this work. Unfortunately, some versions of `echo' evaluate escape + sequences in their arguments, possibly mangling the program text. + Using `expr' avoids this problem.) + +`--source, --source=, -Wsource=' + The source text is appended to `program'. + +`--version, -Wversion' + `igawk' prints its version number, runs `gawk --version' to get + the `gawk' version information, and then exits. + + If none of the `-f', `--file', `-Wfile', `--source', or `-Wsource' +arguments are supplied, then the first nonoption argument should be the +`awk' program. If there are no command-line arguments left, `igawk' +prints an error message and exits. Otherwise, the first argument is +appended to `program'. In any case, after the arguments have been +processed, `program' contains the complete text of the original `awk' +program. + + The program is as follows: + + #! /bin/sh + # igawk --- like gawk but do @include processing + if [ "$1" = debug ] + then + set -x + shift + fi + + # A literal newline, so that program text is formatted correctly + n=' + ' + + # Initialize variables to empty + program= + opts= + + while [ $# -ne 0 ] # loop over arguments + do + case $1 in + --) shift; break;; + + -W) shift + # The ${x?'message here'} construct prints a + # diagnostic if $x is the null string + set -- -W"${@?'missing operand'}" + continue;; + + -[vF]) opts="$opts $1 '${2?'missing operand'}'" + shift;; + + -[vF]*) opts="$opts '$1'" ;; + + -f) program="$program$n@include ${2?'missing operand'}" + shift;; + + -f*) f=`expr "$1" : '-f\(.*\)'` + program="$program$n@include $f";; + + -[W-]file=*) + f=`expr "$1" : '-.file=\(.*\)'` + program="$program$n@include $f";; + + -[W-]file) + program="$program$n@include ${2?'missing operand'}" + shift;; + + -[W-]source=*) + t=`expr "$1" : '-.source=\(.*\)'` + program="$program$n$t";; + + -[W-]source) + program="$program$n${2?'missing operand'}" + shift;; + + -[W-]version) + echo igawk: version 2.0 1>&2 + gawk --version + exit 0 ;; + + -[W-]*) opts="$opts '$1'" ;; + + *) break;; + esac + shift + done + + if [ -z "$program" ] + then + program=${1?'missing program'} + shift + fi + + # At this point, `program' has the program. + + The `awk' program to process `@include' directives is stored in the +shell variable `expand_prog'. Doing this keeps the shell script +readable. The `awk' program reads through the user's program, one line +at a time, using `getline' (*note Getline::). The input file names and +`@include' statements are managed using a stack. As each `@include' is +encountered, the current file name is "pushed" onto the stack and the +file named in the `@include' directive becomes the current file name. +As each file is finished, the stack is "popped," and the previous input +file becomes the current input file again. The process is started by +making the original file the first one on the stack. + + The `pathto' function does the work of finding the full path to a +file. It simulates `gawk''s behavior when searching the `AWKPATH' +environment variable (*note AWKPATH Variable::). If a file name has a +`/' in it, no path search is done. Otherwise, the file name is +concatenated with the name of each directory in the path, and an +attempt is made to open the generated file name. The only way to test +if a file can be read in `awk' is to go ahead and try to read it with +`getline'; this is what `pathto' does.(2) If the file can be read, it +is closed and the file name is returned: + + expand_prog=' + + function pathto(file, i, t, junk) + { + if (index(file, "/") != 0) + return file + + for (i = 1; i <= ndirs; i++) { + t = (pathlist[i] "/" file) + if ((getline junk < t) > 0) { + # found it + close(t) + return t + } + } + return "" + } + + The main program is contained inside one `BEGIN' rule. The first +thing it does is set up the `pathlist' array that `pathto' uses. After +splitting the path on `:', null elements are replaced with `"."', which +represents the current directory: + + BEGIN { + path = ENVIRON["AWKPATH"] + ndirs = split(path, pathlist, ":") + for (i = 1; i <= ndirs; i++) { + if (pathlist[i] == "") + pathlist[i] = "." + } + + The stack is initialized with `ARGV[1]', which will be `/dev/stdin'. +The main loop comes next. Input lines are read in succession. Lines +that do not start with `@include' are printed verbatim. If the line +does start with `@include', the file name is in `$2'. `pathto' is +called to generate the full path. If it cannot, then we print an error +message and continue. + + The next thing to check is if the file is included already. The +`processed' array is indexed by the full file name of each included +file and it tracks this information for us. If the file is seen again, +a warning message is printed. Otherwise, the new file name is pushed +onto the stack and processing continues. + + Finally, when `getline' encounters the end of the input file, the +file is closed and the stack is popped. When `stackptr' is less than +zero, the program is done: + + stackptr = 0 + input[stackptr] = ARGV[1] # ARGV[1] is first file + + for (; stackptr >= 0; stackptr--) { + while ((getline < input[stackptr]) > 0) { + if (tolower($1) != "@include") { + print + continue + } + fpath = pathto($2) + if (fpath == "") { + printf("igawk:%s:%d: cannot find %s\n", + input[stackptr], FNR, $2) > "/dev/stderr" + continue + } + if (! (fpath in processed)) { + processed[fpath] = input[stackptr] + input[++stackptr] = fpath # push onto stack + } else + print $2, "included in", input[stackptr], + "already included in", + processed[fpath] > "/dev/stderr" + } + close(input[stackptr]) + } + }' # close quote ends `expand_prog' variable + + processed_program=`gawk -- "$expand_prog" /dev/stdin <<EOF + $program + EOF + ` + + The shell construct `COMMAND << MARKER' is called a "here document". +Everything in the shell script up to the MARKER is fed to COMMAND as +input. The shell processes the contents of the here document for +variable and command substitution (and possibly other things as well, +depending upon the shell). + + The shell construct ``...`' is called "command substitution". The +output of the command between the two backquotes (grave accents) is +substituted into the command line. It is saved as a single string, +even if the results contain whitespace. + + The expanded program is saved in the variable `processed_program'. +It's done in these steps: + + 1. Run `gawk' with the `@include'-processing program (the value of + the `expand_prog' shell variable) on standard input. + + 2. Standard input is the contents of the user's program, from the + shell variable `program'. Its contents are fed to `gawk' via a + here document. + + 3. The results of this processing are saved in the shell variable + `processed_program' by using command substitution. + + The last step is to call `gawk' with the expanded program, along +with the original options and command-line arguments that the user +supplied. + + eval gawk $opts -- '"$processed_program"' '"$@"' + + The `eval' command is a shell construct that reruns the shell's +parsing process. This keeps things properly quoted. + + This version of `igawk' represents my fourth attempt at this program. +There are four key simplifications that make the program work better: + + * Using `@include' even for the files named with `-f' makes building + the initial collected `awk' program much simpler; all the + `@include' processing can be done once. + + * Not trying to save the line read with `getline' in the `pathto' + function when testing for the file's accessibility for use with + the main program simplifies things considerably. + + * Using a `getline' loop in the `BEGIN' rule does it all in one + place. It is not necessary to call out to a separate loop for + processing nested `@include' statements. + + * Instead of saving the expanded program in a temporary file, + putting it in a shell variable avoids some potential security + problems. This has the disadvantage that the script relies upon + more features of the `sh' language, making it harder to follow for + those who aren't familiar with `sh'. + + Also, this program illustrates that it is often worthwhile to combine +`sh' and `awk' programming together. You can usually accomplish quite +a lot, without having to resort to low-level programming in C or C++, +and it is frequently easier to do certain kinds of string and argument +manipulation using the shell than it is in `awk'. + + Finally, `igawk' shows that it is not always necessary to add new +features to a program; they can often be layered on top. With `igawk', +there is no real reason to build `@include' processing into `gawk' +itself. + + As an additional example of this, consider the idea of having two +files in a directory in the search path: + +`default.awk' + This file contains a set of default library functions, such as + `getopt' and `assert'. + +`site.awk' + This file contains library functions that are specific to a site or + installation; i.e., locally developed functions. Having a + separate file allows `default.awk' to change with new `gawk' + releases, without requiring the system administrator to update it + each time by adding the local functions. + + One user suggested that `gawk' be modified to automatically read +these files upon startup. Instead, it would be very simple to modify +`igawk' to do this. Since `igawk' can process nested `@include' +directives, `default.awk' could simply contain `@include' statements +for the desired library functions. + + ---------- Footnotes ---------- + + (1) Fully explaining the `sh' language is beyond the scope of this +book. We provide some minimal explanations, but see a good shell +programming book if you wish to understand things in more depth. + + (2) On some very old versions of `awk', the test `getline junk < t' +can loop forever if the file exists but is empty. Caveat emptor. + + +File: gawk.info, Node: Language History, Next: Installation, Prev: Sample Programs, Up: Top + +Appendix A The Evolution of the `awk' Language +********************************************** + +This Info file describes the GNU implementation of `awk', which follows +the POSIX specification. Many long-time `awk' users learned `awk' +programming with the original `awk' implementation in Version 7 Unix. +(This implementation was the basis for `awk' in Berkeley Unix, through +4.3-Reno. Subsequent versions of Berkeley Unix, and systems derived +from 4.4BSD-Lite, use various versions of `gawk' for their `awk'.) +This major node briefly describes the evolution of the `awk' language, +with cross-references to other parts of the Info file where you can +find more information. + +* Menu: + +* V7/SVR3.1:: The major changes between V7 and System V + Release 3.1. +* SVR4:: Minor changes between System V Releases 3.1 + and 4. +* POSIX:: New features from the POSIX standard. +* BTL:: New features from the Bell Laboratories + version of `awk'. +* POSIX/GNU:: The extensions in `gawk' not in POSIX + `awk'. +* Contributors:: The major contributors to `gawk'. + + +File: gawk.info, Node: V7/SVR3.1, Next: SVR4, Up: Language History + +A.1 Major Changes Between V7 and SVR3.1 +======================================= + +The `awk' language evolved considerably between the release of Version +7 Unix (1978) and the new version that was first made generally +available in System V Release 3.1 (1987). This minor node summarizes +the changes, with cross-references to further details: + + * The requirement for `;' to separate rules on a line (*note + Statements/Lines::). + + * User-defined functions and the `return' statement (*note + User-defined::). + + * The `delete' statement (*note Delete::). + + * The `do'-`while' statement (*note Do Statement::). + + * The built-in functions `atan2', `cos', `sin', `rand', and `srand' + (*note Numeric Functions::). + + * The built-in functions `gsub', `sub', and `match' (*note String + Functions::). + + * The built-in functions `close' and `system' (*note I/O + Functions::). + + * The `ARGC', `ARGV', `FNR', `RLENGTH', `RSTART', and `SUBSEP' + built-in variables (*note Built-in Variables::). + + * Assignable `$0'. + + * The conditional expression using the ternary operator `?:' (*note + Conditional Exp::). + + * The expression `INDEX in ARRAY' outside of `for' statements (*note + Reference to Elements::). + + * The exponentiation operator `^' (*note Arithmetic Ops::) and its + assignment operator form `^=' (*note Assignment Ops::). + + * C-compatible operator precedence, which breaks some old `awk' + programs (*note Precedence::). + + * Regexps as the value of `FS' (*note Field Separators::) and as the + third argument to the `split' function (*note String Functions::), + rather than using only the first character of `FS'. + + * Dynamic regexps as operands of the `~' and `!~' operators (*note + Regexp Usage::). + + * The escape sequences `\b', `\f', and `\r' (*note Escape + Sequences::). (Some vendors have updated their old versions of + `awk' to recognize `\b', `\f', and `\r', but this is not something + you can rely on.) + + * Redirection of input for the `getline' function (*note Getline::). + + * Multiple `BEGIN' and `END' rules (*note BEGIN/END::). + + * Multidimensional arrays (*note Multi-dimensional::). + + +File: gawk.info, Node: SVR4, Next: POSIX, Prev: V7/SVR3.1, Up: Language History + +A.2 Changes Between SVR3.1 and SVR4 +=================================== + +The System V Release 4 (1989) version of Unix `awk' added these features +(some of which originated in `gawk'): + + * The `ENVIRON' variable (*note Built-in Variables::). + + * Multiple `-f' options on the command line (*note Options::). + + * The `-v' option for assigning variables before program execution + begins (*note Options::). + + * The `--' option for terminating command-line options. + + * The `\a', `\v', and `\x' escape sequences (*note Escape + Sequences::). + + * A defined return value for the `srand' built-in function (*note + Numeric Functions::). + + * The `toupper' and `tolower' built-in string functions for case + translation (*note String Functions::). + + * A cleaner specification for the `%c' format-control letter in the + `printf' function (*note Control Letters::). + + * The ability to dynamically pass the field width and precision + (`"%*.*d"') in the argument list of the `printf' function (*note + Control Letters::). + + * The use of regexp constants, such as `/foo/', as expressions, where + they are equivalent to using the matching operator, as in `$0 ~ + /foo/' (*note Using Constant Regexps::). + + * Processing of escape sequences inside command-line variable + assignments (*note Assignment Options::). + + +File: gawk.info, Node: POSIX, Next: BTL, Prev: SVR4, Up: Language History + +A.3 Changes Between SVR4 and POSIX `awk' +======================================== + +The POSIX Command Language and Utilities standard for `awk' (1992) +introduced the following changes into the language: + + * The use of `-W' for implementation-specific options (*note + Options::). + + * The use of `CONVFMT' for controlling the conversion of numbers to + strings (*note Conversion::). + + * The concept of a numeric string and tighter comparison rules to go + with it (*note Typing and Comparison::). + + * More complete documentation of many of the previously undocumented + features of the language. + + The following common extensions are not permitted by the POSIX +standard: + + * `\x' escape sequences are not recognized (*note Escape + Sequences::). + + * Newlines do not act as whitespace to separate fields when `FS' is + equal to a single space (*note Fields::). + + * Newlines are not allowed after `?' or `:' (*note Conditional + Exp::). + + * The synonym `func' for the keyword `function' is not recognized + (*note Definition Syntax::). + + * The operators `**' and `**=' cannot be used in place of `^' and + `^=' (*note Arithmetic Ops::, and *note Assignment Ops::). + + * Specifying `-Ft' on the command line does not set the value of + `FS' to be a single TAB character (*note Field Separators::). + + * The locale's decimal point character is used for parsing input + data (*note Locales::). + + * The `fflush' built-in function is not supported (*note I/O + Functions::). + + +File: gawk.info, Node: BTL, Next: POSIX/GNU, Prev: POSIX, Up: Language History + +A.4 Extensions in the Bell Laboratories `awk' +============================================= + +Brian Kernighan, one of the original designers of Unix `awk', has made +his version available via his home page (*note Other Versions::). This +minor node describes extensions in his version of `awk' that are not in +POSIX `awk': + + * The `-mf N' and `-mr N' command-line options to set the maximum + number of fields and the maximum record size, respectively (*note + Options::). As a side note, his `awk' no longer needs these + options; it continues to accept them to avoid breaking old + programs. + + * The `fflush' built-in function for flushing buffered output (*note + I/O Functions::). + + * The `**' and `**=' operators (*note Arithmetic Ops:: and *note + Assignment Ops::). + + * The use of `func' as an abbreviation for `function' (*note + Definition Syntax::). + + + The Bell Laboratories `awk' also incorporates the following +extensions, originally developed for `gawk': + + * The `\x' escape sequence (*note Escape Sequences::). + + * The `/dev/stdin', `/dev/stdout', and `/dev/stderr' special files + (*note Special Files::). + + * The ability for `FS' and for the third argument to `split' to be + null strings (*note Single Character Fields::). + + * The `nextfile' statement (*note Nextfile Statement::). + + * The ability to delete all of an array at once with `delete ARRAY' + (*note Delete::). + + +File: gawk.info, Node: POSIX/GNU, Next: Contributors, Prev: BTL, Up: Language History + +A.5 Extensions in `gawk' Not in POSIX `awk' +=========================================== + +The GNU implementation, `gawk', adds a large number of features. This +minor node lists them in the order they were added to `gawk'. They can +all be disabled with either the `--traditional' or `--posix' options +(*note Options::). + + Version 2.10 of `gawk' introduced the following features: + + * The `AWKPATH' environment variable for specifying a path search for + the `-f' command-line option (*note Options::). + + * The `IGNORECASE' variable and its effects (*note + Case-sensitivity::). + + * The `/dev/stdin', `/dev/stdout', `/dev/stderr' and `/dev/fd/N' + special file names (*note Special Files::). + + Version 2.13 of `gawk' introduced the following features: + + * The `FIELDWIDTHS' variable and its effects (*note Constant Size::). + + * The `systime' and `strftime' built-in functions for obtaining and + printing timestamps (*note Time Functions::). + + * The `-W lint' option to provide error and portability checking for + both the source code and at runtime (*note Options::). + + * The `-W compat' option to turn off the GNU extensions (*note + Options::). + + * The `-W posix' option for full POSIX compliance (*note Options::). + + Version 2.14 of `gawk' introduced the following feature: + + * The `next file' statement for skipping to the next data file + (*note Nextfile Statement::). + + Version 2.15 of `gawk' introduced the following features: + + * The `ARGIND' variable, which tracks the movement of `FILENAME' + through `ARGV' (*note Built-in Variables::). + + * The `ERRNO' variable, which contains the system error message when + `getline' returns -1 or `close' fails (*note Built-in Variables::). + + * The `/dev/pid', `/dev/ppid', `/dev/pgrpid', and `/dev/user' file + name interpretation (*note Special Files::). + + * The ability to delete all of an array at once with `delete ARRAY' + (*note Delete::). + + * The ability to use GNU-style long-named options that start with + `--' (*note Options::). + + * The `--source' option for mixing command-line and library-file + source code (*note Options::). + + Version 3.0 of `gawk' introduced the following features: + + * `IGNORECASE' changed, now applying to string comparison as well as + regexp operations (*note Case-sensitivity::). + + * The `RT' variable that contains the input text that matched `RS' + (*note Records::). + + * Full support for both POSIX and GNU regexps (*note Regexp::). + + * The `gensub' function for more powerful text manipulation (*note + String Functions::). + + * The `strftime' function acquired a default time format, allowing + it to be called with no arguments (*note Time Functions::). + + * The ability for `FS' and for the third argument to `split' to be + null strings (*note Single Character Fields::). + + * The ability for `RS' to be a regexp (*note Records::). + + * The `next file' statement became `nextfile' (*note Nextfile + Statement::). + + * The `--lint-old' option to warn about constructs that are not + available in the original Version 7 Unix version of `awk' (*note + V7/SVR3.1::). + + * The `-m' option and the `fflush' function from the Bell + Laboratories research version of `awk' (*note Options::; also + *note I/O Functions::). + + * The `--re-interval' option to provide interval expressions in + regexps (*note Regexp Operators::). + + * The `--traditional' option was added as a better name for + `--compat' (*note Options::). + + * The use of GNU Autoconf to control the configuration process + (*note Quick Installation::). + + * Amiga support (*note Amiga Installation::). + + + Version 3.1 of `gawk' introduced the following features: + + * The `BINMODE' special variable for non-POSIX systems, which allows + binary I/O for input and/or output files (*note PC Using::). + + * The `LINT' special variable, which dynamically controls lint + warnings (*note Built-in Variables::). + + * The `PROCINFO' array for providing process-related information + (*note Built-in Variables::). + + * The `TEXTDOMAIN' special variable for setting an application's + internationalization text domain (*note Built-in Variables::, and + *note Internationalization::). + + * The ability to use octal and hexadecimal constants in `awk' + program source code (*note Nondecimal-numbers::). + + * The `|&' operator for two-way I/O to a coprocess (*note Two-way + I/O::). + + * The `/inet' special files for TCP/IP networking using `|&' (*note + TCP/IP Networking::). + + * The optional second argument to `close' that allows closing one end + of a two-way pipe to a coprocess (*note Two-way I/O::). + + * The optional third argument to the `match' function for capturing + text-matching subexpressions within a regexp (*note String + Functions::). + + * Positional specifiers in `printf' formats for making translations + easier (*note Printf Ordering::). + + * The `asort' and `asorti' functions for sorting arrays (*note Array + Sorting::). + + * The `bindtextdomain', `dcgettext' and `dcngettext' functions for + internationalization (*note Programmer i18n::). + + * The `extension' built-in function and the ability to add new + built-in functions dynamically (*note Dynamic Extensions::). + + * The `mktime' built-in function for creating timestamps (*note Time + Functions::). + + * The `and', `or', `xor', `compl', `lshift', `rshift', and + `strtonum' built-in functions (*note Bitwise Functions::). + + * The support for `next file' as two words was removed completely + (*note Nextfile Statement::). + + * The `--dump-variables' option to print a list of all global + variables (*note Options::). + + * The `--gen-po' command-line option and the use of a leading + underscore to mark strings that should be translated (*note String + Extraction::). + + * The `--non-decimal-data' option to allow non-decimal input data + (*note Nondecimal Data::). + + * The `--profile' option and `pgawk', the profiling version of + `gawk', for producing execution profiles of `awk' programs (*note + Profiling::). + + * The `--use-lc-numeric' option to force `gawk' to use the locale's + decimal point for parsing input data (*note Conversion::). + + * The `--enable-portals' configuration option to enable special + treatment of pathnames that begin with `/p' as BSD portals (*note + Portal Files::). + + * The `--disable-directories-fatal' configuration option which + causes `gawk' to silently skip directories named on the command + line (*note Additional Configuration Options::). + + * The use of GNU Automake to help in standardizing the configuration + process (*note Quick Installation::). + + * The use of GNU `gettext' for `gawk''s own message output (*note + Gawk I18N::). + + * BeOS support (*note BeOS Installation::). + + * Tandem support (*note Tandem Installation::). + + * The Atari port became officially unsupported (*note Atari + Installation::). + + * The source code now uses new-style function definitions, with + `ansi2knr' to convert the code on systems with old compilers. + + * The `--disable-lint' configuration option to disable lint checking + at compile time (*note Additional Configuration Options::). + + * POSIX compliance for `sub' and `gsub' (*note Gory Details::). + + * The `--exec' option, for use in CGI scripts (*note Options::). + + * The `length' function was extended to accept an array argument and + return the number of elements in the array (*note String + Functions::). + + * The `strftime' function acquired a third argument to enable + printing times as UTC (*note Time Functions::). + + + +File: gawk.info, Node: Contributors, Prev: POSIX/GNU, Up: Language History + +A.6 Major Contributors to `gawk' +================================ + + Always give credit where credit is due. + Anonymous + + This minor node names the major contributors to `gawk' and/or this +Info file, in approximate chronological order: + + * Dr. Alfred V. Aho, Dr. Peter J. Weinberger, and Dr. Brian W. + Kernighan, all of Bell Laboratories, designed and implemented Unix + `awk', from which `gawk' gets the majority of its feature set. + + * Paul Rubin did the initial design and implementation in 1986, and + wrote the first draft (around 40 pages) of this Info file. + + * Jay Fenlason finished the initial implementation. + + * Diane Close revised the first draft of this Info file, bringing it + to around 90 pages. + + * Richard Stallman helped finish the implementation and the initial + draft of this Info file. He is also the founder of the FSF and + the GNU project. + + * John Woods contributed parts of the code (mostly fixes) in the + initial version of `gawk'. + + * In 1988, David Trueman took over primary maintenance of `gawk', + making it compatible with "new" `awk', and greatly improving its + performance. + + * Pat Rankin provided the VMS port and its documentation. + + * Conrad Kwok, Scott Garfinkle, and Kent Williams did the initial + ports to MS-DOS with various versions of MSC. + + * Hal Peterson provided help in porting `gawk' to Cray systems. + + * Kai Uwe Rommel provided the initial port to OS/2 and its + documentation. + + * Michal Jaegermann provided the port to Atari systems and its + documentation. He continues to provide portability checking with + DEC Alpha systems, and has done a lot of work to make sure `gawk' + works on non-32-bit systems. + + * Fred Fish provided the port to Amiga systems and its documentation. + + * Scott Deifik currently maintains the MS-DOS port. + + * Juan Grigera maintains the port to Windows32 systems. + + * Dr. Darrel Hankerson acts as coordinator for the various ports to + different PC platforms and creates binary distributions for + various PC operating systems. He is also instrumental in keeping + the documentation up to date for the various PC platforms. + + * Christos Zoulas provided the `extension' built-in function for + dynamically adding new modules. + + * Ju"rgen Kahrs contributed the initial version of the TCP/IP + networking code and documentation, and motivated the inclusion of + the `|&' operator. + + * Stephen Davies provided the initial port to Tandem systems and its + documentation. Matthew Woehlke provided improvements for Tandem's + POSIX-compliant systems. + + * Martin Brown provided the port to BeOS and its documentation. + + * Arno Peters did the initial work to convert `gawk' to use GNU + Automake and `gettext'. + + * Alan J. Broder provided the initial version of the `asort' function + as well as the code for the new optional third argument to the + `match' function. + + * Andreas Buening updated the `gawk' port for OS/2. + + Isamu Hasegawa, of IBM in Japan, contributed support for multibyte + characters. + + Michael Benzinger contributed the initial code for `switch' + statements. + + Patrick T.J. McPhee contributed the code for dynamic loading in + Windows32 environments. + + * Arnold Robbins has been working on `gawk' since 1988, at first + helping David Trueman, and as the primary maintainer since around + 1994. + + +File: gawk.info, Node: Installation, Next: Notes, Prev: Language History, Up: Top + +Appendix B Installing `gawk' +**************************** + +This appendix provides instructions for installing `gawk' on the +various platforms that are supported by the developers. The primary +developer supports GNU/Linux (and Unix), whereas the other ports are +contributed. *Note Bugs::, for the electronic mail addresses of the +people who did the respective ports. + +* Menu: + +* Gawk Distribution:: What is in the `gawk' distribution. +* Unix Installation:: Installing `gawk' under various + versions of Unix. +* Non-Unix Installation:: Installation on Other Operating Systems. +* Unsupported:: Systems whose ports are no longer supported. +* Bugs:: Reporting Problems and Bugs. +* Other Versions:: Other freely available `awk' + implementations. + + +File: gawk.info, Node: Gawk Distribution, Next: Unix Installation, Up: Installation + +B.1 The `gawk' Distribution +=========================== + +This minor node describes how to get the `gawk' distribution, how to +extract it, and then what is in the various files and subdirectories. + +* Menu: + +* Getting:: How to get the distribution. +* Extracting:: How to extract the distribution. +* Distribution contents:: What is in the distribution. + + +File: gawk.info, Node: Getting, Next: Extracting, Up: Gawk Distribution + +B.1.1 Getting the `gawk' Distribution +------------------------------------- + +There are three ways to get GNU software: + + * Copy it from someone else who already has it. + + * Order `gawk' directly from the Free Software Foundation. Software + distributions are available for Gnu/Linux, Unix, and MS-Windows, + in several CD packages. Their address is: + + Free Software Foundation + 51 Franklin Street, Fifth Floor + Boston, MA 02110-1301 USA + Phone: +1-617-542-5942 + Fax (including Japan): +1-617-542-2652 + Email: <gnu@gnu.org> + URL: `http://www.gnu.org' + + Ordering from the FSF directly contributes to the support of the + foundation and to the production of more free software. + + * Retrieve `gawk' by using anonymous `ftp' to the Internet host + `ftp.gnu.org', in the directory `/gnu/gawk'. + + The GNU software archive is mirrored around the world. The +up-to-date list of mirror sites is available from the main FSF web site +(http://www.gnu.org/order/ftp.html). Try to use one of the mirrors; +they will be less busy, and you can usually find one closer to your +site. + + +File: gawk.info, Node: Extracting, Next: Distribution contents, Prev: Getting, Up: Gawk Distribution + +B.1.2 Extracting the Distribution +--------------------------------- + +`gawk' is distributed as a `tar' file compressed with the GNU Zip +program, `gzip'. + + Once you have the distribution (for example, `gawk-3.1.6.tar.gz'), +use `gzip' to expand the file and then use `tar' to extract it. You +can use the following pipeline to produce the `gawk' distribution: + + # Under System V, add 'o' to the tar options + gzip -d -c gawk-3.1.6.tar.gz | tar -xvpf - + +This creates a directory named `gawk-3.1.6' in the current directory. + + The distribution file name is of the form `gawk-V.R.P.tar.gz'. The +V represents the major version of `gawk', the R represents the current +release of version V, and the P represents a "patch level", meaning +that minor bugs have been fixed in the release. The current patch +level is 6, but when retrieving distributions, you should get the +version with the highest version, release, and patch level. (Note, +however, that patch levels greater than or equal to 80 denote "beta" or +nonproduction software; you might not want to retrieve such a version +unless you don't mind experimenting.) If you are not on a Unix system, +you need to make other arrangements for getting and extracting the +`gawk' distribution. You should consult a local expert. + + +File: gawk.info, Node: Distribution contents, Prev: Extracting, Up: Gawk Distribution + +B.1.3 Contents of the `gawk' Distribution +----------------------------------------- + +The `gawk' distribution has a number of C source files, documentation +files, subdirectories, and files related to the configuration process +(*note Unix Installation::), as well as several subdirectories related +to different non-Unix operating systems: + +Various `.c', `.y', and `.h' files + The actual `gawk' source code. + +`README' +`README_d/README.*' + Descriptive files: `README' for `gawk' under Unix and the rest for + the various hardware and software combinations. + +`INSTALL' + A file providing an overview of the configuration and installation + process. + +`ChangeLog' + A detailed list of source code changes as bugs are fixed or + improvements made. + +`NEWS' + A list of changes to `gawk' since the last release or patch. + +`COPYING' + The GNU General Public License. + +`FUTURES' + A brief list of features and changes being contemplated for future + releases, with some indication of the time frame for the feature, + based on its difficulty. + +`LIMITATIONS' + A list of those factors that limit `gawk''s performance. Most of + these depend on the hardware or operating system software and are + not limits in `gawk' itself. + +`POSIX.STD' + A description of one area in which the POSIX standard for `awk' is + incorrect as well as how `gawk' handles the problem. + +`doc/awkforai.txt' + A short article describing why `gawk' is a good language for AI + (Artificial Intelligence) programming. + +`doc/README.card' +`doc/ad.block' +`doc/awkcard.in' +`doc/cardfonts' +`doc/colors' +`doc/macros' +`doc/no.colors' +`doc/setter.outline' + The `troff' source for a five-color `awk' reference card. A + modern version of `troff' such as GNU `troff' (`groff') is needed + to produce the color version. See the file `README.card' for + instructions if you have an older `troff'. + +`doc/gawk.1' + The `troff' source for a manual page describing `gawk'. This is + distributed for the convenience of Unix users. + +`doc/gawk.texi' + The Texinfo source file for this Info file. It should be + processed with TeX to produce a printed document, and with + `makeinfo' to produce an Info or HTML file. + +`doc/gawk.info' + The generated Info file for this Info file. + +`doc/gawkinet.texi' + The Texinfo source file for *Note Top::. It should be processed + with TeX to produce a printed document and with `makeinfo' to + produce an Info or HTML file. + +`doc/gawkinet.info' + The generated Info file for `TCP/IP Internetworking with `gawk''. + +`doc/igawk.1' + The `troff' source for a manual page describing the `igawk' + program presented in *note Igawk Program::. + +`doc/Makefile.in' + The input file used during the configuration process to generate + the actual `Makefile' for creating the documentation. + +`Makefile.am' +`*/Makefile.am' + Files used by the GNU `automake' software for generating the + `Makefile.in' files used by `autoconf' and `configure'. + +`Makefile.in' +`acconfig.h' +`acinclude.m4' +`aclocal.m4' +`configh.in' +`configure.in' +`configure' +`custom.h' +`missing_d/*' +`m4/*' + These files and subdirectories are used when configuring `gawk' + for various Unix systems. They are explained in *note Unix + Installation::. + +`po/*' + The `po' library contains message translations. + +`awklib/extract.awk' +`awklib/Makefile.am' +`awklib/Makefile.in' +`awklib/eg/*' + The `awklib' directory contains a copy of `extract.awk' (*note + Extract Program::), which can be used to extract the sample + programs from the Texinfo source file for this Info file. It also + contains a `Makefile.in' file, which `configure' uses to generate + a `Makefile'. `Makefile.am' is used by GNU Automake to create + `Makefile.in'. The library functions from *note Library + Functions::, and the `igawk' program from *note Igawk Program::, + are included as ready-to-use files in the `gawk' distribution. + They are installed as part of the installation process. The rest + of the programs in this Info file are available in appropriate + subdirectories of `awklib/eg'. + +`unsupported/atari/*' + Files needed for building `gawk' on an Atari ST (*note Atari + Installation::, for details). + +`unsupported/tandem/*' + Files needed for building `gawk' on a Tandem (*note Tandem + Installation::, for details). + +`posix/*' + Files needed for building `gawk' on POSIX-compliant systems. + +`pc/*' + Files needed for building `gawk' under MS-DOS, MS Windows and OS/2 + (*note PC Installation::, for details). + +`vms/*' + Files needed for building `gawk' under VMS (*note VMS + Installation::, for details). + +`test/*' + A test suite for `gawk'. You can use `make check' from the + top-level `gawk' directory to run your version of `gawk' against + the test suite. If `gawk' successfully passes `make check', then + you can be confident of a successful port. + + +File: gawk.info, Node: Unix Installation, Next: Non-Unix Installation, Prev: Gawk Distribution, Up: Installation + +B.2 Compiling and Installing `gawk' on Unix +=========================================== + +Usually, you can compile and install `gawk' by typing only two +commands. However, if you use an unusual system, you may need to +configure `gawk' for your system yourself. + +* Menu: + +* Quick Installation:: Compiling `gawk' under Unix. +* Additional Configuration Options:: Other compile-time options. +* Configuration Philosophy:: How it's all supposed to work. + + +File: gawk.info, Node: Quick Installation, Next: Additional Configuration Options, Up: Unix Installation + +B.2.1 Compiling `gawk' for Unix +------------------------------- + +After you have extracted the `gawk' distribution, `cd' to +`gawk-3.1.6'. Like most GNU software, `gawk' is configured +automatically for your Unix system by running the `configure' program. +This program is a Bourne shell script that is generated automatically +using GNU `autoconf'. (The `autoconf' software is described fully +starting with *note Top::.) + + To configure `gawk', simply run `configure': + + sh ./configure + + This produces a `Makefile' and `config.h' tailored to your system. +The `config.h' file describes various facts about your system. You +might want to edit the `Makefile' to change the `CFLAGS' variable, +which controls the command-line options that are passed to the C +compiler (such as optimization levels or compiling for debugging). + + Alternatively, you can add your own values for most `make' variables +on the command line, such as `CC' and `CFLAGS', when running +`configure': + + CC=cc CFLAGS=-g sh ./configure + +See the file `INSTALL' in the `gawk' distribution for all the details. + + After you have run `configure' and possibly edited the `Makefile', +type: + + make + +Shortly thereafter, you should have an executable version of `gawk'. +That's all there is to it! To verify that `gawk' is working properly, +run `make check'. All of the tests should succeed. If these steps do +not work, or if any of the tests fail, check the files in the +`README_d' directory to see if you've found a known problem. If the +failure is not described there, please send in a bug report (*note +Bugs::.) + + +File: gawk.info, Node: Additional Configuration Options, Next: Configuration Philosophy, Prev: Quick Installation, Up: Unix Installation + +B.2.2 Additional Configuration Options +-------------------------------------- + +There are several additional options you may use on the `configure' +command line when compiling `gawk' from scratch, including: + +`--enable-portals' + Treat pathnames that begin with `/p' as BSD portal files when + doing two-way I/O with the `|&' operator (*note Portal Files::). + +`--enable-switch' + Enable the recognition and execution of C-style `switch' statements + in `awk' programs (*note Switch Statement::.) + +`--disable-lint' + This option disables all lint checking within `gawk'. The + `--lint' and `--lint-old' options (*note Options::) are accepted, + but silently do nothing. Similarly, setting the `LINT' variable + (*note User-modified::) has no effect on the running `awk' program. + + When used with GCC's automatic dead-code-elimination, this option + cuts almost 200K bytes off the size of the `gawk' executable on + GNU/Linux x86 systems. Results on other systems and with other + compilers are likely to vary. Using this option may bring you + some slight performance improvement. + + Using this option will cause some of the tests in the test suite + to fail. This option may be removed at a later date. + +`--disable-nls' + Disable all message-translation facilities. This is usually not + desirable, but it may bring you some slight performance + improvement. + +`--disable-directories-fatal' + Causes `gawk' to silently skip directories named on the command + line. + + As of version 3.1.5, the `--with-included-gettext' configuration +option is no longer available, since `gawk' expects the GNU `gettext' +library to be installed as an external library. + + +File: gawk.info, Node: Configuration Philosophy, Prev: Additional Configuration Options, Up: Unix Installation + +B.2.3 The Configuration Process +------------------------------- + +This minor node is of interest only if you know something about using +the C language and the Unix operating system. + + The source code for `gawk' generally attempts to adhere to formal +standards wherever possible. This means that `gawk' uses library +routines that are specified by the ISO C standard and by the POSIX +operating system interface standard. When using an ISO C compiler, +function prototypes are used to help improve the compile-time checking. + + Many Unix systems do not support all of either the ISO or the POSIX +standards. The `missing_d' subdirectory in the `gawk' distribution +contains replacement versions of those functions that are most likely +to be missing. + + The `config.h' file that `configure' creates contains definitions +that describe features of the particular operating system where you are +attempting to compile `gawk'. The three things described by this file +are: what header files are available, so that they can be correctly +included, what (supposedly) standard functions are actually available +in your C libraries, and various miscellaneous facts about your variant +of Unix. For example, there may not be an `st_blksize' element in the +`stat' structure. In this case, `HAVE_ST_BLKSIZE' is undefined. + + It is possible for your C compiler to lie to `configure'. It may do +so by not exiting with an error when a library function is not +available. To get around this, edit the file `custom.h'. Use an +`#ifdef' that is appropriate for your system, and either `#define' any +constants that `configure' should have defined but didn't, or `#undef' +any constants that `configure' defined and should not have. `custom.h' +is automatically included by `config.h'. + + It is also possible that the `configure' program generated by +`autoconf' will not work on your system in some other fashion. If you +do have a problem, the file `configure.in' is the input for `autoconf'. +You may be able to change this file and generate a new version of +`configure' that works on your system (*note Bugs::, for information on +how to report problems in configuring `gawk'). The same mechanism may +be used to send in updates to `configure.in' and/or `custom.h'. + + +File: gawk.info, Node: Non-Unix Installation, Next: Unsupported, Prev: Unix Installation, Up: Installation + +B.3 Installation on Other Operating Systems +=========================================== + +This minor node describes how to install `gawk' on various non-Unix +systems. + +* Menu: + +* Amiga Installation:: Installing `gawk' on an Amiga. +* BeOS Installation:: Installing `gawk' on BeOS. +* PC Installation:: Installing and Compiling `gawk' on + MS-DOS and OS/2. +* VMS Installation:: Installing `gawk' on VMS. + + +File: gawk.info, Node: Amiga Installation, Next: BeOS Installation, Up: Non-Unix Installation + +B.3.1 Installing `gawk' on an Amiga +----------------------------------- + +You can install `gawk' on an Amiga system using a Unix emulation +environment, available via anonymous `ftp' from `ftp.ninemoons.com' in +the directory `pub/ade/current'. This includes a shell based on +`pdksh'. The primary component of this environment is a Unix emulation +library, `ixemul.lib'. + + A more complete distribution for the Amiga is available on the Geek +Gadgets CD-ROM, available from: + + CRONUS + 1840 E. Warner Road #105-265 + Tempe, AZ 85284 USA + US Toll Free: (800) 804-0833 + Phone: +1-602-491-0442 + FAX: +1-602-491-0048 + Email: <info@ninemoons.com> + WWW: `http://www.ninemoons.com' + Anonymous `ftp' site: `ftp.ninemoons.com' + + Once you have the distribution, you can configure `gawk' simply by +running `configure': + + configure -v m68k-amigaos + + Then run `make' and you should be all set! If these steps do not +work, please send in a bug report (*note Bugs::). + + +File: gawk.info, Node: BeOS Installation, Next: PC Installation, Prev: Amiga Installation, Up: Non-Unix Installation + +B.3.2 Installing `gawk' on BeOS +------------------------------- + +Since BeOS DR9, all the tools that you should need to build `gawk' are +included with BeOS. The process is basically identical to the Unix +process of running `configure' and then `make'. Full instructions are +given below. + + You can compile `gawk' under BeOS by extracting the standard sources +and running `configure'. You _must_ specify the location prefix for the +installation directory. For BeOS DR9 and beyond, the best directory to +use is `/boot/home/config', so the `configure' command is: + + configure --prefix=/boot/home/config + + This installs the compiled application into `/boot/home/config/bin', +which is already specified in the standard `PATH'. + + Once the configuration process is completed, you can run `make', and +then `make install': + + $ make + ... + $ make install + + BeOS uses `bash' as its shell; thus, you use `gawk' the same way you +would under Unix. If these steps do not work, please send in a bug +report (*note Bugs::). + + +File: gawk.info, Node: PC Installation, Next: VMS Installation, Prev: BeOS Installation, Up: Non-Unix Installation + +B.3.3 Installation on PC Operating Systems +------------------------------------------ + +This minor node covers installation and usage of `gawk' on x86 machines +running DOS, any version of Windows, or OS/2. In this minor node, the +term "Windows32" refers to any of Windows-95/98/ME/NT/2000. + + The limitations of DOS (and DOS shells under Windows or OS/2) has +meant that various "DOS extenders" are often used with programs such as +`gawk'. The varying capabilities of Microsoft Windows 3.1 and +Windows32 can add to the confusion. For an overview of the +considerations, please refer to `README_d/README.pc' in the +distribution. + +* Menu: + +* PC Binary Installation:: Installing a prepared distribution. +* PC Compiling:: Compiling `gawk' for MS-DOS, Windows32, + and OS/2. +* PC Dynamic:: Compiling `gawk' for dynamic libraries. +* PC Using:: Running `gawk' on MS-DOS, Windows32 and + OS/2. +* Cygwin:: Building and running `gawk' for + Cygwin. + + +File: gawk.info, Node: PC Binary Installation, Next: PC Compiling, Up: PC Installation + +B.3.3.1 Installing a Prepared Distribution for PC Systems +......................................................... + +If you have received a binary distribution prepared by the DOS +maintainers, then `gawk' and the necessary support files appear under +the `gnu' directory, with executables in `gnu/bin', libraries in +`gnu/lib/awk', and manual pages under `gnu/man'. This is designed for +easy installation to a `/gnu' directory on your drive--however, the +files can be installed anywhere provided `AWKPATH' is set properly. +Regardless of the installation directory, the first line of `igawk.cmd' +and `igawk.bat' (in `gnu/bin') may need to be edited. + + The binary distribution contains a separate file describing the +contents. In particular, it may include more than one version of the +`gawk' executable. + + OS/2 (32 bit, EMX) binary distributions are prepared for the `/usr' +directory of your preferred drive. Set `UNIXROOT' to your installation +drive (e.g., `e:') if you want to install `gawk' onto another drive +than the hardcoded default `c:'. Executables appear in `/usr/bin', +libraries under `/usr/share/awk', manual pages under `/usr/man', +Texinfo documentation under `/usr/info' and NLS files under +`/usr/share/locale'. If you already have a file `/usr/info/dir' from +another package _do not overwrite it!_ Instead enter the following +commands at your prompt (replace `x:' by your installation drive): + + install-info --info-dir=x:/usr/info x:/usr/info/gawk.info + install-info --info-dir=x:/usr/info x:/usr/info/gawkinet.info + + However, the files can be installed anywhere provided `AWKPATH' is +set properly. + + The binary distribution may contain a separate file containing +additional or more detailed installation instructions. + + +File: gawk.info, Node: PC Compiling, Next: PC Dynamic, Prev: PC Binary Installation, Up: PC Installation + +B.3.3.2 Compiling `gawk' for PC Operating Systems +................................................. + +`gawk' can be compiled for MS-DOS, Windows32, and OS/2 using the GNU +development tools from DJ Delorie (DJGPP; MS-DOS only) or Eberhard +Mattes (EMX; MS-DOS, Windows32 and OS/2). Microsoft Visual C/C++ can +be used to build a Windows32 version, and Microsoft C/C++ can be used +to build 16-bit versions for MS-DOS and OS/2. (As of `gawk' 3.1.2, the +MSC version doesn't work. However, the maintainer is working on fixing +it.) The file `README_d/README.pc' in the `gawk' distribution contains +additional notes, and `pc/Makefile' contains important information on +compilation options. + + To build `gawk' for MS-DOS, Windows32, and OS/2 (16 bit only; for 32 +bit (EMX) you can use the `configure' script and skip the following +paragraphs; for details see below), copy the files in the `pc' +directory (_except_ for `ChangeLog') to the directory with the rest of +the `gawk' sources. The `Makefile' contains a configuration section +with comments and may need to be edited in order to work with your +`make' utility. + + The `Makefile' contains a number of targets for building various +MS-DOS, Windows32, and OS/2 versions. A list of targets is printed if +the `make' command is given without a target. As an example, to build +`gawk' using the DJGPP tools, enter `make djgpp'. (The DJGPP tools may +be found at `ftp://ftp.delorie.com/pub/djgpp/current/v2gnu/'.) + + Using `make' to run the standard tests and to install `gawk' +requires additional Unix-like tools, including `sh', `sed', and `cp'. +In order to run the tests, the `test/*.ok' files may need to be +converted so that they have the usual DOS-style end-of-line markers. +Most of the tests work properly with Stewartson's shell along with the +companion utilities or appropriate GNU utilities. However, some +editing of `test/Makefile' is required. It is recommended that you copy +the file `pc/Makefile.tst' over the file `test/Makefile' as a +replacement. Details can be found in `README_d/README.pc' and in the +file `pc/Makefile.tst'. + + The 32 bit EMX version of `gawk' works "out of the box" under OS/2. +In principle, it is possible to compile `gawk' the following way: + + $ ./configure + $ make + + This is not recommended, though. To get an OMF executable you should +use the following commands at your `sh' prompt: + + $ CPPFLAGS="-D__ST_MT_ERRNO__" + $ export CPPFLAGS + $ CFLAGS="-O2 -Zomf -Zmt" + $ export CFLAGS + $ LDFLAGS="-s -Zcrtdll -Zlinker /exepack:2 -Zlinker /pm:vio -Zstack 0x6000" + $ export LDFLAGS + $ RANLIB="echo" + $ export RANLIB + $ ./configure --prefix=c:/usr --without-included-gettext + $ make AR=emxomfar + + These are just suggestions. You may use any other set of +(self-consistent) environment variables and compiler flags. + + To get an FHS-compliant file hierarchy it is recommended to use the +additional `configure' options `--infodir=c:/usr/share/info', +`--mandir=c:/usr/share/man' and `--libexecdir=c:/usr/lib'. + + If you use GCC 2.95 it is recommended to use also: + + $ LIBS="-lgcc" + $ export LIBS + + You can also get an `a.out' executable if you prefer: + + $ CPPFLAGS="-D__ST_MT_ERRNO__" + $ export CPPFLAGS + $ CFLAGS="-O2 -Zmt" + $ export CFLAGS + $ LDFLAGS="-s -Zstack 0x6000" + $ LIBS="-lgcc" + $ unset RANLIB + $ ./configure --prefix=c:/usr + $ make + + NOTE: Versions later than GCC 2.95, i.e., GCC 3.x using the + Innotek libc were not tested. + + NOTE: Even if the compiled `gawk.exe' (`a.out') executable + contains a DOS header, it does _not_ work under DOS. To compile an + executable that runs under DOS, `"-DPIPES_SIMULATED"' must be + added to `CPPFLAGS'. But then some nonstandard extensions of + `gawk' (e.g., `|&') do not work! + + After compilation the internal tests can be performed. Enter `make +check CMP="diff -a"' at your command prompt. All tests except for the +`pid' test are expected to work properly. The `pid' test fails because +child processes are not started by `fork()'. + + `make install' works as expected. + + NOTE: Most OS/2 ports of GNU `make' are not able to handle the + Makefiles of this package. If you encounter any problems with + `make' try GNU Make 3.79.1 or later versions. You should find the + latest version on `http://www.unixos2.org/sw/pub/binary/make/' or + on `ftp://hobbes.nmsu.edu/pub/os2/'. + + +File: gawk.info, Node: PC Dynamic, Next: PC Using, Prev: PC Compiling, Up: PC Installation + +B.3.3.3 Compiling `gawk' For Dynamic Libraries +.............................................. + +To compile `gawk' with dynamic extension support, uncomment the +definitions of `DYN_FLAGS', `DYN_EXP', `DYN_OBJ', and `DYN_MAKEXP' in +the configuration section of the `Makefile'. There are two definitions +for `DYN_MAKEXP': pick the one that matches your target. + + To build some of the example extension libraries, `cd' to the +extension directory and copy `Makefile.pc' to `Makefile'. You can then +build using the same two targets. To run the example `awk' scripts, +you'll need to either change the call to the `extension' function to +match the name of the library (for instance, change `"./ordchr.so"' to +`"ordchr.dll"' or simply `"ordchr"'), or rename the library to match +the call (for instance, rename `ordchr.dll' to `ordchr.so'). + + If you build `gawk.exe' with one compiler but want to build an +extension library with the other, you need to copy the import library. +Visual C uses a library called `gawk.lib', while MinGW uses a library +called `libgawk.a'. These files are equivalent and will interoperate if +you give them the correct name. The resulting shared libraries are +also interoperable. + + To create your own extension library, you can use the examples as +models, but you're essentially on your own. Post to `comp.lang.awk' or +send electronic mail to <ptjm@interlog.com> if you have problems getting +started. If you need to access functions or variables which are not +exported by `gawk.exe', add them to `gawkw32.def' and rebuild. You +should also add `ATTRIBUTE_EXPORTED' to the declaration in `awk.h' of +any variables you add to `gawkw32.def'. + + Note that extension libraries have the name of the `awk' executable +embedded in them at link time, so they will work only with `gawk.exe'. +In particular, they won't work if you rename `gawk.exe' to `awk.exe' or +if you try to use `pgawk.exe'. You can perform profiling by temporarily +renaming `pgawk.exe' to `gawk.exe'. You can resolve this problem by +changing the program name in the definition of `DYN_MAKEXP' for your +compiler. + + On Windows32, libraries are sought first in the current directory, +then in the directory containing `gawk.exe', and finally through the +`PATH' environment variable. + + +File: gawk.info, Node: PC Using, Next: Cygwin, Prev: PC Dynamic, Up: PC Installation + +B.3.3.4 Using `gawk' on PC Operating Systems +............................................ + +With the exception of the Cygwin environment, the `|&' operator and +TCP/IP networking (*note TCP/IP Networking::) are not supported for +MS-DOS or MS-Windows. EMX (OS/2 only) does support at least the `|&' +operator. + + The OS/2 and MS-DOS versions of `gawk' search for program files as +described in *note AWKPATH Variable::. However, semicolons (rather +than colons) separate elements in the `AWKPATH' variable. If `AWKPATH' +is not set or is empty, then the default search path for OS/2 (16 bit) +and MS-DOS versions is `".;c:/lib/awk;c:/gnu/lib/awk"'. + + The search path for OS/2 (32 bit, EMX) is determined by the prefix +directory (most likely `/usr' or `c:/usr') that has been specified as +an option of the `configure' script like it is the case for the Unix +versions. If `c:/usr' is the prefix directory then the default search +path contains `.' and `c:/usr/share/awk'. Additionally, to support +binary distributions of `gawk' for OS/2 systems whose drive `c:' might +not support long file names or might not exist at all, there is a +special environment variable. If `UNIXROOT' specifies a drive then this +specific drive is also searched for program files. E.g., if `UNIXROOT' +is set to `e:' the complete default search path is +`".;c:/usr/share/awk;e:/usr/share/awk"'. + + An `sh'-like shell (as opposed to `command.com' under MS-DOS or +`cmd.exe' under OS/2) may be useful for `awk' programming. Ian +Stewartson has written an excellent shell for MS-DOS and OS/2, Daisuke +Aoyama has ported GNU `bash' to MS-DOS using the DJGPP tools, and +several shells are available for OS/2, including `ksh'. The file +`README_d/README.pc' in the `gawk' distribution contains information on +these shells. Users of Stewartson's shell on DOS should examine its +documentation for handling command lines; in particular, the setting +for `gawk' in the shell configuration may need to be changed and the +`ignoretype' option may also be of interest. + + Under OS/2 and DOS, `gawk' (and many other text programs) silently +translate end-of-line `"\r\n"' to `"\n"' on input and `"\n"' to +`"\r\n"' on output. A special `BINMODE' variable allows control over +these translations and is interpreted as follows: + + * If `BINMODE' is `"r"', or `(BINMODE & 1)' is nonzero, then binary + mode is set on read (i.e., no translations on reads). + + * If `BINMODE' is `"w"', or `(BINMODE & 2)' is nonzero, then binary + mode is set on write (i.e., no translations on writes). + + * If `BINMODE' is `"rw"' or `"wr"', binary mode is set for both read + and write (same as `(BINMODE & 3)'). + + * `BINMODE=NON-NULL-STRING' is the same as `BINMODE=3' (i.e., no + translations on reads or writes). However, `gawk' issues a warning + message if the string is not one of `"rw"' or `"wr"'. + +The modes for standard input and standard output are set one time only +(after the command line is read, but before processing any of the `awk' +program). Setting `BINMODE' for standard input or standard output is +accomplished by using an appropriate `-v BINMODE=N' option on the +command line. `BINMODE' is set at the time a file or pipe is opened +and cannot be changed mid-stream. + + The name `BINMODE' was chosen to match `mawk' (*note Other +Versions::). Both `mawk' and `gawk' handle `BINMODE' similarly; +however, `mawk' adds a `-W BINMODE=N' option and an environment +variable that can set `BINMODE', `RS', and `ORS'. The files +`binmode[1-3].awk' (under `gnu/lib/awk' in some of the prepared +distributions) have been chosen to match `mawk''s `-W BINMODE=N' +option. These can be changed or discarded; in particular, the setting +of `RS' giving the fewest "surprises" is open to debate. `mawk' uses +`RS = "\r\n"' if binary mode is set on read, which is appropriate for +files with the DOS-style end-of-line. + + To illustrate, the following examples set binary mode on writes for +standard output and other files, and set `ORS' as the "usual" DOS-style +end-of-line: + + gawk -v BINMODE=2 -v ORS="\r\n" ... + +or: + + gawk -v BINMODE=w -f binmode2.awk ... + +These give the same result as the `-W BINMODE=2' option in `mawk'. The +following changes the record separator to `"\r\n"' and sets binary mode +on reads, but does not affect the mode on standard input: + + gawk -v RS="\r\n" --source "BEGIN { BINMODE = 1 }" ... + +or: + + gawk -f binmode1.awk ... + +With proper quoting, in the first example the setting of `RS' can be +moved into the `BEGIN' rule. + + +File: gawk.info, Node: Cygwin, Prev: PC Using, Up: PC Installation + +B.3.3.5 Using `gawk' In The Cygwin Environment +.............................................. + +`gawk' can be used "out of the box" under Windows if you are using the +Cygwin environment.(1) This environment provides an excellent +simulation of Unix, using the GNU tools, such as `bash', the GNU +Compiler Collection (GCC), GNU Make, and other GNU tools. Compilation +and installation for Cygwin is the same as for a Unix system: + + tar -xvpzf gawk-3.1.6.tar.gz + cd gawk-3.1.6 + ./configure + make + + When compared to GNU/Linux on the same system, the `configure' step +on Cygwin takes considerably longer. However, it does finish, and then +the `make' proceeds as usual. + + NOTE: The `|&' operator and TCP/IP networking (*note TCP/IP + Networking::) are fully supported in the Cygwin environment. This + is not true for any other environment for MS-DOS or MS-Windows. + + ---------- Footnotes ---------- + + (1) `http://www.cygwin.com' + + +File: gawk.info, Node: VMS Installation, Prev: PC Installation, Up: Non-Unix Installation + +B.3.4 How to Compile and Install `gawk' on VMS +---------------------------------------------- + +This node describes how to compile and install `gawk' under VMS. + +* Menu: + +* VMS Compilation:: How to compile `gawk' under VMS. +* VMS Installation Details:: How to install `gawk' under VMS. +* VMS Running:: How to run `gawk' under VMS. +* VMS POSIX:: Alternate instructions for VMS POSIX. +* VMS Old Gawk:: An old version comes with some VMS systems. + + +File: gawk.info, Node: VMS Compilation, Next: VMS Installation Details, Up: VMS Installation + +B.3.4.1 Compiling `gawk' on VMS +............................... + +To compile `gawk' under VMS, there is a `DCL' command procedure that +issues all the necessary `CC' and `LINK' commands. There is also a +`Makefile' for use with the `MMS' utility. From the source directory, +use either: + + $ @[.VMS]VMSBUILD.COM + +or: + + $ MMS/DESCRIPTION=[.VMS]DESCRIP.MMS GAWK + + Depending upon which C compiler you are using, follow one of the sets +of instructions in this table: + +VAX C V3.x + Use either `vmsbuild.com' or `descrip.mms' as is. These use + `CC/OPTIMIZE=NOLINE', which is essential for Version 3.0. + +VAX C V2.x + You must have Version 2.3 or 2.4; older ones won't work. Edit + either `vmsbuild.com' or `descrip.mms' according to the comments + in them. For `vmsbuild.com', this just entails removing two `!' + delimiters. Also edit `config.h' (which is a copy of file + `[.config]vms-conf.h') and comment out or delete the two lines + `#define __STDC__ 0' and `#define VAXC_BUILTINS' near the end. + +GNU C + Edit `vmsbuild.com' or `descrip.mms'; the changes are different + from those for VAX C V2.x but equally straightforward. No changes + to `config.h' are needed. + +DEC C + Edit `vmsbuild.com' or `descrip.mms' according to their comments. + No changes to `config.h' are needed. + + `gawk' has been tested under VAX/VMS 5.5-1 using VAX C V3.2, and GNU +C 1.40 and 2.3. It should work without modifications for VMS V4.6 and +up. + + +File: gawk.info, Node: VMS Installation Details, Next: VMS Running, Prev: VMS Compilation, Up: VMS Installation + +B.3.4.2 Installing `gawk' on VMS +................................ + +To install `gawk', all you need is a "foreign" command, which is a +`DCL' symbol whose value begins with a dollar sign. For example: + + $ GAWK :== $disk1:[gnubin]GAWK + +Substitute the actual location of `gawk.exe' for `$disk1:[gnubin]'. The +symbol should be placed in the `login.com' of any user who wants to run +`gawk', so that it is defined every time the user logs on. +Alternatively, the symbol may be placed in the system-wide +`sylogin.com' procedure, which allows all users to run `gawk'. + + Optionally, the help entry can be loaded into a VMS help library: + + $ LIBRARY/HELP SYS$HELP:HELPLIB [.VMS]GAWK.HLP + +(You may want to substitute a site-specific help library rather than +the standard VMS library `HELPLIB'.) After loading the help text, the +command: + + $ HELP GAWK + +provides information about both the `gawk' implementation and the `awk' +programming language. + + The logical name `AWK_LIBRARY' can designate a default location for +`awk' program files. For the `-f' option, if the specified file name +has no device or directory path information in it, `gawk' looks in the +current directory first, then in the directory specified by the +translation of `AWK_LIBRARY' if the file is not found. If, after +searching in both directories, the file still is not found, `gawk' +appends the suffix `.awk' to the filename and retries the file search. +If `AWK_LIBRARY' is not defined, that portion of the file search fails +benignly. + + +File: gawk.info, Node: VMS Running, Next: VMS POSIX, Prev: VMS Installation Details, Up: VMS Installation + +B.3.4.3 Running `gawk' on VMS +............................. + +Command-line parsing and quoting conventions are significantly different +on VMS, so examples in this Info file or from other sources often need +minor changes. They _are_ minor though, and all `awk' programs should +run correctly. + + Here are a couple of trivial tests: + + $ gawk -- "BEGIN {print ""Hello, World!""}" + $ gawk -"W" version + ! could also be -"W version" or "-W version" + +Note that uppercase and mixed-case text must be quoted. + + The VMS port of `gawk' includes a `DCL'-style interface in addition +to the original shell-style interface (see the help entry for details). +One side effect of dual command-line parsing is that if there is only a +single parameter (as in the quoted string program above), the command +becomes ambiguous. To work around this, the normally optional `--' +flag is required to force Unix style rather than `DCL' parsing. If any +other dash-type options (or multiple parameters such as data files to +process) are present, there is no ambiguity and `--' can be omitted. + + The default search path, when looking for `awk' program files +specified by the `-f' option, is `"SYS$DISK:[],AWK_LIBRARY:"'. The +logical name `AWKPATH' can be used to override this default. The format +of `AWKPATH' is a comma-separated list of directory specifications. +When defining it, the value should be quoted so that it retains a single +translation and not a multitranslation `RMS' searchlist. + + +File: gawk.info, Node: VMS POSIX, Next: VMS Old Gawk, Prev: VMS Running, Up: VMS Installation + +B.3.4.4 Building and Using `gawk' on VMS POSIX +.............................................. + +Ignore the instructions above, although `vms/gawk.hlp' should still be +made available in a help library. The source tree should be unpacked +into a container file subsystem rather than into the ordinary VMS +filesystem. Make sure that the two scripts, `configure' and +`vms/posix-cc.sh', are executable; use `chmod +x' on them if necessary. +Then execute the following two commands: + + psx> CC=vms/posix-cc.sh configure + psx> make CC=c89 gawk + +The first command constructs files `config.h' and `Makefile' out of +templates, using a script to make the C compiler fit `configure''s +expectations. The second command compiles and links `gawk' using the C +compiler directly; ignore any warnings from `make' about being unable +to redefine `CC'. `configure' takes a very long time to execute, but +at least it provides incremental feedback as it runs. + + This has been tested with VAX/VMS V6.2, VMS POSIX V2.0, and DEC C +V5.2. + + Once built, `gawk' works like any other shell utility. Unlike the +normal VMS port of `gawk', no special command-line manipulation is +needed in the VMS POSIX environment. + + +File: gawk.info, Node: VMS Old Gawk, Prev: VMS POSIX, Up: VMS Installation + +B.3.4.5 Some VMS Systems Have An Old Version of `gawk' +...................................................... + +Some versions of VMS have an old version of `gawk'. To access it, +define a symbol, as follows: + + $ gawk :== $ sys$common:[syshlp.examples.tcpip.snmp]gawk.exe + + This is apparently version 2.15.6, which is quite old. We recommend +compiling and using the current version. + + +File: gawk.info, Node: Unsupported, Next: Bugs, Prev: Non-Unix Installation, Up: Installation + +B.4 Unsupported Operating System Ports +====================================== + +This sections describes systems for which the `gawk' port is no longer +supported. + +* Menu: + +* Atari Installation:: Installing `gawk' on the Atari ST. +* Tandem Installation:: Installing `gawk' on a Tandem. + + +File: gawk.info, Node: Atari Installation, Next: Tandem Installation, Up: Unsupported + +B.4.1 Installing `gawk' on the Atari ST +--------------------------------------- + +The Atari port is no longer supported. It is included for those who +might want to use it but it is no longer being actively maintained. + + There are no substantial differences when installing `gawk' on +various Atari models. Compiled `gawk' executables do not require a +large amount of memory with most `awk' programs, and should run on all +Motorola processor-based models (called further ST, even if that is not +exactly right). + + In order to use `gawk', you need to have a shell, either text or +graphics, that does not map all the characters of a command line to +uppercase. Maintaining case distinction in option flags is very +important (*note Options::). These days this is the default and it may +only be a problem for some very old machines. If your system does not +preserve the case of option flags, you need to upgrade your tools. +Support for I/O redirection is necessary to make it easy to import +`awk' programs from other environments. Pipes are nice to have but not +vital. + +* Menu: + +* Atari Compiling:: Compiling `gawk' on Atari. +* Atari Using:: Running `gawk' on Atari. + + +File: gawk.info, Node: Atari Compiling, Next: Atari Using, Up: Atari Installation + +B.4.1.1 Compiling `gawk' on the Atari ST +........................................ + +A proper compilation of `gawk' sources when `sizeof(int)' differs from +`sizeof(void *)' requires an ISO C compiler. An initial port was done +with `gcc'. You may actually prefer executables where `int's are four +bytes wide but the other variant works as well. + + You may need quite a bit of memory when trying to recompile the +`gawk' sources, as some source files (`regex.c' in particular) are quite +big. If you run out of memory compiling such a file, try reducing the +optimization level for this particular file, which may help. + + With a reasonable shell (`bash' will do), you have a pretty good +chance that the `configure' utility will succeed, and in particular if +you run GNU/Linux, MiNT or a similar operating system. Otherwise +sample versions of `config.h' and `Makefile.st' are given in the +`atari' subdirectory and can be edited and copied to the corresponding +files in the main source directory. Even if `configure' produces +something, it might be advisable to compare its results with the sample +versions and possibly make adjustments. + + Some `gawk' source code fragments depend on a preprocessor define +`atarist'. This basically assumes the TOS environment with `gcc'. +Modify these sections as appropriate if they are not right for your +environment. Also see the remarks about `AWKPATH' and `envsep' in +*note Atari Using::. + + As shipped, the sample `config.h' claims that the `system' function +is missing from the libraries, which is not true, and an alternative +implementation of this function is provided in +`unsupported/atari/system.c'. Depending upon your particular +combination of shell and operating system, you might want to change the +file to indicate that `system' is available. + + +File: gawk.info, Node: Atari Using, Prev: Atari Compiling, Up: Atari Installation + +B.4.1.2 Running `gawk' on the Atari ST +...................................... + +An executable version of `gawk' should be placed, as usual, anywhere in +your `PATH' where your shell can find it. + + While executing, the Atari version of `gawk' creates a number of +temporary files. When using `gcc' libraries for TOS, `gawk' looks for +either of the environment variables, `TEMP' or `TMPDIR', in that order. +If either one is found, its value is assumed to be a directory for +temporary files. This directory must exist, and if you can spare the +memory, it is a good idea to put it on a RAM drive. If neither `TEMP' +nor `TMPDIR' are found, then `gawk' uses the current directory for its +temporary files. + + The ST version of `gawk' searches for its program files, as +described in *note AWKPATH Variable::. The default value for the +`AWKPATH' variable is taken from `DEFPATH' defined in `Makefile'. The +sample `gcc'/TOS `Makefile' for the ST in the distribution sets +`DEFPATH' to `".,c:\lib\awk,c:\gnu\lib\awk"'. The search path can be +modified by explicitly setting `AWKPATH' to whatever you want. Note +that colons cannot be used on the ST to separate elements in the +`AWKPATH' variable, since they have another reserved meaning. Instead, +you must use a comma to separate elements in the path. When +recompiling, the separating character can be modified by initializing +the `envsep' variable in `unsupported/atari/gawkmisc.atr' to another +value. + + Although `awk' allows great flexibility in doing I/O redirections +from within a program, this facility should be used with care on the ST +running under TOS. In some circumstances, the OS routines for +file-handle pool processing lose track of certain events, causing the +computer to crash and requiring a reboot. Often a warm reboot is +sufficient. Fortunately, this happens infrequently and in rather +esoteric situations. In particular, avoid having one part of an `awk' +program using `print' statements explicitly redirected to +`/dev/stdout', while other `print' statements use the default standard +output, and a calling shell has redirected standard output to a file. + + When `gawk' is compiled with the ST version of `gcc' and its usual +libraries, it accepts both `/' and `\' as path separators. While this +is convenient, it should be remembered that this removes one +technically valid character (`/') from your file name. It may also +create problems for external programs called via the `system' function, +which may not support this convention. Whenever it is possible that a +file created by `gawk' will be used by some other program, use only +backslashes. Also remember that in `awk', backslashes in strings have +to be doubled in order to get literal backslashes (*note Escape +Sequences::). + + +File: gawk.info, Node: Tandem Installation, Prev: Atari Installation, Up: Unsupported + +B.4.2 Installing `gawk' on a Tandem +----------------------------------- + +The Tandem port is only minimally supported. The port's contributor no +longer has access to a Tandem system. + + The Tandem port was done on a Cyclone machine running D20. The port +is pretty clean and all facilities seem to work except for the I/O +piping facilities (*note Getline/Pipe::, *note Getline/Variable/Pipe::, +and *note Redirection::), which is just too foreign a concept for +Tandem. + + To build a Tandem executable from source, download all of the files +so that the file names on the Tandem box conform to the restrictions of +D20. For example, `array.c' becomes `ARRAYC', and `awk.h' becomes +`AWKH'. The totally Tandem-specific files are in the `tandem' +"subvolume" (`unsupported/tandem' in the `gawk' distribution) and +should be copied to the main source directory before building `gawk'. + + The file `compit' can then be used to compile and bind an executable. +Alas, there is no `configure' or `make'. + + Usage is the same as for Unix, except that D20 requires all `{' and +`}' characters to be escaped with `~' on the command line (but _not_ in +script files). Also, the standard Tandem syntax for `/in filename,out +filename/' must be used instead of the usual Unix `<' and `>' for file +redirection. (Redirection options on `getline', `print' etc., are +supported.) + + The `-mr VAL' option (*note Options::) has been "stolen" to enable +Tandem users to process fixed-length records with no "end-of-line" +character. That is, `-mr 74' tells `gawk' to read the input file as +fixed 74-byte records. + + +File: gawk.info, Node: Bugs, Next: Other Versions, Prev: Unsupported, Up: Installation + +B.5 Reporting Problems and Bugs +=============================== + + There is nothing more dangerous than a bored archeologist. + The Hitchhiker's Guide to the Galaxy + + If you have problems with `gawk' or think that you have found a bug, +please report it to the developers; we cannot promise to do anything +but we might well want to fix it. + + Before reporting a bug, make sure you have actually found a real bug. +Carefully reread the documentation and see if it really says you can do +what you're trying to do. If it's not clear whether you should be able +to do something or not, report that too; it's a bug in the +documentation! + + Before reporting a bug or trying to fix it yourself, try to isolate +it to the smallest possible `awk' program and input data file that +reproduces the problem. Then send us the program and data file, some +idea of what kind of Unix system you're using, the compiler you used to +compile `gawk', and the exact results `gawk' gave you. Also say what +you expected to occur; this helps us decide whether the problem is +really in the documentation. + + Once you have a precise problem, send email to <bug-gawk@gnu.org>. + + Please include the version number of `gawk' you are using. You can +get this information with the command `gawk --version'. Using this +address automatically sends a carbon copy of your mail to me. If +necessary, I can be reached directly at <arnold@skeeve.com>. The bug +reporting address is preferred since the email list is archived at the +GNU Project. _All email should be in English, since that is my native +language._ + + *Caution:* Do _not_ try to report bugs in `gawk' by posting to the +Usenet/Internet newsgroup `comp.lang.awk'. While the `gawk' developers +do occasionally read this newsgroup, there is no guarantee that we will +see your posting. The steps described above are the official +recognized ways for reporting bugs. + + Non-bug suggestions are always welcome as well. If you have +questions about things that are unclear in the documentation or are +just obscure features, ask me; I will try to help you out, although I +may not have the time to fix the problem. You can send me electronic +mail at the Internet address noted previously. + + If you find bugs in one of the non-Unix ports of `gawk', please send +an electronic mail message to the person who maintains that port. They +are named in the following list, as well as in the `README' file in the +`gawk' distribution. Information in the `README' file should be +considered authoritative if it conflicts with this Info file. + + The people maintaining the non-Unix ports of `gawk' are as follows: + +Amiga Fred Fish, <fnf@ninemoons.com>. +BeOS Martin Brown, <mc@whoever.com>. +MS-DOS Scott Deifik, <scottd.mail@sbcglobal.net> and Darrel + Hankerson, <hankedr@mail.auburn.edu>. +MS-Windows Juan Grigera, <juan@biophnet.unlp.edu.ar>. +OS/2 The Unix for OS/2 team, + <gawk-maintainer@unixos2.org>. +Tandem Stephen Davies, <scldad@sdc.com.au>. +VMS Pat Rankin, <rankin@pactechdata.com>. + + If your bug is also reproducible under Unix, please send a copy of +your report to the <bug-gawk@gnu.org> email list as well. + + +File: gawk.info, Node: Other Versions, Prev: Bugs, Up: Installation + +B.6 Other Freely Available `awk' Implementations +================================================ + + It's kind of fun to put comments like this in your awk code. + `// Do C++ comments work? answer: yes! of course' + Michael Brennan + + There are a number of other freely available `awk' implementations. +This minor node briefly describes where to get them: + +Unix `awk' + Brian Kernighan has made his implementation of `awk' freely + available. You can retrieve this version via the World Wide Web + from his home page.(1) It is available in several archive formats: + + Shell archive + `http://cm.bell-labs.com/who/bwk/awk.shar' + + Compressed `tar' file + `http://cm.bell-labs.com/who/bwk/awk.tar.gz' + + Zip file + `http://cm.bell-labs.com/who/bwk/awk.zip' + + This version requires an ISO C (1990 standard) compiler; the C + compiler from GCC (the GNU Compiler Collection) works quite nicely. + + *Note BTL::, for a list of extensions in this `awk' that are not + in POSIX `awk'. + +`mawk' + Michael Brennan has written an independent implementation of `awk', + called `mawk'. It is available under the GPL (*note Copying::), + just as `gawk' is. + + You can get it via anonymous `ftp' to the host `ftp.whidbey.net'. + Change directory to `/pub/brennan'. Use "binary" or "image" mode, + and retrieve `mawk1.3.3.tar.gz' (or the latest version that is + there). + + `gunzip' may be used to decompress this file. Installation is + similar to `gawk''s (*note Unix Installation::). + + `mawk' has the following extensions that are not in POSIX `awk': + + * The `fflush' built-in function for flushing buffered output + (*note I/O Functions::). + + * The `**' and `**=' operators (*note Arithmetic Ops:: and also + see *note Assignment Ops::). + + * The use of `func' as an abbreviation for `function' (*note + Definition Syntax::). + + * The `\x' escape sequence (*note Escape Sequences::). + + * The `/dev/stdout', and `/dev/stderr' special files (*note + Special Files::). Use `"-"' instead of `"/dev/stdin"' with + `mawk'. + + * The ability for `FS' and for the third argument to `split' to + be null strings (*note Single Character Fields::). + + * The ability to delete all of an array at once with `delete + ARRAY' (*note Delete::). + + * The ability for `RS' to be a regexp (*note Records::). + + * The `BINMODE' special variable for non-Unix operating systems + (*note PC Using::). + + The next version of `mawk' will support `nextfile'. + +`awka' + Written by Andrew Sumner, `awka' translates `awk' programs into C, + compiles them, and links them with a library of functions that + provides the core `awk' functionality. It also has a number of + extensions. + + The `awk' translator is released under the GPL, and the library is + under the LGPL. + + To get `awka', go to `http://awka.sourceforge.net'. You can reach + Andrew Sumner at <andrew@zbcom.net>. + +`pawk' + Nelson H.F. Beebe at the University of Utah has modified the Bell + Labs `awk' to provide timing and profiling information. It is + different from `pgawk' (*note Profiling::), in that it uses + CPU-based profiling, not line-count profiling. You may find it at + either `ftp://ftp.math.utah.edu/pub/pawk/pawk-20020210.tar.gz' or + `http://www.math.utah.edu/pub/pawk/pawk-20020210.tar.gz'. + +The OpenSolaris POSIX `awk' + The version of `awk' in `/usr/xpg4/bin' on Solaris is POSIX + compliant. It is based on the `awk' from Mortice Kern Systems for + PCs. The source code can be downloaded from the OpenSolaris web + site.(2) This author was able to make it compile and work under + GNU/Linux with 1-2 hours of work. Making it more generally + portable (using GNU Autoconf and/or Automake) would take more + work, and this has not been done, at least to our knowledge. + +`jawk' + This is an interpreter for `awk' written in Java. It claims to be + a full interpreter, although because it uses Java facilities for + I/O and for regexp matching, the language it supports is different + from POSIX `awk'. More information is available on the project's + home page.(3). + + + ---------- Footnotes ---------- + + (1) `http://cm.bell-labs.com/who/bwk' + + (2) `http://www.opensolaris.org' + + (3) `http://jawk.sourceforge.net' + + +File: gawk.info, Node: Notes, Next: Basic Concepts, Prev: Installation, Up: Top + +Appendix C Implementation Notes +******************************* + +This appendix contains information mainly of interest to implementors +and maintainers of `gawk'. Everything in it applies specifically to +`gawk' and not to other implementations. + +* Menu: + +* Compatibility Mode:: How to disable certain `gawk' + extensions. +* Additions:: Making Additions To `gawk'. +* Dynamic Extensions:: Adding new built-in functions to + `gawk'. +* Future Extensions:: New features that may be implemented one day. + + +File: gawk.info, Node: Compatibility Mode, Next: Additions, Up: Notes + +C.1 Downward Compatibility and Debugging +======================================== + +*Note POSIX/GNU::, for a summary of the GNU extensions to the `awk' +language and program. All of these features can be turned off by +invoking `gawk' with the `--traditional' option or with the `--posix' +option. + + If `gawk' is compiled for debugging with `-DDEBUG', then there is +one more option available on the command line: + +`-W parsedebug' +`--parsedebug' + Prints out the parse stack information as the program is being + parsed. + + This option is intended only for serious `gawk' developers and not +for the casual user. It probably has not even been compiled into your +version of `gawk', since it slows down execution. + + +File: gawk.info, Node: Additions, Next: Dynamic Extensions, Prev: Compatibility Mode, Up: Notes + +C.2 Making Additions to `gawk' +============================== + +If you find that you want to enhance `gawk' in a significant fashion, +you are perfectly free to do so. That is the point of having free +software; the source code is available and you are free to change it as +you want (*note Copying::). + + This minor node discusses the ways you might want to change `gawk' +as well as any considerations you should bear in mind. + +* Menu: + +* Adding Code:: Adding code to the main body of + `gawk'. +* New Ports:: Porting `gawk' to a new operating + system. + + +File: gawk.info, Node: Adding Code, Next: New Ports, Up: Additions + +C.2.1 Adding New Features +------------------------- + +You are free to add any new features you like to `gawk'. However, if +you want your changes to be incorporated into the `gawk' distribution, +there are several steps that you need to take in order to make it +possible for me to include your changes: + + 1. Before building the new feature into `gawk' itself, consider + writing it as an extension module (*note Dynamic Extensions::). + If that's not possible, continue with the rest of the steps in + this list. + + 2. Get the latest version. It is much easier for me to integrate + changes if they are relative to the most recent distributed + version of `gawk'. If your version of `gawk' is very old, I may + not be able to integrate them at all. (*Note Getting::, for + information on getting the latest version of `gawk'.) + + 3. See *note (Version)Top:: standards, GNU Coding Standards. This + document describes how GNU software should be written. If you + haven't read it, please do so, preferably _before_ starting to + modify `gawk'. (The `GNU Coding Standards' are available from the + GNU Project's `ftp' site, at + `ftp://ftp.gnu.org/gnu/GNUinfo/standards.text'. An HTML version, + suitable for reading with a WWW browser, is available at + `http://www.gnu.org/prep/standards_toc.html'. Texinfo, Info, and + DVI versions are also available.) + + 4. Use the `gawk' coding style. The C code for `gawk' follows the + instructions in the `GNU Coding Standards', with minor exceptions. + The code is formatted using the traditional "K&R" style, + particularly as regards to the placement of braces and the use of + tabs. In brief, the coding rules for `gawk' are as follows: + + * Use ANSI/ISO style (prototype) function headers when defining + functions. + + * Put the name of the function at the beginning of its own line. + + * Put the return type of the function, even if it is `int', on + the line above the line with the name and arguments of the + function. + + * Put spaces around parentheses used in control structures + (`if', `while', `for', `do', `switch', and `return'). + + * Do not put spaces in front of parentheses used in function + calls. + + * Put spaces around all C operators and after commas in + function calls. + + * Do not use the comma operator to produce multiple side + effects, except in `for' loop initialization and increment + parts, and in macro bodies. + + * Use real tabs for indenting, not spaces. + + * Use the "K&R" brace layout style. + + * Use comparisons against `NULL' and `'\0'' in the conditions of + `if', `while', and `for' statements, as well as in the `case's + of `switch' statements, instead of just the plain pointer or + character value. + + * Use the `TRUE', `FALSE' and `NULL' symbolic constants and the + character constant `'\0'' where appropriate, instead of `1' + and `0'. + + * Use the `ISALPHA', `ISDIGIT', etc. macros, instead of the + traditional lowercase versions; these macros are better + behaved for non-ASCII character sets. + + * Provide one-line descriptive comments for each function. + + * Do not use `#elif'. Many older Unix C compilers cannot handle + it. + + * Do not use the `alloca' function for allocating memory off + the stack. Its use causes more portability trouble than is + worth the minor benefit of not having to free the storage. + Instead, use `malloc' and `free'. + + NOTE: If I have to reformat your code to follow the coding + style used in `gawk', I may not bother to integrate your + changes at all. + + 5. Be prepared to sign the appropriate paperwork. In order for the + FSF to distribute your changes, you must either place those + changes in the public domain and submit a signed statement to that + effect, or assign the copyright in your changes to the FSF. Both + of these actions are easy to do and _many_ people have done so + already. If you have questions, please contact me (*note Bugs::), + or <gnu@gnu.org>. + + 6. Update the documentation. Along with your new code, please supply + new sections and/or chapters for this Info file. If at all + possible, please use real Texinfo, instead of just supplying + unformatted ASCII text (although even that is better than no + documentation at all). Conventions to be followed in `GAWK: + Effective AWK Programming' are provided after the `@bye' at the + end of the Texinfo source file. If possible, please update the + `man' page as well. + + You will also have to sign paperwork for your documentation + changes. + + 7. Submit changes as context diffs or unified diffs. Use `diff -c -r + -N' or `diff -u -r -N' to compare the original `gawk' source tree + with your version. (I find context diffs to be more readable but + unified diffs are more compact.) I recommend using the GNU + version of `diff'. Send the output produced by either run of + `diff' to me when you submit your changes. (*Note Bugs::, for the + electronic mail information.) + + Using this format makes it easy for me to apply your changes to the + master version of the `gawk' source code (using `patch'). If I + have to apply the changes manually, using a text editor, I may not + do so, particularly if there are lots of changes. + + 8. Include an entry for the `ChangeLog' file with your submission. + This helps further minimize the amount of work I have to do, + making it easier for me to accept patches. + + Although this sounds like a lot of work, please remember that while +you may write the new code, I have to maintain it and support it. If it +isn't possible for me to do that with a minimum of extra work, then I +probably will not. + + +File: gawk.info, Node: New Ports, Prev: Adding Code, Up: Additions + +C.2.2 Porting `gawk' to a New Operating System +---------------------------------------------- + +If you want to port `gawk' to a new operating system, there are several +steps: + + 1. Follow the guidelines in *note Adding Code::, concerning coding + style, submission of diffs, and so on. + + 2. When doing a port, bear in mind that your code must coexist + peacefully with the rest of `gawk' and the other ports. Avoid + gratuitous changes to the system-independent parts of the code. If + at all possible, avoid sprinkling `#ifdef's just for your port + throughout the code. + + If the changes needed for a particular system affect too much of + the code, I probably will not accept them. In such a case, you + can, of course, distribute your changes on your own, as long as + you comply with the GPL (*note Copying::). + + 3. A number of the files that come with `gawk' are maintained by other + people at the Free Software Foundation. Thus, you should not + change them unless it is for a very good reason; i.e., changes are + not out of the question, but changes to these files are + scrutinized extra carefully. The files are `getopt.h', + `getopt.c', `getopt1.c', `regex.h', `regex.c', `regcomp.c', + `regex_internal.c', `regex_internal.h', `regexec.c', `dfa.h', + `dfa.c', `install-sh', and `mkinstalldirs'. + + 4. Be willing to continue to maintain the port. Non-Unix operating + systems are supported by volunteers who maintain the code needed + to compile and run `gawk' on their systems. If noone volunteers to + maintain a port, it becomes unsupported and it may be necessary to + remove it from the distribution. + + 5. Supply an appropriate `gawkmisc.???' file. Each port has its own + `gawkmisc.???' that implements certain operating system specific + functions. This is cleaner than a plethora of `#ifdef's scattered + throughout the code. The `gawkmisc.c' in the main source + directory includes the appropriate `gawkmisc.???' file from each + subdirectory. Be sure to update it as well. + + Each port's `gawkmisc.???' file has a suffix reminiscent of the + machine or operating system for the port--for example, + `pc/gawkmisc.pc' and `vms/gawkmisc.vms'. The use of separate + suffixes, instead of plain `gawkmisc.c', makes it possible to move + files from a port's subdirectory into the main subdirectory, + without accidentally destroying the real `gawkmisc.c' file. + (Currently, this is only an issue for the PC operating system + ports.) + + 6. Supply a `Makefile' as well as any other C source and header files + that are necessary for your operating system. All your code + should be in a separate subdirectory, with a name that is the same + as, or reminiscent of, either your operating system or the + computer system. If possible, try to structure things so that it + is not necessary to move files out of the subdirectory into the + main source directory. If that is not possible, then be sure to + avoid using names for your files that duplicate the names of files + in the main source directory. + + 7. Update the documentation. Please write a section (or sections) + for this Info file describing the installation and compilation + steps needed to compile and/or install `gawk' for your system. + + 8. Be prepared to sign the appropriate paperwork. In order for the + FSF to distribute your code, you must either place your code in + the public domain and submit a signed statement to that effect, or + assign the copyright in your code to the FSF. Both of these + actions are easy to do and _many_ people have done so already. If + you have questions, please contact me, or <gnu@gnu.org>. + + Following these steps makes it much easier to integrate your changes +into `gawk' and have them coexist happily with other operating systems' +code that is already there. + + In the code that you supply and maintain, feel free to use a coding +style and brace layout that suits your taste. + + +File: gawk.info, Node: Dynamic Extensions, Next: Future Extensions, Prev: Additions, Up: Notes + +C.3 Adding New Built-in Functions to `gawk' +=========================================== + + Danger Will Robinson! Danger!! + Warning! Warning! + The Robot + + Beginning with `gawk' 3.1, it is possible to add new built-in +functions to `gawk' using dynamically loaded libraries. This facility +is available on systems (such as GNU/Linux) that support the `dlopen' +and `dlsym' functions. This minor node describes how to write and use +dynamically loaded extensions for `gawk'. Experience with programming +in C or C++ is necessary when reading this minor node. + + *Caution:* The facilities described in this minor node are very much +subject to change in a future `gawk' release. Be aware that you may +have to re-do everything, perhaps from scratch, at some future time. + + *Caution:* If you have written your own dynamic extensions, be sure +to recompile them for each new `gawk' release. There is no guarantee +of binary compatibility between different releases, nor will there ever +be such a guarantee. + +* Menu: + +* Internals:: A brief look at some `gawk' internals. +* Sample Library:: A example of new functions. + + +File: gawk.info, Node: Internals, Next: Sample Library, Up: Dynamic Extensions + +C.3.1 A Minimal Introduction to `gawk' Internals +------------------------------------------------ + +The truth is that `gawk' was not designed for simple extensibility. +The facilities for adding functions using shared libraries work, but +are something of a "bag on the side." Thus, this tour is brief and +simplistic; would-be `gawk' hackers are encouraged to spend some time +reading the source code before trying to write extensions based on the +material presented here. Of particular note are the files `awk.h', +`builtin.c', and `eval.c'. Reading `awkgram.y' in order to see how the +parse tree is built would also be of use. + + With the disclaimers out of the way, the following types, structure +members, functions, and macros are declared in `awk.h' and are of use +when writing extensions. The next minor node shows how they are used: + +`AWKNUM' + An `AWKNUM' is the internal type of `awk' floating-point numbers. + Typically, it is a C `double'. + +`NODE' + Just about everything is done using objects of type `NODE'. These + contain both strings and numbers, as well as variables and arrays. + +`AWKNUM force_number(NODE *n)' + This macro forces a value to be numeric. It returns the actual + numeric value contained in the node. It may end up calling an + internal `gawk' function. + +`void force_string(NODE *n)' + This macro guarantees that a `NODE''s string value is current. It + may end up calling an internal `gawk' function. It also + guarantees that the string is zero-terminated. + +`size_t get_curfunc_arg_count(void)' + This function returns the actual number of parameters passed to + the current function. Inside the code of an extension this can be + used to determine the maximum index which is safe to use with + `stack_ptr'. If this value is greater than `tree->param_cnt', the + function was called incorrectly from the `awk' program. + + *Caution:* This function is new as of `gawk' 3.1.4. + +`n->param_cnt' + Inside an extension function, this is the maximum number of + expected parameters, as set by the `make_builtin' function. + +`n->stptr' +`n->stlen' + The data and length of a `NODE''s string value, respectively. The + string is _not_ guaranteed to be zero-terminated. If you need to + pass the string value to a C library function, save the value in + `n->stptr[n->stlen]', assign `'\0'' to it, call the routine, and + then restore the value. + +`n->type' + The type of the `NODE'. This is a C `enum'. Values should be + either `Node_var' or `Node_var_array' for function parameters. + +`n->vname' + The "variable name" of a node. This is not of much use inside + externally written extensions. + +`void assoc_clear(NODE *n)' + Clears the associative array pointed to by `n'. Make sure that + `n->type == Node_var_array' first. + +`NODE **assoc_lookup(NODE *symbol, NODE *subs, int reference)' + Finds, and installs if necessary, array elements. `symbol' is the + array, `subs' is the subscript. This is usually a value created + with `tmp_string' (see below). `reference' should be `TRUE' if it + is an error to use the value before it is created. Typically, + `FALSE' is the correct value to use from extension functions. + +`NODE *make_string(char *s, size_t len)' + Take a C string and turn it into a pointer to a `NODE' that can be + stored appropriately. This is permanent storage; understanding of + `gawk' memory management is helpful. + +`NODE *make_number(AWKNUM val)' + Take an `AWKNUM' and turn it into a pointer to a `NODE' that can + be stored appropriately. This is permanent storage; understanding + of `gawk' memory management is helpful. + +`NODE *tmp_string(char *s, size_t len);' + Take a C string and turn it into a pointer to a `NODE' that can be + stored appropriately. This is temporary storage; understanding of + `gawk' memory management is helpful. + +`NODE *tmp_number(AWKNUM val)' + Take an `AWKNUM' and turn it into a pointer to a `NODE' that can + be stored appropriately. This is temporary storage; understanding + of `gawk' memory management is helpful. + +`NODE *dupnode(NODE *n)' + Duplicate a node. In most cases, this increments an internal + reference count instead of actually duplicating the entire `NODE'; + understanding of `gawk' memory management is helpful. + +`void free_temp(NODE *n)' + This macro releases the memory associated with a `NODE' allocated + with `tmp_string' or `tmp_number'. Understanding of `gawk' memory + management is helpful. + +`void make_builtin(char *name, NODE *(*func)(NODE *), int count)' + Register a C function pointed to by `func' as new built-in + function `name'. `name' is a regular C string. `count' is the + maximum number of arguments that the function takes. The function + should be written in the following manner: + + /* do_xxx --- do xxx function for gawk */ + + NODE * + do_xxx(NODE *tree) + { + ... + } + +`NODE *get_argument(NODE *tree, int i)' + This function is called from within a C extension function to get + the `i'-th argument from the function call. The first argument is + argument zero. + +`NODE *get_actual_argument(NODE *tree, unsigned int i,' +` int optional, int wantarray);' + This function retrieves a particular argument `i'. `wantarray' is + `TRUE' if the argument should be an array, `FALSE' otherwise. If + `optional' is `TRUE', the argument need not have been supplied. + If it wasn't, the return value is `NULL'. It is a fatal error if + `optional' is `TRUE' but the argument was not provided. + + *Caution:* This function is new as of `gawk' 3.1.4. + +`get_scalar_argument(t, i, opt)' + This is a convenience macro that calls `get_actual_argument'. + + *Caution:* This macro is new as of `gawk' 3.1.4. + +`get_array_argument(t, i, opt)' + This is a convenience macro that calls `get_actual_argument'. + + *Caution:* This macro is new as of `gawk' 3.1.4. + +`void set_value(NODE *tree)' + This function is called from within a C extension function to set + the return value from the extension function. This value is what + the `awk' program sees as the return value from the new `awk' + function. + +`void update_ERRNO(void)' + This function is called from within a C extension function to set + the value of `gawk''s `ERRNO' variable, based on the current value + of the C `errno' variable. It is provided as a convenience. + +`void update_ERRNO_saved(int errno_saved)' + This function is called from within a C extension function to set + the value of `gawk''s `ERRNO' variable, based on the saved value + of the C `errno' variable provided as the argument. It is + provided as a convenience. + + *Caution:* This function is new as of `gawk' 3.1.5. + +`void register_deferred_variable(const char *name, NODE *(*load_func)(void))' + This function is called to register a function to be called when a + reference to an undefined variable with the given name is + encountered. The callback function will never be called if the + variable exists already, so, unless the calling code is running at + program startup, it should first check whether a variable of the + given name already exists. The argument function must return a + pointer to a NODE containing the newly created variable. This + function is used to implement the builtin `ENVIRON' and `PROCINFO' + variables, so you can refer to them for examples. + + *Caution:* This function is new as of `gawk' 3.1.5. + +`void register_open_hook(void *(*open_func)(IOBUF *))' + This function is called to register a function to be called + whenever a new data file is opened, leading to the creation of an + `IOBUF' structure in `iop_alloc'. After creating the new `IOBUF', + `iop_alloc' will call (in reverse order of registration, so the + last function registered is called first) each open hook until one + returns non-NULL. If any hook returns a non-NULL value, that + value is assigned to the `IOBUF''s `opaque' field (which will + presumably point to a structure containing additional state + associated with the input processing), and no further open hooks + are called. + + The function called will most likely want to set the `IOBUF' + `get_record' method to indicate that future input records should + be retrieved by calling that method instead of using the standard + `gawk' input processing. + + And the function will also probably want to set the `IOBUF' + `close_func' method to be called when the file is closed to clean + up any state associated with the input. + + Finally, hook functions should be prepared to receive an `IOBUF' + structure where the `fd' field is set to `INVALID_HANDLE', meaning + that `gawk' was not able to open the file itself. In this case, + the hook function must be able to successfully open the file and + place a valid file descriptor there. + + Currently, for example, the hook function facility is used to + implement the XML parser shared library extension. For more info, + please look in `awk.h' and in `io.c'. + + *Caution:* This function is new as of `gawk' 3.1.5. + + An argument that is supposed to be an array needs to be handled with +some extra code, in case the array being passed in is actually from a +function parameter. + + In versions of `gawk' up to and including 3.1.2, the following +boilerplate code shows how to do this: + + NODE *the_arg; + + the_arg = get_argument(tree, 2); /* assume need 3rd arg, 0-based */ + + /* if a parameter, get it off the stack */ + if (the_arg->type == Node_param_list) + the_arg = stack_ptr[the_arg->param_cnt]; + + /* parameter referenced an array, get it */ + if (the_arg->type == Node_array_ref) + the_arg = the_arg->orig_array; + + /* check type */ + if (the_arg->type != Node_var && the_arg->type != Node_var_array) + fatal("newfunc: third argument is not an array"); + + /* force it to be an array, if necessary, clear it */ + the_arg->type = Node_var_array; + assoc_clear(the_arg); + + For versions 3.1.3 and later, the internals changed. In particular, +the interface was actually _simplified_ drastically. The following +boilerplate code now suffices: + + NODE *the_arg; + + the_arg = get_argument(tree, 2); /* assume need 3rd arg, 0-based */ + + /* force it to be an array: */ + the_arg = get_array(the_arg); + + /* if necessary, clear it: */ + assoc_clear(the_arg); + + As of version 3.1.4, the internals improved again, and became even +simpler: + + NODE *the_arg; + + the_arg = get_array_argument(tree, 2, FALSE); /* assume need 3rd arg, 0-based */ + + Again, you should spend time studying the `gawk' internals; don't +just blindly copy this code. + + +File: gawk.info, Node: Sample Library, Prev: Internals, Up: Dynamic Extensions + +C.3.2 Directory and File Operation Built-ins +-------------------------------------------- + +Two useful functions that are not in `awk' are `chdir' (so that an +`awk' program can change its directory) and `stat' (so that an `awk' +program can gather information about a file). This minor node +implements these functions for `gawk' in an external extension library. + +* Menu: + +* Internal File Description:: What the new functions will do. +* Internal File Ops:: The code for internal file operations. +* Using Internal File Ops:: How to use an external extension. + + +File: gawk.info, Node: Internal File Description, Next: Internal File Ops, Up: Sample Library + +C.3.2.1 Using `chdir' and `stat' +................................ + +This minor node shows how to use the new functions at the `awk' level +once they've been integrated into the running `gawk' interpreter. +Using `chdir' is very straightforward. It takes one argument, the new +directory to change to: + + ... + newdir = "/home/arnold/funstuff" + ret = chdir(newdir) + if (ret < 0) { + printf("could not change to %s: %s\n", + newdir, ERRNO) > "/dev/stderr" + exit 1 + } + ... + + The return value is negative if the `chdir' failed, and `ERRNO' +(*note Built-in Variables::) is set to a string indicating the error. + + Using `stat' is a bit more complicated. The C `stat' function fills +in a structure that has a fair amount of information. The right way to +model this in `awk' is to fill in an associative array with the +appropriate information: + + file = "/home/arnold/.profile" + fdata[1] = "x" # force `fdata' to be an array + ret = stat(file, fdata) + if (ret < 0) { + printf("could not stat %s: %s\n", + file, ERRNO) > "/dev/stderr" + exit 1 + } + printf("size of %s is %d bytes\n", file, fdata["size"]) + + The `stat' function always clears the data array, even if the `stat' +fails. It fills in the following elements: + +`"name"' + The name of the file that was `stat''ed. + +`"dev"' +`"ino"' + The file's device and inode numbers, respectively. + +`"mode"' + The file's mode, as a numeric value. This includes both the file's + type and its permissions. + +`"nlink"' + The number of hard links (directory entries) the file has. + +`"uid"' +`"gid"' + The numeric user and group ID numbers of the file's owner. + +`"size"' + The size in bytes of the file. + +`"blocks"' + The number of disk blocks the file actually occupies. This may not + be a function of the file's size if the file has holes. + +`"atime"' +`"mtime"' +`"ctime"' + The file's last access, modification, and inode update times, + respectively. These are numeric timestamps, suitable for + formatting with `strftime' (*note Built-in::). + +`"pmode"' + The file's "printable mode." This is a string representation of + the file's type and permissions, such as what is produced by `ls + -l'--for example, `"drwxr-xr-x"'. + +`"type"' + A printable string representation of the file's type. The value + is one of the following: + + `"blockdev"' + `"chardev"' + The file is a block or character device ("special file"). + + `"directory"' + The file is a directory. + + `"fifo"' + The file is a named-pipe (also known as a FIFO). + + `"file"' + The file is just a regular file. + + `"socket"' + The file is an `AF_UNIX' ("Unix domain") socket in the + filesystem. + + `"symlink"' + The file is a symbolic link. + + Several additional elements may be present depending upon the +operating system and the type of the file. You can test for them in +your `awk' program by using the `in' operator (*note Reference to +Elements::): + +`"blksize"' + The preferred block size for I/O to the file. This field is not + present on all POSIX-like systems in the C `stat' structure. + +`"linkval"' + If the file is a symbolic link, this element is the name of the + file the link points to (i.e., the value of the link). + +`"rdev"' +`"major"' +`"minor"' + If the file is a block or character device file, then these values + represent the numeric device number and the major and minor + components of that number, respectively. + + +File: gawk.info, Node: Internal File Ops, Next: Using Internal File Ops, Prev: Internal File Description, Up: Sample Library + +C.3.2.2 C Code for `chdir' and `stat' +..................................... + +Here is the C code for these extensions. They were written for +GNU/Linux. The code needs some more work for complete portability to +other POSIX-compliant systems:(1) + + #include "awk.h" + + #include <sys/sysmacros.h> + + /* do_chdir --- provide dynamically loaded + chdir() builtin for gawk */ + + static NODE * + do_chdir(tree) + NODE *tree; + { + NODE *newdir; + int ret = -1; + + if (do_lint && get_curfunc_arg_count() != 1) + lintwarn("chdir: called with incorrect number of arguments"); + + newdir = get_scalar_argument(tree, 0); + + The file includes the `"awk.h"' header file for definitions for the +`gawk' internals. It includes `<sys/sysmacros.h>' for access to the +`major' and `minor' macros. + + By convention, for an `awk' function `foo', the function that +implements it is called `do_foo'. The function should take a `NODE *' +argument, usually called `tree', that represents the argument list to +the function. The `newdir' variable represents the new directory to +change to, retrieved with `get_argument'. Note that the first argument +is numbered zero. + + This code actually accomplishes the `chdir'. It first forces the +argument to be a string and passes the string value to the `chdir' +system call. If the `chdir' fails, `ERRNO' is updated. The result of +`force_string' has to be freed with `free_temp': + + (void) force_string(newdir); + ret = chdir(newdir->stptr); + if (ret < 0) + update_ERRNO(); + free_temp(newdir); + + Finally, the function returns the return value to the `awk' level, +using `set_value'. Then it must return a value from the call to the new +built-in (this value ignored by the interpreter): + + /* Set the return value */ + set_value(tmp_number((AWKNUM) ret)); + + /* Just to make the interpreter happy */ + return tmp_number((AWKNUM) 0); + } + + The `stat' built-in is more involved. First comes a function that +turns a numeric mode into a printable representation (e.g., 644 becomes +`-rw-r--r--'). This is omitted here for brevity: + + /* format_mode --- turn a stat mode field + into something readable */ + + static char * + format_mode(fmode) + unsigned long fmode; + { + ... + } + + Next comes the actual `do_stat' function itself. First come the +variable declarations and argument checking: + + /* do_stat --- provide a stat() function for gawk */ + + static NODE * + do_stat(tree) + NODE *tree; + { + NODE *file, *array; + struct stat sbuf; + int ret; + NODE **aptr; + char *pmode; /* printable mode */ + char *type = "unknown"; + + + if (do_lint && get_curfunc_arg_count() > 2) + lintwarn("stat: called with too many arguments"); + + Then comes the actual work. First, we get the arguments. Then, we +always clear the array. To get the file information, we use `lstat', +in case the file is a symbolic link. If there's an error, we set +`ERRNO' and return: + + /* directory is first arg, array to hold results is second */ + file = get_scalar_argument(tree, 0, FALSE); + array = get_array_argument(tree, 1, FALSE); + + /* empty out the array */ + assoc_clear(array); + + /* lstat the file, if error, set ERRNO and return */ + (void) force_string(file); + ret = lstat(file->stptr, & sbuf); + if (ret < 0) { + update_ERRNO(); + + set_value(tmp_number((AWKNUM) ret)); + + free_temp(file); + return tmp_number((AWKNUM) 0); + } + + Now comes the tedious part: filling in the array. Only a few of the +calls are shown here, since they all follow the same pattern: + + /* fill in the array */ + aptr = assoc_lookup(array, tmp_string("name", 4), FALSE); + *aptr = dupnode(file); + + aptr = assoc_lookup(array, tmp_string("mode", 4), FALSE); + *aptr = make_number((AWKNUM) sbuf.st_mode); + + aptr = assoc_lookup(array, tmp_string("pmode", 5), FALSE); + pmode = format_mode(sbuf.st_mode); + *aptr = make_string(pmode, strlen(pmode)); + + When done, we free the temporary value containing the file name, set +the return value, and return: + + free_temp(file); + + /* Set the return value */ + set_value(tmp_number((AWKNUM) ret)); + + /* Just to make the interpreter happy */ + return tmp_number((AWKNUM) 0); + } + + Finally, it's necessary to provide the "glue" that loads the new +function(s) into `gawk'. By convention, each library has a routine +named `dlload' that does the job: + + /* dlload --- load new builtins in this library */ + + NODE * + dlload(tree, dl) + NODE *tree; + void *dl; + { + make_builtin("chdir", do_chdir, 1); + make_builtin("stat", do_stat, 2); + return tmp_number((AWKNUM) 0); + } + + And that's it! As an exercise, consider adding functions to +implement system calls such as `chown', `chmod', and `umask'. + + ---------- Footnotes ---------- + + (1) This version is edited slightly for presentation. The complete +version can be found in `extension/filefuncs.c' in the `gawk' +distribution. + + +File: gawk.info, Node: Using Internal File Ops, Prev: Internal File Ops, Up: Sample Library + +C.3.2.3 Integrating the Extensions +.................................. + +Now that the code is written, it must be possible to add it at runtime +to the running `gawk' interpreter. First, the code must be compiled. +Assuming that the functions are in a file named `filefuncs.c', and IDIR +is the location of the `gawk' include files, the following steps create +a GNU/Linux shared library: + + $ gcc -shared -DHAVE_CONFIG_H -c -O -g -IIDIR filefuncs.c + $ ld -o filefuncs.so -shared filefuncs.o + + Once the library exists, it is loaded by calling the `extension' +built-in function. This function takes two arguments: the name of the +library to load and the name of a function to call when the library is +first loaded. This function adds the new functions to `gawk'. It +returns the value returned by the initialization function within the +shared library: + + # file testff.awk + BEGIN { + extension("./filefuncs.so", "dlload") + + chdir(".") # no-op + + data[1] = 1 # force `data' to be an array + print "Info for testff.awk" + ret = stat("testff.awk", data) + print "ret =", ret + for (i in data) + printf "data[\"%s\"] = %s\n", i, data[i] + print "testff.awk modified:", + strftime("%m %d %y %H:%M:%S", data["mtime"]) + } + + Here are the results of running the program: + + $ gawk -f testff.awk + -| Info for testff.awk + -| ret = 0 + -| data["blksize"] = 4096 + -| data["mtime"] = 932361936 + -| data["mode"] = 33188 + -| data["type"] = file + -| data["dev"] = 2065 + -| data["gid"] = 10 + -| data["ino"] = 878597 + -| data["ctime"] = 971431797 + -| data["blocks"] = 2 + -| data["nlink"] = 1 + -| data["name"] = testff.awk + -| data["atime"] = 971608519 + -| data["pmode"] = -rw-r--r-- + -| data["size"] = 607 + -| data["uid"] = 2076 + -| testff.awk modified: 07 19 99 08:25:36 + + +File: gawk.info, Node: Future Extensions, Prev: Dynamic Extensions, Up: Notes + +C.4 Probable Future Extensions +============================== + + AWK is a language similar to PERL, only considerably more elegant. + Arnold Robbins + + Hey! + Larry Wall + + This minor node briefly lists extensions and possible improvements +that indicate the directions we are currently considering for `gawk'. +The file `FUTURES' in the `gawk' distribution lists these extensions as +well. + + Following is a list of probable future changes visible at the `awk' +language level: + +Loadable module interface + It is not clear that the `awk'-level interface to the modules + facility is as good as it should be. The interface needs to be + redesigned, particularly taking namespace issues into account, as + well as possibly including issues such as library search path order + and versioning. + +`RECLEN' variable for fixed-length records + Along with `FIELDWIDTHS', this would speed up the processing of + fixed-length records. `PROCINFO["RS"]' would be `"RS"' or + `"RECLEN"', depending upon which kind of record processing is in + effect. + +Additional `printf' specifiers + The 1999 ISO C standard added a number of additional `printf' + format specifiers. These should be evaluated for possible + inclusion in `gawk'. + +Databases + It may be possible to map a GDBM/NDBM/SDBM file into an `awk' + array. + +More `lint' warnings + There are more things that could be checked for portability. + + Following is a list of probable improvements that will make `gawk''s +source code easier to work with: + +Loadable module mechanics + The current extension mechanism works (*note Dynamic Extensions::), + but is rather primitive. It requires a fair amount of manual work + to create and integrate a loadable module. Nor is the current + mechanism as portable as might be desired. The GNU `libtool' + package provides a number of features that would make using + loadable modules much easier. `gawk' should be changed to use + `libtool'. + +Loadable module internals + The API to its internals that `gawk' "exports" should be revised. + Too many things are needlessly exposed. A new API should be + designed and implemented to make module writing easier. + +Better array subscript management + `gawk''s management of array subscript storage could use revamping, + so that using the same value to index multiple arrays only stores + one copy of the index value. + +Integrating the DBUG library + Integrating Fred Fish's DBUG library would be helpful during + development, but it's a lot of work to do. + + Following is a list of probable improvements that will make `gawk' +perform better: + +Compilation of `awk' programs + `gawk' uses a Bison (YACC-like) parser to convert the script given + it into a syntax tree; the syntax tree is then executed by a + simple recursive evaluator. This method incurs a lot of overhead, + since the recursive evaluator performs many procedure calls to do + even the simplest things. + + It should be possible for `gawk' to convert the script's parse tree + into a C program which the user would then compile, using the + normal C compiler and a special `gawk' library to provide all the + needed functions (regexps, fields, associative arrays, type + coercion, and so on). + + An easier possibility might be for an intermediate phase of `gawk' + to convert the parse tree into a linear byte code form like the + one used in GNU Emacs Lisp. The recursive evaluator would then be + replaced by a straight line byte code interpreter that would be + intermediate in speed between running a compiled program and doing + what `gawk' does now. + + Finally, the programs in the test suite could use documenting in +this Info file. + + *Note Additions::, if you are interested in tackling any of these +projects. + + +File: gawk.info, Node: Basic Concepts, Next: Glossary, Prev: Notes, Up: Top + +Appendix D Basic Programming Concepts +************************************* + +This major node attempts to define some of the basic concepts and terms +that are used throughout the rest of this Info file. As this Info file +is specifically about `awk', and not about computer programming in +general, the coverage here is by necessity fairly cursory and +simplistic. (If you need more background, there are many other +introductory texts that you should refer to instead.) + +* Menu: + +* Basic High Level:: The high level view. +* Basic Data Typing:: A very quick intro to data types. +* Floating Point Issues:: Stuff to know about floating-point numbers. + + +File: gawk.info, Node: Basic High Level, Next: Basic Data Typing, Up: Basic Concepts + +D.1 What a Program Does +======================= + +At the most basic level, the job of a program is to process some input +data and produce results. + + _______ + +------+ / \ +---------+ + | Data | -----> < Program > -----> | Results | + +------+ \_______/ +---------+ + + The "program" in the figure can be either a compiled program(1) +(such as `ls'), or it may be "interpreted". In the latter case, a +machine-executable program such as `awk' reads your program, and then +uses the instructions in your program to process the data. + + When you write a program, it usually consists of the following, very +basic set of steps: + + ______ + +----------------+ / More \ No +----------+ + | Initialization | -------> < Data > -------> | Clean Up | + +----------------+ ^ \ ? / +----------+ + | +--+-+ + | | Yes + | | + | V + | +---------+ + +-----+ Process | + +---------+ + +Initialization + These are the things you do before actually starting to process + data, such as checking arguments, initializing any data you need + to work with, and so on. This step corresponds to `awk''s `BEGIN' + rule (*note BEGIN/END::). + + If you were baking a cake, this might consist of laying out all the + mixing bowls and the baking pan, and making sure you have all the + ingredients that you need. + +Processing + This is where the actual work is done. Your program reads data, + one logical chunk at a time, and processes it as appropriate. + + In most programming languages, you have to manually manage the + reading of data, checking to see if there is more each time you + read a chunk. `awk''s pattern-action paradigm (*note Getting + Started::) handles the mechanics of this for you. + + In baking a cake, the processing corresponds to the actual labor: + breaking eggs, mixing the flour, water, and other ingredients, and + then putting the cake into the oven. + +Clean Up + Once you've processed all the data, you may have things you need to + do before exiting. This step corresponds to `awk''s `END' rule + (*note BEGIN/END::). + + After the cake comes out of the oven, you still have to wrap it in + plastic wrap to keep anyone from tasting it, as well as wash the + mixing bowls and utensils. + + An "algorithm" is a detailed set of instructions necessary to +accomplish a task, or process data. It is much the same as a recipe +for baking a cake. Programs implement algorithms. Often, it is up to +you to design the algorithm and implement it, simultaneously. + + The "logical chunks" we talked about previously are called "records", +similar to the records a company keeps on employees, a school keeps for +students, or a doctor keeps for patients. Each record has many +component parts, such as first and last names, date of birth, address, +and so on. The component parts are referred to as the "fields" of the +record. + + The act of reading data is termed "input", and that of generating +results, not too surprisingly, is termed "output". They are often +referred to together as "input/output," and even more often, as "I/O" +for short. (You will also see "input" and "output" used as verbs.) + + `awk' manages the reading of data for you, as well as the breaking +it up into records and fields. Your program's job is to tell `awk' +what to with the data. You do this by describing "patterns" in the +data to look for, and "actions" to execute when those patterns are +seen. This "data-driven" nature of `awk' programs usually makes them +both easier to write and easier to read. + + ---------- Footnotes ---------- + + (1) Compiled programs are typically written in lower-level languages +such as C, C++, Fortran, or Ada, and then translated, or "compiled", +into a form that the computer can execute directly. + + +File: gawk.info, Node: Basic Data Typing, Next: Floating Point Issues, Prev: Basic High Level, Up: Basic Concepts + +D.2 Data Values in a Computer +============================= + +In a program, you keep track of information and values in things called +"variables". A variable is just a name for a given value, such as +`first_name', `last_name', `address', and so on. `awk' has several +predefined variables, and it has special names to refer to the current +input record and the fields of the record. You may also group multiple +associated values under one name, as an array. + + Data, particularly in `awk', consists of either numeric values, such +as 42 or 3.1415927, or string values. String values are essentially +anything that's not a number, such as a name. Strings are sometimes +referred to as "character data", since they store the individual +characters that comprise them. Individual variables, as well as +numeric and string variables, are referred to as "scalar" values. +Groups of values, such as arrays, are not scalars. + + Within computers, there are two kinds of numeric values: "integers" +and "floating-point". In school, integer values were referred to as +"whole" numbers--that is, numbers without any fractional part, such as +1, 42, or -17. The advantage to integer numbers is that they represent +values exactly. The disadvantage is that their range is limited. On +most modern systems, this range is -2,147,483,648 to 2,147,483,647. + + Integer values come in two flavors: "signed" and "unsigned". Signed +values may be negative or positive, with the range of values just +described. Unsigned values are always positive. On most modern +systems, the range is from 0 to 4,294,967,295. + + Floating-point numbers represent what are called "real" numbers; +i.e., those that do have a fractional part, such as 3.1415927. The +advantage to floating-point numbers is that they can represent a much +larger range of values. The disadvantage is that there are numbers +that they cannot represent exactly. `awk' uses "double-precision" +floating-point numbers, which can hold more digits than +"single-precision" floating-point numbers. Floating-point issues are +discussed more fully in *note Floating Point Issues::. + + At the very lowest level, computers store values as groups of binary +digits, or "bits". Modern computers group bits into groups of eight, +called "bytes". Advanced applications sometimes have to manipulate +bits directly, and `gawk' provides functions for doing so. + + While you are probably used to the idea of a number without a value +(i.e., zero), it takes a bit more getting used to the idea of +zero-length character data. Nevertheless, such a thing exists. It is +called the "null string". The null string is character data that has +no value. In other words, it is empty. It is written in `awk' programs +like this: `""'. + + Humans are used to working in decimal; i.e., base 10. In base 10, +numbers go from 0 to 9, and then "roll over" into the next column. +(Remember grade school? 42 is 4 times 10 plus 2.) + + There are other number bases though. Computers commonly use base 2 +or "binary", base 8 or "octal", and base 16 or "hexadecimal". In +binary, each column represents two times the value in the column to its +right. Each column may contain either a 0 or a 1. Thus, binary 1010 +represents 1 times 8, plus 0 times 4, plus 1 times 2, plus 0 times 1, +or decimal 10. Octal and hexadecimal are discussed more in *note +Nondecimal-numbers::. + + Programs are written in programming languages. Hundreds, if not +thousands, of programming languages exist. One of the most popular is +the C programming language. The C language had a very strong influence +on the design of the `awk' language. + + There have been several versions of C. The first is often referred +to as "K&R" C, after the initials of Brian Kernighan and Dennis Ritchie, +the authors of the first book on C. (Dennis Ritchie created the +language, and Brian Kernighan was one of the creators of `awk'.) + + In the mid-1980s, an effort began to produce an international +standard for C. This work culminated in 1989, with the production of +the ANSI standard for C. This standard became an ISO standard in 1990. +Where it makes sense, POSIX `awk' is compatible with 1990 ISO C. + + In 1999, a revised ISO C standard was approved and released. Future +versions of `gawk' will be as compatible as possible with this standard. + + +File: gawk.info, Node: Floating Point Issues, Prev: Basic Data Typing, Up: Basic Concepts + +D.3 Floating-Point Number Caveats +================================= + +As mentioned earlier, floating-point numbers represent what are called +"real" numbers, i.e., those that have a fractional part. `awk' uses +double-precision floating-point numbers to represent all numeric +values. This minor node describes some of the issues involved in using +floating-point numbers. + + There is a very nice paper on floating-point arithmetic by David +Goldberg, "What Every Computer Scientist Should Know About +Floating-point Arithmetic," `ACM Computing Surveys' *23*, 1 (1991-03), +5-48.(1) This is worth reading if you are interested in the details, +but it does require a background in computer science. + +* Menu: + +* String Conversion Precision:: The String Value Can Lie. +* Unexpected Results:: Floating Point Numbers Are Not + Abstract Numbers. +* POSIX Floating Point Problems:: Standards Versus Existing Practice. + + ---------- Footnotes ---------- + + (1) `http://www.validlab.com/goldberg/paper.ps'. + + +File: gawk.info, Node: String Conversion Precision, Next: Unexpected Results, Up: Floating Point Issues + +D.3.1 The String Value Can Lie +------------------------------ + +Internally, `awk' keeps both the numeric value (double-precision +floating-point) and the string value for a variable. Separately, `awk' +keeps track of what type the variable has (*note Typing and +Comparison::), which plays a role in how variables are used in +comparisons. + + It is important to note that the string value for a number may not +reflect the full value (all the digits) that the numeric value actually +contains. The following program (`values.awk') illustrates this: + + { + $1 = $2 + $3 + # see it for what it is + printf("$1 = %.12g\n", $1) + # use CONVFMT + a = "<" $1 ">" + print "a =", a + # use OFMT + print "$1 =", $1 + } + +This program shows the full value of the sum of `$2' and `$3' using +`printf', and then prints the string values obtained from both +automatic conversion (via `CONVFMT') and from printing (via `OFMT'). + + Here is what happens when the program is run: + + $ echo 2 3.654321 1.2345678 | awk -f values.awk + -| $1 = 4.8888888 + -| a = <4.88889> + -| $1 = 4.88889 + + This makes it clear that the full numeric value is different from +what the default string representations show. + + `CONVFMT''s default value is `"%.6g"', which yields a value with at +least six significant digits. For some applications, you might want to +change it to specify more precision. On most modern machines, most of +the time, 17 digits is enough to capture a floating-point number's +value exactly.(1) + + ---------- Footnotes ---------- + + (1) Pathological cases can require up to 752 digits (!), but we +doubt that you need to worry about this. + + +File: gawk.info, Node: Unexpected Results, Next: POSIX Floating Point Problems, Prev: String Conversion Precision, Up: Floating Point Issues + +D.3.2 Floating Point Numbers Are Not Abstract Numbers +----------------------------------------------------- + +Unlike numbers in the abstract sense (such as what you studied in high +school or college math), numbers stored in computers are limited in +certain ways. They cannot represent an infinite number of digits, nor +can they always represent things exactly. In particular, +floating-point numbers cannot always represent values exactly. Here is +an example: + + $ awk '{ printf("%010d\n", $1 * 100) }' + 515.79 + -| 0000051579 + 515.80 + -| 0000051579 + 515.81 + -| 0000051580 + 515.82 + -| 0000051582 + Ctrl-d + +This shows that some values can be represented exactly, whereas others +are only approximated. This is not a "bug" in `awk', but simply an +artifact of how computers represent numbers. + + Another peculiarity of floating-point numbers on modern systems is +that they often have more than one representation for the number zero! +In particular, it is possible to represent "minus zero" as well as +regular, or "positive" zero. + + This example shows that negative and positive zero are distinct +values when stored internally, but that they are in fact equal to each +other, as well as to "regular" zero: + + $ gawk 'BEGIN { mz = -0 ; pz = 0 + > printf "-0 = %g, +0 = %g, (-0 == +0) -> %d\n", mz, pz, mz == pz + > printf "mz == 0 -> %d, pz == 0 -> %d\n", mz == 0, pz == 0 + > }' + -| -0 = -0, +0 = 0, (-0 == +0) -> 1 + -| mz == 0 -> 1, pz == 0 -> 1 + + It helps to keep this in mind should you process numeric data that +contains negative zero values; the fact that the zero is negative is +noted and can affect comparisons. + + +File: gawk.info, Node: POSIX Floating Point Problems, Prev: Unexpected Results, Up: Floating Point Issues + +D.3.3 Standards Versus Existing Practice +---------------------------------------- + +Historically, `awk' has converted any non-numeric looking string to the +numeric value zero, when required. Furthermore, the original +definition of the language and the original POSIX standards specified +that `awk' only understands decimal numbers (base 10), and not octal +(base 8) or hexadecimal numbers (base 16). + + As of this writing (February, 2007), changes in the language of the +current POSIX standard can be interpreted to imply that `awk' should +support additional features. These features are: + + * Interpretation of floating point data values specified in + hexadecimal notation (`0xDEADBEEF'). (Note: data values, _not_ + source code constants.) + + * Support for the special IEEE 754 floating point values "Not A + Number" (NaN), positive Infinity ("inf") and negative Infinity + ("-inf"). In particular, the format for these values is as + specified by the ISO C99 standard, which ignores case and can + allow machine-dependent additional characters after the `nan' and + allow either `inf' or `infinity'. + + The first problem is that both of these are clear changes to +historical practice: + + * The `gawk' maintainer feels that hexadecimal floating point + values, in particular, is ugly, and was never intended by the + original designers to be part of the language. + + * Allowing completely alphabetic strings to have valid numeric + values is also a very severe departure from historical practice. + + The second problem is that the `gawk' maintainer feels that this +interpretation of the standard, which requires a certain amount of +"language lawyering" to arrive at in the first place, was not intended +by the standard developers, either. In other words, "we see how you +got where you are, but we don't think that that's where you want to be." + + Nevertheless, on systems that support IEEE floating point, it seems +reasonable to provide _some_ way to support NaN and Infinity values. +The solution implemented in `gawk', as of version 3.1.6, is as follows: + + 1. With the `--posix' command-line option, `gawk' becomes "hands + off." String values are passed directly to the system library's + `strtod()' function, and if it successfuly returns a numeric value, + that is what's used. By definition, the results are not portable + across different systems.(1) They are also a little surprising: + + $ echo nanny | gawk --posix '{ print $1 + 0 }' + -| nan + $ echo 0xDeadBeef | gawk --posix '{ print $1 + 0 }' + -| 3735928559 + + 2. Without `--posix', `gawk' interprets the four strings `+inf', + `-inf', `+nan', and `-nan' specially, producing the corresponding + special numeric values. The leading sign acts a signal to `gawk' + (and the user) that the value is really numeric. Hexadecimal + floating point is not supported (unless you also use + `--non-decimal-data', which is _not_ recommended). For example: + + $ echo nanny | gawk '{ print $1 + 0 }' + -| 0 + $ echo +nan | gawk '{ print $1 + 0 }' + -| nan + $ echo 0xDeadBeef | gawk '{ print $1 + 0 }' + -| 0 + + `gawk' does ignore case distinction in the four special values. + Thus `+nan' and `+NaN' are the same. + + ---------- Footnotes ---------- + + (1) You asked for it, you got it. + + +File: gawk.info, Node: Glossary, Next: Copying, Prev: Basic Concepts, Up: Top + +Glossary +******** + +Action + A series of `awk' statements attached to a rule. If the rule's + pattern matches an input record, `awk' executes the rule's action. + Actions are always enclosed in curly braces. (*Note Action + Overview::.) + +Amazing `awk' Assembler + Henry Spencer at the University of Toronto wrote a retargetable + assembler completely as `sed' and `awk' scripts. It is thousands + of lines long, including machine descriptions for several eight-bit + microcomputers. It is a good example of a program that would have + been better written in another language. You can get it from + `ftp://ftp.freefriends.org/arnold/Awkstuff/aaa.tgz'. + +Amazingly Workable Formatter (`awf') + Henry Spencer at the University of Toronto wrote a formatter that + accepts a large subset of the `nroff -ms' and `nroff -man' + formatting commands, using `awk' and `sh'. It is available over + the Internet from + `ftp://ftp.freefriends.org/arnold/Awkstuff/awf.tgz'. + +Anchor + The regexp metacharacters `^' and `$', which force the match to + the beginning or end of the string, respectively. + +ANSI + The American National Standards Institute. This organization + produces many standards, among them the standards for the C and + C++ programming languages. These standards often become + international standards as well. See also "ISO." + +Array + A grouping of multiple values under the same name. Most languages + just provide sequential arrays. `awk' provides associative arrays. + +Assertion + A statement in a program that a condition is true at this point in + the program. Useful for reasoning about how a program is supposed + to behave. + +Assignment + An `awk' expression that changes the value of some `awk' variable + or data object. An object that you can assign to is called an + "lvalue". The assigned values are called "rvalues". *Note + Assignment Ops::. + +Associative Array + Arrays in which the indices may be numbers or strings, not just + sequential integers in a fixed range. + +`awk' Language + The language in which `awk' programs are written. + +`awk' Program + An `awk' program consists of a series of "patterns" and "actions", + collectively known as "rules". For each input record given to the + program, the program's rules are all processed in turn. `awk' + programs may also contain function definitions. + +`awk' Script + Another name for an `awk' program. + +Bash + The GNU version of the standard shell (the Bourne-Again SHell). + See also "Bourne Shell." + +BBS + See "Bulletin Board System." + +Bit + Short for "Binary Digit." All values in computer memory + ultimately reduce to binary digits: values that are either zero or + one. Groups of bits may be interpreted differently--as integers, + floating-point numbers, character data, addresses of other memory + objects, or other data. `awk' lets you work with floating-point + numbers and strings. `gawk' lets you manipulate bit values with + the built-in functions described in *note Bitwise Functions::. + + Computers are often defined by how many bits they use to represent + integer values. Typical systems are 32-bit systems, but 64-bit + systems are becoming increasingly popular, and 16-bit systems are + waning in popularity. + +Boolean Expression + Named after the English mathematician Boole. See also "Logical + Expression." + +Bourne Shell + The standard shell (`/bin/sh') on Unix and Unix-like systems, + originally written by Steven R. Bourne. Many shells (`bash', + `ksh', `pdksh', `zsh') are generally upwardly compatible with the + Bourne shell. + +Built-in Function + The `awk' language provides built-in functions that perform various + numerical, I/O-related, and string computations. Examples are + `sqrt' (for the square root of a number) and `substr' (for a + substring of a string). `gawk' provides functions for timestamp + management, bit manipulation, and runtime string translation. + (*Note Built-in::.) + +Built-in Variable + `ARGC', `ARGV', `CONVFMT', `ENVIRON', `FILENAME', `FNR', `FS', + `NF', `NR', `OFMT', `OFS', `ORS', `RLENGTH', `RSTART', `RS', and + `SUBSEP' are the variables that have special meaning to `awk'. In + addition, `ARGIND', `BINMODE', `ERRNO', `FIELDWIDTHS', + `IGNORECASE', `LINT', `PROCINFO', `RT', and `TEXTDOMAIN' are the + variables that have special meaning to `gawk'. Changing some of + them affects `awk''s running environment. (*Note Built-in + Variables::.) + +Braces + See "Curly Braces." + +Bulletin Board System + A computer system allowing users to log in and read and/or leave + messages for other users of the system, much like leaving paper + notes on a bulletin board. + +C + The system programming language that most GNU software is written + in. The `awk' programming language has C-like syntax, and this + Info file points out similarities between `awk' and C when + appropriate. + + In general, `gawk' attempts to be as similar to the 1990 version + of ISO C as makes sense. Future versions of `gawk' may adopt + features from the newer 1999 standard, as appropriate. + +C++ + A popular object-oriented programming language derived from C. + +Character Set + The set of numeric codes used by a computer system to represent the + characters (letters, numbers, punctuation, etc.) of a particular + country or place. The most common character set in use today is + ASCII (American Standard Code for Information Interchange). Many + European countries use an extension of ASCII known as ISO-8859-1 + (ISO Latin-1). + +CHEM + A preprocessor for `pic' that reads descriptions of molecules and + produces `pic' input for drawing them. It was written in `awk' by + Brian Kernighan and Jon Bentley, and is available from + `http://cm.bell-labs.com/netlib/typesetting/chem.gz'. + +Coprocess + A subordinate program with which two-way communications is + possible. + +Compiler + A program that translates human-readable source code into + machine-executable object code. The object code is then executed + directly by the computer. See also "Interpreter." + +Compound Statement + A series of `awk' statements, enclosed in curly braces. Compound + statements may be nested. (*Note Statements::.) + +Concatenation + Concatenating two strings means sticking them together, one after + another, producing a new string. For example, the string `foo' + concatenated with the string `bar' gives the string `foobar'. + (*Note Concatenation::.) + +Conditional Expression + An expression using the `?:' ternary operator, such as `EXPR1 ? + EXPR2 : EXPR3'. The expression EXPR1 is evaluated; if the result + is true, the value of the whole expression is the value of EXPR2; + otherwise the value is EXPR3. In either case, only one of EXPR2 + and EXPR3 is evaluated. (*Note Conditional Exp::.) + +Comparison Expression + A relation that is either true or false, such as `(a < b)'. + Comparison expressions are used in `if', `while', `do', and `for' + statements, and in patterns to select which input records to + process. (*Note Typing and Comparison::.) + +Curly Braces + The characters `{' and `}'. Curly braces are used in `awk' for + delimiting actions, compound statements, and function bodies. + +Dark Corner + An area in the language where specifications often were (or still + are) not clear, leading to unexpected or undesirable behavior. + Such areas are marked in this Info file with "(d.c.)" in the text + and are indexed under the heading "dark corner." + +Data Driven + A description of `awk' programs, where you specify the data you + are interested in processing, and what to do when that data is + seen. + +Data Objects + These are numbers and strings of characters. Numbers are + converted into strings and vice versa, as needed. (*Note + Conversion::.) + +Deadlock + The situation in which two communicating processes are each waiting + for the other to perform an action. + +Double-Precision + An internal representation of numbers that can have fractional + parts. Double-precision numbers keep track of more digits than do + single-precision numbers, but operations on them are sometimes + more expensive. This is the way `awk' stores numeric values. It + is the C type `double'. + +Dynamic Regular Expression + A dynamic regular expression is a regular expression written as an + ordinary expression. It could be a string constant, such as + `"foo"', but it may also be an expression whose value can vary. + (*Note Computed Regexps::.) + +Environment + A collection of strings, of the form NAME`='VAL, that each program + has available to it. Users generally place values into the + environment in order to provide information to various programs. + Typical examples are the environment variables `HOME' and `PATH'. + +Empty String + See "Null String." + +Epoch + The date used as the "beginning of time" for timestamps. Time + values in Unix systems are represented as seconds since the epoch, + with library functions available for converting these values into + standard date and time formats. + + The epoch on Unix and POSIX systems is 1970-01-01 00:00:00 UTC. + See also "GMT" and "UTC." + +Escape Sequences + A special sequence of characters used for describing nonprinting + characters, such as `\n' for newline or `\033' for the ASCII ESC + (Escape) character. (*Note Escape Sequences::.) + +FDL + See "Free Documentation License." + +Field + When `awk' reads an input record, it splits the record into pieces + separated by whitespace (or by a separator regexp that you can + change by setting the built-in variable `FS'). Such pieces are + called fields. If the pieces are of fixed length, you can use the + built-in variable `FIELDWIDTHS' to describe their lengths. (*Note + Field Separators::, and *note Constant Size::.) + +Flag + A variable whose truth value indicates the existence or + nonexistence of some condition. + +Floating-Point Number + Often referred to in mathematical terms as a "rational" or real + number, this is just a number that can have a fractional part. + See also "Double-Precision" and "Single-Precision." + +Format + Format strings are used to control the appearance of output in the + `strftime' and `sprintf' functions, and are used in the `printf' + statement as well. Also, data conversions from numbers to strings + are controlled by the format string contained in the built-in + variable `CONVFMT'. (*Note Control Letters::.) + +Free Documentation License + This document describes the terms under which this Info file is + published and may be copied. (*Note GNU Free Documentation + License::.) + +Function + A specialized group of statements used to encapsulate general or + program-specific tasks. `awk' has a number of built-in functions, + and also allows you to define your own. (*Note Functions::.) + +FSF + See "Free Software Foundation." + +Free Software Foundation + A nonprofit organization dedicated to the production and + distribution of freely distributable software. It was founded by + Richard M. Stallman, the author of the original Emacs editor. GNU + Emacs is the most widely used version of Emacs today. + +`gawk' + The GNU implementation of `awk'. + +General Public License + This document describes the terms under which `gawk' and its source + code may be distributed. (*Note Copying::.) + +GMT + "Greenwich Mean Time." This is the old term for UTC. It is the + time of day used as the epoch for Unix and POSIX systems. See + also "Epoch" and "UTC." + +GNU + "GNU's not Unix". An on-going project of the Free Software + Foundation to create a complete, freely distributable, + POSIX-compliant computing environment. + +GNU/Linux + A variant of the GNU system using the Linux kernel, instead of the + Free Software Foundation's Hurd kernel. Linux is a stable, + efficient, full-featured clone of Unix that has been ported to a + variety of architectures. It is most popular on PC-class systems, + but runs well on a variety of other systems too. The Linux kernel + source code is available under the terms of the GNU General Public + License, which is perhaps its most important aspect. + +GPL + See "General Public License." + +Hexadecimal + Base 16 notation, where the digits are `0'-`9' and `A'-`F', with + `A' representing 10, `B' representing 11, and so on, up to `F' for + 15. Hexadecimal numbers are written in C using a leading `0x', to + indicate their base. Thus, `0x12' is 18 (1 times 16 plus 2). + +I/O + Abbreviation for "Input/Output," the act of moving data into and/or + out of a running program. + +Input Record + A single chunk of data that is read in by `awk'. Usually, an + `awk' input record consists of one line of text. (*Note + Records::.) + +Integer + A whole number, i.e., a number that does not have a fractional + part. + +Internationalization + The process of writing or modifying a program so that it can use + multiple languages without requiring further source code changes. + +Interpreter + A program that reads human-readable source code directly, and uses + the instructions in it to process data and produce results. `awk' + is typically (but not always) implemented as an interpreter. See + also "Compiler." + +Interval Expression + A component of a regular expression that lets you specify repeated + matches of some part of the regexp. Interval expressions were not + traditionally available in `awk' programs. + +ISO + The International Standards Organization. This organization + produces international standards for many things, including + programming languages, such as C and C++. In the computer arena, + important standards like those for C, C++, and POSIX become both + American national and ISO international standards simultaneously. + This Info file refers to Standard C as "ISO C" throughout. + +Keyword + In the `awk' language, a keyword is a word that has special + meaning. Keywords are reserved and may not be used as variable + names. + + `gawk''s keywords are: `BEGIN', `END', `if', `else', `while', + `do...while', `for', `for...in', `break', `continue', `delete', + `next', `nextfile', `function', `func', and `exit'. If `gawk' was + configured with the `--enable-switch' option (*note Switch + Statement::), then `switch', `case', and `default' are also + keywords. + +Lesser General Public License + This document describes the terms under which binary library + archives or shared objects, and their source code may be + distributed. + +Linux + See "GNU/Linux." + +LGPL + See "Lesser General Public License." + +Localization + The process of providing the data necessary for an + internationalized program to work in a particular language. + +Logical Expression + An expression using the operators for logic, AND, OR, and NOT, + written `&&', `||', and `!' in `awk'. Often called Boolean + expressions, after the mathematician who pioneered this kind of + mathematical logic. + +Lvalue + An expression that can appear on the left side of an assignment + operator. In most languages, lvalues can be variables or array + elements. In `awk', a field designator can also be used as an + lvalue. + +Matching + The act of testing a string against a regular expression. If the + regexp describes the contents of the string, it is said to "match" + it. + +Metacharacters + Characters used within a regexp that do not stand for themselves. + Instead, they denote regular expression operations, such as + repetition, grouping, or alternation. + +Null String + A string with no characters in it. It is represented explicitly in + `awk' programs by placing two double quote characters next to each + other (`""'). It can appear in input data by having two successive + occurrences of the field separator appear next to each other. + +Number + A numeric-valued data object. Modern `awk' implementations use + double-precision floating-point to represent numbers. Very old + `awk' implementations use single-precision floating-point. + +Octal + Base-eight notation, where the digits are `0'-`7'. Octal numbers + are written in C using a leading `0', to indicate their base. + Thus, `013' is 11 (one times 8 plus 3). + +P1003.2 + See "POSIX." + +Pattern + Patterns tell `awk' which input records are interesting to which + rules. + + A pattern is an arbitrary conditional expression against which + input is tested. If the condition is satisfied, the pattern is + said to "match" the input record. A typical pattern might compare + the input record against a regular expression. (*Note Pattern + Overview::.) + +POSIX + The name for a series of standards that specify a Portable + Operating System interface. The "IX" denotes the Unix heritage of + these standards. The main standard of interest for `awk' users is + `IEEE Standard for Information Technology, Standard 1003.2-1992, + Portable Operating System Interface (POSIX) Part 2: Shell and + Utilities'. Informally, this standard is often referred to as + simply "P1003.2." + +Precedence + The order in which operations are performed when operators are used + without explicit parentheses. + +Private + Variables and/or functions that are meant for use exclusively by + library functions and not for the main `awk' program. Special care + must be taken when naming such variables and functions. (*Note + Library Names::.) + +Range (of input lines) + A sequence of consecutive lines from the input file(s). A pattern + can specify ranges of input lines for `awk' to process or it can + specify single lines. (*Note Pattern Overview::.) + +Recursion + When a function calls itself, either directly or indirectly. If + this isn't clear, refer to the entry for "recursion." + +Redirection + Redirection means performing input from something other than the + standard input stream, or performing output to something other + than the standard output stream. + + You can redirect the output of the `print' and `printf' statements + to a file or a system command, using the `>', `>>', `|', and `|&' + operators. You can redirect input to the `getline' statement using + the `<', `|', and `|&' operators. (*Note Redirection::, and *note + Getline::.) + +Regexp + Short for "regular expression". A regexp is a pattern that + denotes a set of strings, possibly an infinite set. For example, + the regexp `R.*xp' matches any string starting with the letter `R' + and ending with the letters `xp'. In `awk', regexps are used in + patterns and in conditional expressions. Regexps may contain + escape sequences. (*Note Regexp::.) + +Regular Expression + See "regexp." + +Regular Expression Constant + A regular expression constant is a regular expression written + within slashes, such as `/foo/'. This regular expression is chosen + when you write the `awk' program and cannot be changed during its + execution. (*Note Regexp Usage::.) + +Rule + A segment of an `awk' program that specifies how to process single + input records. A rule consists of a "pattern" and an "action". + `awk' reads an input record; then, for each rule, if the input + record satisfies the rule's pattern, `awk' executes the rule's + action. Otherwise, the rule does nothing for that input record. + +Rvalue + A value that can appear on the right side of an assignment + operator. In `awk', essentially every expression has a value. + These values are rvalues. + +Scalar + A single value, be it a number or a string. Regular variables are + scalars; arrays and functions are not. + +Search Path + In `gawk', a list of directories to search for `awk' program + source files. In the shell, a list of directories to search for + executable programs. + +Seed + The initial value, or starting point, for a sequence of random + numbers. + +`sed' + See "Stream Editor." + +Shell + The command interpreter for Unix and POSIX-compliant systems. The + shell works both interactively, and as a programming language for + batch files, or shell scripts. + +Short-Circuit + The nature of the `awk' logical operators `&&' and `||'. If the + value of the entire expression is determinable from evaluating just + the lefthand side of these operators, the righthand side is not + evaluated. (*Note Boolean Ops::.) + +Side Effect + A side effect occurs when an expression has an effect aside from + merely producing a value. Assignment expressions, increment and + decrement expressions, and function calls have side effects. + (*Note Assignment Ops::.) + +Single-Precision + An internal representation of numbers that can have fractional + parts. Single-precision numbers keep track of fewer digits than + do double-precision numbers, but operations on them are sometimes + less expensive in terms of CPU time. This is the type used by + some very old versions of `awk' to store numeric values. It is + the C type `float'. + +Space + The character generated by hitting the space bar on the keyboard. + +Special File + A file name interpreted internally by `gawk', instead of being + handed directly to the underlying operating system--for example, + `/dev/stderr'. (*Note Special Files::.) + +Stream Editor + A program that reads records from an input stream and processes + them one or more at a time. This is in contrast with batch + programs, which may expect to read their input files in entirety + before starting to do anything, as well as with interactive + programs which require input from the user. + +String + A datum consisting of a sequence of characters, such as `I am a + string'. Constant strings are written with double quotes in the + `awk' language and may contain escape sequences. (*Note Escape + Sequences::.) + +Tab + The character generated by hitting the `TAB' key on the keyboard. + It usually expands to up to eight spaces upon output. + +Text Domain + A unique name that identifies an application. Used for grouping + messages that are translated at runtime into the local language. + +Timestamp + A value in the "seconds since the epoch" format used by Unix and + POSIX systems. Used for the `gawk' functions `mktime', + `strftime', and `systime'. See also "Epoch" and "UTC." + +Unix + A computer operating system originally developed in the early + 1970's at AT&T Bell Laboratories. It initially became popular in + universities around the world and later moved into commercial + environments as a software development system and network server + system. There are many commercial versions of Unix, as well as + several work-alike systems whose source code is freely available + (such as GNU/Linux, NetBSD, FreeBSD, and OpenBSD). + +UTC + The accepted abbreviation for "Universal Coordinated Time." This + is standard time in Greenwich, England, which is used as a + reference time for day and date calculations. See also "Epoch" + and "GMT." + +Whitespace + A sequence of space, TAB, or newline characters occurring inside + an input record or a string. + + +File: gawk.info, Node: Copying, Next: GNU Free Documentation License, Prev: Glossary, Up: Top + +GNU General Public License +************************** + + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. `http://fsf.org/' + + Everyone is permitted to copy and distribute verbatim copies of this + license document, but changing it is not allowed. + +Preamble +======== + +The GNU General Public License is a free, copyleft license for software +and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains +free software for all its users. We, the Free Software Foundation, use +the GNU General Public License for most of our software; it applies +also to any other work released this way by its authors. You can apply +it to your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you +have certain responsibilities if you distribute copies of the software, +or if you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the +manufacturer can do so. This is fundamentally incompatible with the +aim of protecting users' freedom to change the software. The +systematic pattern of such abuse occurs in the area of products for +individuals to use, which is precisely where it is most unacceptable. +Therefore, we have designed this version of the GPL to prohibit the +practice for those products. If such problems arise substantially in +other domains, we stand ready to extend this provision to those domains +in future versions of the GPL, as needed to protect the freedom of +users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + +TERMS AND CONDITIONS +==================== + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public + License. + + "Copyright" also means copyright-like laws that apply to other + kinds of works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this + License. Each licensee is addressed as "you". "Licensees" and + "recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the + work in a fashion requiring copyright permission, other than the + making of an exact copy. The resulting work is called a "modified + version" of the earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work + based on the Program. + + To "propagate" a work means to do anything with it that, without + permission, would make you directly or secondarily liable for + infringement under applicable copyright law, except executing it + on a computer or modifying a private copy. Propagation includes + copying, distribution (with or without modification), making + available to the public, and in some countries other activities as + well. + + To "convey" a work means any kind of propagation that enables other + parties to make or receive copies. Mere interaction with a user + through a computer network, with no transfer of a copy, is not + conveying. + + An interactive user interface displays "Appropriate Legal Notices" + to the extent that it includes a convenient and prominently visible + feature that (1) displays an appropriate copyright notice, and (2) + tells the user that there is no warranty for the work (except to + the extent that warranties are provided), that licensees may + convey the work under this License, and how to view a copy of this + License. If the interface presents a list of user commands or + options, such as a menu, a prominent item in the list meets this + criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work + for making modifications to it. "Object code" means any + non-source form of a work. + + A "Standard Interface" means an interface that either is an + official standard defined by a recognized standards body, or, in + the case of interfaces specified for a particular programming + language, one that is widely used among developers working in that + language. + + The "System Libraries" of an executable work include anything, + other than the work as a whole, that (a) is included in the normal + form of packaging a Major Component, but which is not part of that + Major Component, and (b) serves only to enable use of the work + with that Major Component, or to implement a Standard Interface + for which an implementation is available to the public in source + code form. A "Major Component", in this context, means a major + essential component (kernel, window system, and so on) of the + specific operating system (if any) on which the executable work + runs, or a compiler used to produce the work, or an object code + interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all + the source code needed to generate, install, and (for an executable + work) run the object code and to modify the work, including + scripts to control those activities. However, it does not include + the work's System Libraries, or general-purpose tools or generally + available free programs which are used unmodified in performing + those activities but which are not part of the work. For example, + Corresponding Source includes interface definition files + associated with source files for the work, and the source code for + shared libraries and dynamically linked subprograms that the work + is specifically designed to require, such as by intimate data + communication or control flow between those subprograms and other + parts of the work. + + The Corresponding Source need not include anything that users can + regenerate automatically from other parts of the Corresponding + Source. + + The Corresponding Source for a work in source code form is that + same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of + copyright on the Program, and are irrevocable provided the stated + conditions are met. This License explicitly affirms your unlimited + permission to run the unmodified Program. The output from running + a covered work is covered by this License only if the output, + given its content, constitutes a covered work. This License + acknowledges your rights of fair use or other equivalent, as + provided by copyright law. + + You may make, run and propagate covered works that you do not + convey, without conditions so long as your license otherwise + remains in force. You may convey covered works to others for the + sole purpose of having them make modifications exclusively for + you, or provide you with facilities for running those works, + provided that you comply with the terms of this License in + conveying all material for which you do not control copyright. + Those thus making or running the covered works for you must do so + exclusively on your behalf, under your direction and control, on + terms that prohibit them from making any copies of your + copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under + the conditions stated below. Sublicensing is not allowed; section + 10 makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological + measure under any applicable law fulfilling obligations under + article 11 of the WIPO copyright treaty adopted on 20 December + 1996, or similar laws prohibiting or restricting circumvention of + such measures. + + When you convey a covered work, you waive any legal power to forbid + circumvention of technological measures to the extent such + circumvention is effected by exercising rights under this License + with respect to the covered work, and you disclaim any intention + to limit operation or modification of the work as a means of + enforcing, against the work's users, your or third parties' legal + rights to forbid circumvention of technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you + receive it, in any medium, provided that you conspicuously and + appropriately publish on each copy an appropriate copyright notice; + keep intact all notices stating that this License and any + non-permissive terms added in accord with section 7 apply to the + code; keep intact all notices of the absence of any warranty; and + give all recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, + and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to + produce it from the Program, in the form of source code under the + terms of section 4, provided that you also meet all of these + conditions: + + a. The work must carry prominent notices stating that you + modified it, and giving a relevant date. + + b. The work must carry prominent notices stating that it is + released under this License and any conditions added under + section 7. This requirement modifies the requirement in + section 4 to "keep intact all notices". + + c. You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable + section 7 additional terms, to the whole of the work, and all + its parts, regardless of how they are packaged. This License + gives no permission to license the work in any other way, but + it does not invalidate such permission if you have separately + received it. + + d. If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has + interactive interfaces that do not display Appropriate Legal + Notices, your work need not make them do so. + + A compilation of a covered work with other separate and independent + works, which are not by their nature extensions of the covered + work, and which are not combined with it such as to form a larger + program, in or on a volume of a storage or distribution medium, is + called an "aggregate" if the compilation and its resulting + copyright are not used to limit the access or legal rights of the + compilation's users beyond what the individual works permit. + Inclusion of a covered work in an aggregate does not cause this + License to apply to the other parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms + of sections 4 and 5, provided that you also convey the + machine-readable Corresponding Source under the terms of this + License, in one of these ways: + + a. Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b. Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for + as long as you offer spare parts or customer support for that + product model, to give anyone who possesses the object code + either (1) a copy of the Corresponding Source for all the + software in the product that is covered by this License, on a + durable physical medium customarily used for software + interchange, for a price no more than your reasonable cost of + physically performing this conveying of source, or (2) access + to copy the Corresponding Source from a network server at no + charge. + + c. Convey individual copies of the object code with a copy of + the written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, + and only if you received the object code with such an offer, + in accord with subsection 6b. + + d. Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access + to the Corresponding Source in the same way through the same + place at no further charge. You need not require recipients + to copy the Corresponding Source along with the object code. + If the place to copy the object code is a network server, the + Corresponding Source may be on a different server (operated + by you or a third party) that supports equivalent copying + facilities, provided you maintain clear directions next to + the object code saying where to find the Corresponding Source. + Regardless of what server hosts the Corresponding Source, you + remain obligated to ensure that it is available for as long + as needed to satisfy these requirements. + + e. Convey the object code using peer-to-peer transmission, + provided you inform other peers where the object code and + Corresponding Source of the work are being offered to the + general public at no charge under subsection 6d. + + + A separable portion of the object code, whose source code is + excluded from the Corresponding Source as a System Library, need + not be included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means + any tangible personal property which is normally used for personal, + family, or household purposes, or (2) anything designed or sold for + incorporation into a dwelling. In determining whether a product + is a consumer product, doubtful cases shall be resolved in favor of + coverage. For a particular product received by a particular user, + "normally used" refers to a typical or common use of that class of + product, regardless of the status of the particular user or of the + way in which the particular user actually uses, or expects or is + expected to use, the product. A product is a consumer product + regardless of whether the product has substantial commercial, + industrial or non-consumer uses, unless such uses represent the + only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, + procedures, authorization keys, or other information required to + install and execute modified versions of a covered work in that + User Product from a modified version of its Corresponding Source. + The information must suffice to ensure that the continued + functioning of the modified object code is in no case prevented or + interfered with solely because modification has been made. + + If you convey an object code work under this section in, or with, + or specifically for use in, a User Product, and the conveying + occurs as part of a transaction in which the right of possession + and use of the User Product is transferred to the recipient in + perpetuity or for a fixed term (regardless of how the transaction + is characterized), the Corresponding Source conveyed under this + section must be accompanied by the Installation Information. But + this requirement does not apply if neither you nor any third party + retains the ability to install modified object code on the User + Product (for example, the work has been installed in ROM). + + The requirement to provide Installation Information does not + include a requirement to continue to provide support service, + warranty, or updates for a work that has been modified or + installed by the recipient, or for the User Product in which it + has been modified or installed. Access to a network may be denied + when the modification itself materially and adversely affects the + operation of the network or violates the rules and protocols for + communication across the network. + + Corresponding Source conveyed, and Installation Information + provided, in accord with this section must be in a format that is + publicly documented (and with an implementation available to the + public in source code form), and must require no special password + or key for unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of + this License by making exceptions from one or more of its + conditions. Additional permissions that are applicable to the + entire Program shall be treated as though they were included in + this License, to the extent that they are valid under applicable + law. If additional permissions apply only to part of the Program, + that part may be used separately under those permissions, but the + entire Program remains governed by this License without regard to + the additional permissions. + + When you convey a copy of a covered work, you may at your option + remove any additional permissions from that copy, or from any part + of it. (Additional permissions may be written to require their own + removal in certain cases when you modify the work.) You may place + additional permissions on material, added by you to a covered work, + for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material + you add to a covered work, you may (if authorized by the copyright + holders of that material) supplement the terms of this License + with terms: + + a. Disclaiming warranty or limiting liability differently from + the terms of sections 15 and 16 of this License; or + + b. Requiring preservation of specified reasonable legal notices + or author attributions in that material or in the Appropriate + Legal Notices displayed by works containing it; or + + c. Prohibiting misrepresentation of the origin of that material, + or requiring that modified versions of such material be + marked in reasonable ways as different from the original + version; or + + d. Limiting the use for publicity purposes of names of licensors + or authors of the material; or + + e. Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f. Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified + versions of it) with contractual assumptions of liability to + the recipient, for any liability that these contractual + assumptions directly impose on those licensors and authors. + + All other non-permissive additional terms are considered "further + restrictions" within the meaning of section 10. If the Program as + you received it, or any part of it, contains a notice stating that + it is governed by this License along with a term that is a further + restriction, you may remove that term. If a license document + contains a further restriction but permits relicensing or + conveying under this License, you may add to a covered work + material governed by the terms of that license document, provided + that the further restriction does not survive such relicensing or + conveying. + + If you add terms to a covered work in accord with this section, you + must place, in the relevant source files, a statement of the + additional terms that apply to those files, or a notice indicating + where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in + the form of a separately written license, or stated as exceptions; + the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly + provided under this License. Any attempt otherwise to propagate or + modify it is void, and will automatically terminate your rights + under this License (including any patent licenses granted under + the third paragraph of section 11). + + However, if you cease all violation of this License, then your + license from a particular copyright holder is reinstated (a) + provisionally, unless and until the copyright holder explicitly + and finally terminates your license, and (b) permanently, if the + copyright holder fails to notify you of the violation by some + reasonable means prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is + reinstated permanently if the copyright holder notifies you of the + violation by some reasonable means, this is the first time you have + received notice of violation of this License (for any work) from + that copyright holder, and you cure the violation prior to 30 days + after your receipt of the notice. + + Termination of your rights under this section does not terminate + the licenses of parties who have received copies or rights from + you under this License. If your rights have been terminated and + not permanently reinstated, you do not qualify to receive new + licenses for the same material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or + run a copy of the Program. Ancillary propagation of a covered work + occurring solely as a consequence of using peer-to-peer + transmission to receive a copy likewise does not require + acceptance. However, nothing other than this License grants you + permission to propagate or modify any covered work. These actions + infringe copyright if you do not accept this License. Therefore, + by modifying or propagating a covered work, you indicate your + acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically + receives a license from the original licensors, to run, modify and + propagate that work, subject to this License. You are not + responsible for enforcing compliance by third parties with this + License. + + An "entity transaction" is a transaction transferring control of an + organization, or substantially all assets of one, or subdividing an + organization, or merging organizations. If propagation of a + covered work results from an entity transaction, each party to that + transaction who receives a copy of the work also receives whatever + licenses to the work the party's predecessor in interest had or + could give under the previous paragraph, plus a right to + possession of the Corresponding Source of the work from the + predecessor in interest, if the predecessor has it or can get it + with reasonable efforts. + + You may not impose any further restrictions on the exercise of the + rights granted or affirmed under this License. For example, you + may not impose a license fee, royalty, or other charge for + exercise of rights granted under this License, and you may not + initiate litigation (including a cross-claim or counterclaim in a + lawsuit) alleging that any patent claim is infringed by making, + using, selling, offering for sale, or importing the Program or any + portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this + License of the Program or a work on which the Program is based. + The work thus licensed is called the contributor's "contributor + version". + + A contributor's "essential patent claims" are all patent claims + owned or controlled by the contributor, whether already acquired or + hereafter acquired, that would be infringed by some manner, + permitted by this License, of making, using, or selling its + contributor version, but do not include claims that would be + infringed only as a consequence of further modification of the + contributor version. For purposes of this definition, "control" + includes the right to grant patent sublicenses in a manner + consistent with the requirements of this License. + + Each contributor grants you a non-exclusive, worldwide, + royalty-free patent license under the contributor's essential + patent claims, to make, use, sell, offer for sale, import and + otherwise run, modify and propagate the contents of its + contributor version. + + In the following three paragraphs, a "patent license" is any + express agreement or commitment, however denominated, not to + enforce a patent (such as an express permission to practice a + patent or covenant not to sue for patent infringement). To + "grant" such a patent license to a party means to make such an + agreement or commitment not to enforce a patent against the party. + + If you convey a covered work, knowingly relying on a patent + license, and the Corresponding Source of the work is not available + for anyone to copy, free of charge and under the terms of this + License, through a publicly available network server or other + readily accessible means, then you must either (1) cause the + Corresponding Source to be so available, or (2) arrange to deprive + yourself of the benefit of the patent license for this particular + work, or (3) arrange, in a manner consistent with the requirements + of this License, to extend the patent license to downstream + recipients. "Knowingly relying" means you have actual knowledge + that, but for the patent license, your conveying the covered work + in a country, or your recipient's use of the covered work in a + country, would infringe one or more identifiable patents in that + country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or + arrangement, you convey, or propagate by procuring conveyance of, a + covered work, and grant a patent license to some of the parties + receiving the covered work authorizing them to use, propagate, + modify or convey a specific copy of the covered work, then the + patent license you grant is automatically extended to all + recipients of the covered work and works based on it. + + A patent license is "discriminatory" if it does not include within + the scope of its coverage, prohibits the exercise of, or is + conditioned on the non-exercise of one or more of the rights that + are specifically granted under this License. You may not convey a + covered work if you are a party to an arrangement with a third + party that is in the business of distributing software, under + which you make payment to the third party based on the extent of + your activity of conveying the work, and under which the third + party grants, to any of the parties who would receive the covered + work from you, a discriminatory patent license (a) in connection + with copies of the covered work conveyed by you (or copies made + from those copies), or (b) primarily for and in connection with + specific products or compilations that contain the covered work, + unless you entered into that arrangement, or that patent license + was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting + any implied license or other defenses to infringement that may + otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, + agreement or otherwise) that contradict the conditions of this + License, they do not excuse you from the conditions of this + License. If you cannot convey a covered work so as to satisfy + simultaneously your obligations under this License and any other + pertinent obligations, then as a consequence you may not convey it + at all. For example, if you agree to terms that obligate you to + collect a royalty for further conveying from those to whom you + convey the Program, the only way you could satisfy both those + terms and this License would be to refrain entirely from conveying + the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have + permission to link or combine any covered work with a work licensed + under version 3 of the GNU Affero General Public License into a + single combined work, and to convey the resulting work. The terms + of this License will continue to apply to the part which is the + covered work, but the special requirements of the GNU Affero + General Public License, section 13, concerning interaction through + a network will apply to the combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new + versions of the GNU General Public License from time to time. + Such new versions will be similar in spirit to the present + version, but may differ in detail to address new problems or + concerns. + + Each version is given a distinguishing version number. If the + Program specifies that a certain numbered version of the GNU + General Public License "or any later version" applies to it, you + have the option of following the terms and conditions either of + that numbered version or of any later version published by the + Free Software Foundation. If the Program does not specify a + version number of the GNU General Public License, you may choose + any version ever published by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future + versions of the GNU General Public License can be used, that + proxy's public statement of acceptance of a version permanently + authorizes you to choose that version for the Program. + + Later license versions may give you additional or different + permissions. However, no additional obligations are imposed on any + author or copyright holder as a result of your choosing to follow a + later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY + APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE + COPYRIGHT HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" + WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED, + INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF + MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE + RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. + SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL + NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN + WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES + AND/OR CONVEYS THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU + FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR + CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE + THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA + BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD + PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER + PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF + THE POSSIBILITY OF SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided + above cannot be given local legal effect according to their terms, + reviewing courts shall apply local law that most closely + approximates an absolute waiver of all civil liability in + connection with the Program, unless a warranty or assumption of + liability accompanies a copy of the Program in return for a fee. + + +END OF TERMS AND CONDITIONS +=========================== + +How to Apply These Terms to Your New Programs +============================================= + +If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these +terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least the +"copyright" line and a pointer to where the full notice is found. + + ONE LINE TO GIVE THE PROGRAM'S NAME AND A BRIEF IDEA OF WHAT IT DOES. + Copyright (C) YEAR NAME OF AUTHOR + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or (at + your option) any later version. + + This program is distributed in the hope that it will be useful, but + WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU + General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see `http://www.gnu.org/licenses/'. + + Also add information on how to contact you by electronic and paper +mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + PROGRAM Copyright (C) YEAR NAME OF AUTHOR + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + + The hypothetical commands `show w' and `show c' should show the +appropriate parts of the General Public License. Of course, your +program's commands might be different; for a GUI interface, you would +use an "about box". + + You should also get your employer (if you work as a programmer) or +school, if any, to sign a "copyright disclaimer" for the program, if +necessary. For more information on this, and how to apply and follow +the GNU GPL, see `http://www.gnu.org/licenses/'. + + The GNU General Public License does not permit incorporating your +program into proprietary programs. If your program is a subroutine +library, you may consider it more useful to permit linking proprietary +applications with the library. If this is what you want to do, use the +GNU Lesser General Public License instead of this License. But first, +please read `http://www.gnu.org/philosophy/why-not-lgpl.html'. + + +File: gawk.info, Node: GNU Free Documentation License, Next: Index, Prev: Copying, Up: Top + +GNU Free Documentation License +****************************** + + Version 1.2, November 2002 + + Copyright (C) 2000,2001,2002 Free Software Foundation, Inc. + 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA + + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + 0. PREAMBLE + + The purpose of this License is to make a manual, textbook, or other + functional and useful document "free" in the sense of freedom: to + assure everyone the effective freedom to copy and redistribute it, + with or without modifying it, either commercially or + noncommercially. Secondarily, this License preserves for the + author and publisher a way to get credit for their work, while not + being considered responsible for modifications made by others. + + This License is a kind of "copyleft", which means that derivative + works of the document must themselves be free in the same sense. + It complements the GNU General Public License, which is a copyleft + license designed for free software. + + We have designed this License in order to use it for manuals for + free software, because free software needs free documentation: a + free program should come with manuals providing the same freedoms + that the software does. But this License is not limited to + software manuals; it can be used for any textual work, regardless + of subject matter or whether it is published as a printed book. + We recommend this License principally for works whose purpose is + instruction or reference. + + 1. APPLICABILITY AND DEFINITIONS + + This License applies to any manual or other work, in any medium, + that contains a notice placed by the copyright holder saying it + can be distributed under the terms of this License. Such a notice + grants a world-wide, royalty-free license, unlimited in duration, + to use that work under the conditions stated herein. The + "Document", below, refers to any such manual or work. Any member + of the public is a licensee, and is addressed as "you". You + accept the license if you copy, modify or distribute the work in a + way requiring permission under copyright law. + + A "Modified Version" of the Document means any work containing the + Document or a portion of it, either copied verbatim, or with + modifications and/or translated into another language. + + A "Secondary Section" is a named appendix or a front-matter section + of the Document that deals exclusively with the relationship of the + publishers or authors of the Document to the Document's overall + subject (or to related matters) and contains nothing that could + fall directly within that overall subject. (Thus, if the Document + is in part a textbook of mathematics, a Secondary Section may not + explain any mathematics.) The relationship could be a matter of + historical connection with the subject or with related matters, or + of legal, commercial, philosophical, ethical or political position + regarding them. + + The "Invariant Sections" are certain Secondary Sections whose + titles are designated, as being those of Invariant Sections, in + the notice that says that the Document is released under this + License. If a section does not fit the above definition of + Secondary then it is not allowed to be designated as Invariant. + The Document may contain zero Invariant Sections. If the Document + does not identify any Invariant Sections then there are none. + + The "Cover Texts" are certain short passages of text that are + listed, as Front-Cover Texts or Back-Cover Texts, in the notice + that says that the Document is released under this License. A + Front-Cover Text may be at most 5 words, and a Back-Cover Text may + be at most 25 words. + + A "Transparent" copy of the Document means a machine-readable copy, + represented in a format whose specification is available to the + general public, that is suitable for revising the document + straightforwardly with generic text editors or (for images + composed of pixels) generic paint programs or (for drawings) some + widely available drawing editor, and that is suitable for input to + text formatters or for automatic translation to a variety of + formats suitable for input to text formatters. A copy made in an + otherwise Transparent file format whose markup, or absence of + markup, has been arranged to thwart or discourage subsequent + modification by readers is not Transparent. An image format is + not Transparent if used for any substantial amount of text. A + copy that is not "Transparent" is called "Opaque". + + Examples of suitable formats for Transparent copies include plain + ASCII without markup, Texinfo input format, LaTeX input format, + SGML or XML using a publicly available DTD, and + standard-conforming simple HTML, PostScript or PDF designed for + human modification. Examples of transparent image formats include + PNG, XCF and JPG. Opaque formats include proprietary formats that + can be read and edited only by proprietary word processors, SGML or + XML for which the DTD and/or processing tools are not generally + available, and the machine-generated HTML, PostScript or PDF + produced by some word processors for output purposes only. + + The "Title Page" means, for a printed book, the title page itself, + plus such following pages as are needed to hold, legibly, the + material this License requires to appear in the title page. For + works in formats which do not have any title page as such, "Title + Page" means the text near the most prominent appearance of the + work's title, preceding the beginning of the body of the text. + + A section "Entitled XYZ" means a named subunit of the Document + whose title either is precisely XYZ or contains XYZ in parentheses + following text that translates XYZ in another language. (Here XYZ + stands for a specific section name mentioned below, such as + "Acknowledgements", "Dedications", "Endorsements", or "History".) + To "Preserve the Title" of such a section when you modify the + Document means that it remains a section "Entitled XYZ" according + to this definition. + + The Document may include Warranty Disclaimers next to the notice + which states that this License applies to the Document. These + Warranty Disclaimers are considered to be included by reference in + this License, but only as regards disclaiming warranties: any other + implication that these Warranty Disclaimers may have is void and + has no effect on the meaning of this License. + + 2. VERBATIM COPYING + + You may copy and distribute the Document in any medium, either + commercially or noncommercially, provided that this License, the + copyright notices, and the license notice saying this License + applies to the Document are reproduced in all copies, and that you + add no other conditions whatsoever to those of this License. You + may not use technical measures to obstruct or control the reading + or further copying of the copies you make or distribute. However, + you may accept compensation in exchange for copies. If you + distribute a large enough number of copies you must also follow + the conditions in section 3. + + You may also lend copies, under the same conditions stated above, + and you may publicly display copies. + + 3. COPYING IN QUANTITY + + If you publish printed copies (or copies in media that commonly + have printed covers) of the Document, numbering more than 100, and + the Document's license notice requires Cover Texts, you must + enclose the copies in covers that carry, clearly and legibly, all + these Cover Texts: Front-Cover Texts on the front cover, and + Back-Cover Texts on the back cover. Both covers must also clearly + and legibly identify you as the publisher of these copies. The + front cover must present the full title with all words of the + title equally prominent and visible. You may add other material + on the covers in addition. Copying with changes limited to the + covers, as long as they preserve the title of the Document and + satisfy these conditions, can be treated as verbatim copying in + other respects. + + If the required texts for either cover are too voluminous to fit + legibly, you should put the first ones listed (as many as fit + reasonably) on the actual cover, and continue the rest onto + adjacent pages. + + If you publish or distribute Opaque copies of the Document + numbering more than 100, you must either include a + machine-readable Transparent copy along with each Opaque copy, or + state in or with each Opaque copy a computer-network location from + which the general network-using public has access to download + using public-standard network protocols a complete Transparent + copy of the Document, free of added material. If you use the + latter option, you must take reasonably prudent steps, when you + begin distribution of Opaque copies in quantity, to ensure that + this Transparent copy will remain thus accessible at the stated + location until at least one year after the last time you + distribute an Opaque copy (directly or through your agents or + retailers) of that edition to the public. + + It is requested, but not required, that you contact the authors of + the Document well before redistributing any large number of + copies, to give them a chance to provide you with an updated + version of the Document. + + 4. MODIFICATIONS + + You may copy and distribute a Modified Version of the Document + under the conditions of sections 2 and 3 above, provided that you + release the Modified Version under precisely this License, with + the Modified Version filling the role of the Document, thus + licensing distribution and modification of the Modified Version to + whoever possesses a copy of it. In addition, you must do these + things in the Modified Version: + + A. Use in the Title Page (and on the covers, if any) a title + distinct from that of the Document, and from those of + previous versions (which should, if there were any, be listed + in the History section of the Document). You may use the + same title as a previous version if the original publisher of + that version gives permission. + + B. List on the Title Page, as authors, one or more persons or + entities responsible for authorship of the modifications in + the Modified Version, together with at least five of the + principal authors of the Document (all of its principal + authors, if it has fewer than five), unless they release you + from this requirement. + + C. State on the Title page the name of the publisher of the + Modified Version, as the publisher. + + D. Preserve all the copyright notices of the Document. + + E. Add an appropriate copyright notice for your modifications + adjacent to the other copyright notices. + + F. Include, immediately after the copyright notices, a license + notice giving the public permission to use the Modified + Version under the terms of this License, in the form shown in + the Addendum below. + + G. Preserve in that license notice the full lists of Invariant + Sections and required Cover Texts given in the Document's + license notice. + + H. Include an unaltered copy of this License. + + I. Preserve the section Entitled "History", Preserve its Title, + and add to it an item stating at least the title, year, new + authors, and publisher of the Modified Version as given on + the Title Page. If there is no section Entitled "History" in + the Document, create one stating the title, year, authors, + and publisher of the Document as given on its Title Page, + then add an item describing the Modified Version as stated in + the previous sentence. + + J. Preserve the network location, if any, given in the Document + for public access to a Transparent copy of the Document, and + likewise the network locations given in the Document for + previous versions it was based on. These may be placed in + the "History" section. You may omit a network location for a + work that was published at least four years before the + Document itself, or if the original publisher of the version + it refers to gives permission. + + K. For any section Entitled "Acknowledgements" or "Dedications", + Preserve the Title of the section, and preserve in the + section all the substance and tone of each of the contributor + acknowledgements and/or dedications given therein. + + L. Preserve all the Invariant Sections of the Document, + unaltered in their text and in their titles. Section numbers + or the equivalent are not considered part of the section + titles. + + M. Delete any section Entitled "Endorsements". Such a section + may not be included in the Modified Version. + + N. Do not retitle any existing section to be Entitled + "Endorsements" or to conflict in title with any Invariant + Section. + + O. Preserve any Warranty Disclaimers. + + If the Modified Version includes new front-matter sections or + appendices that qualify as Secondary Sections and contain no + material copied from the Document, you may at your option + designate some or all of these sections as invariant. To do this, + add their titles to the list of Invariant Sections in the Modified + Version's license notice. These titles must be distinct from any + other section titles. + + You may add a section Entitled "Endorsements", provided it contains + nothing but endorsements of your Modified Version by various + parties--for example, statements of peer review or that the text + has been approved by an organization as the authoritative + definition of a standard. + + You may add a passage of up to five words as a Front-Cover Text, + and a passage of up to 25 words as a Back-Cover Text, to the end + of the list of Cover Texts in the Modified Version. Only one + passage of Front-Cover Text and one of Back-Cover Text may be + added by (or through arrangements made by) any one entity. If the + Document already includes a cover text for the same cover, + previously added by you or by arrangement made by the same entity + you are acting on behalf of, you may not add another; but you may + replace the old one, on explicit permission from the previous + publisher that added the old one. + + The author(s) and publisher(s) of the Document do not by this + License give permission to use their names for publicity for or to + assert or imply endorsement of any Modified Version. + + 5. COMBINING DOCUMENTS + + You may combine the Document with other documents released under + this License, under the terms defined in section 4 above for + modified versions, provided that you include in the combination + all of the Invariant Sections of all of the original documents, + unmodified, and list them all as Invariant Sections of your + combined work in its license notice, and that you preserve all + their Warranty Disclaimers. + + The combined work need only contain one copy of this License, and + multiple identical Invariant Sections may be replaced with a single + copy. If there are multiple Invariant Sections with the same name + but different contents, make the title of each such section unique + by adding at the end of it, in parentheses, the name of the + original author or publisher of that section if known, or else a + unique number. Make the same adjustment to the section titles in + the list of Invariant Sections in the license notice of the + combined work. + + In the combination, you must combine any sections Entitled + "History" in the various original documents, forming one section + Entitled "History"; likewise combine any sections Entitled + "Acknowledgements", and any sections Entitled "Dedications". You + must delete all sections Entitled "Endorsements." + + 6. COLLECTIONS OF DOCUMENTS + + You may make a collection consisting of the Document and other + documents released under this License, and replace the individual + copies of this License in the various documents with a single copy + that is included in the collection, provided that you follow the + rules of this License for verbatim copying of each of the + documents in all other respects. + + You may extract a single document from such a collection, and + distribute it individually under this License, provided you insert + a copy of this License into the extracted document, and follow + this License in all other respects regarding verbatim copying of + that document. + + 7. AGGREGATION WITH INDEPENDENT WORKS + + A compilation of the Document or its derivatives with other + separate and independent documents or works, in or on a volume of + a storage or distribution medium, is called an "aggregate" if the + copyright resulting from the compilation is not used to limit the + legal rights of the compilation's users beyond what the individual + works permit. When the Document is included an aggregate, this + License does not apply to the other works in the aggregate which + are not themselves derivative works of the Document. + + If the Cover Text requirement of section 3 is applicable to these + copies of the Document, then if the Document is less than one half + of the entire aggregate, the Document's Cover Texts may be placed + on covers that bracket the Document within the aggregate, or the + electronic equivalent of covers if the Document is in electronic + form. Otherwise they must appear on printed covers that bracket + the whole aggregate. + + 8. TRANSLATION + + Translation is considered a kind of modification, so you may + distribute translations of the Document under the terms of section + 4. Replacing Invariant Sections with translations requires special + permission from their copyright holders, but you may include + translations of some or all Invariant Sections in addition to the + original versions of these Invariant Sections. You may include a + translation of this License, and all the license notices in the + Document, and any Warranty Disclaimers, provided that you also + include the original English version of this License and the + original versions of those notices and disclaimers. In case of a + disagreement between the translation and the original version of + this License or a notice or disclaimer, the original version will + prevail. + + If a section in the Document is Entitled "Acknowledgements", + "Dedications", or "History", the requirement (section 4) to + Preserve its Title (section 1) will typically require changing the + actual title. + + 9. TERMINATION + + You may not copy, modify, sublicense, or distribute the Document + except as expressly provided for under this License. Any other + attempt to copy, modify, sublicense or distribute the Document is + void, and will automatically terminate your rights under this + License. However, parties who have received copies, or rights, + from you under this License will not have their licenses + terminated so long as such parties remain in full compliance. + + 10. FUTURE REVISIONS OF THIS LICENSE + + The Free Software Foundation may publish new, revised versions of + the GNU Free Documentation License from time to time. Such new + versions will be similar in spirit to the present version, but may + differ in detail to address new problems or concerns. See + `http://www.gnu.org/copyleft/'. + + Each version of the License is given a distinguishing version + number. If the Document specifies that a particular numbered + version of this License "or any later version" applies to it, you + have the option of following the terms and conditions either of + that specified version or of any later version that has been + published (not as a draft) by the Free Software Foundation. If + the Document does not specify a version number of this License, + you may choose any version ever published (not as a draft) by the + Free Software Foundation. + +ADDENDUM: How to use this License for your documents +==================================================== + +To use this License in a document you have written, include a copy of +the License in the document and put the following copyright and license +notices just after the title page: + + Copyright (C) YEAR YOUR NAME. + Permission is granted to copy, distribute and/or modify this document + under the terms of the GNU Free Documentation License, Version 1.2 + or any later version published by the Free Software Foundation; + with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts. + A copy of the license is included in the section entitled ``GNU + Free Documentation License''. + + If you have Invariant Sections, Front-Cover Texts and Back-Cover +Texts, replace the "with...Texts." line with this: + + with the Invariant Sections being LIST THEIR TITLES, with + the Front-Cover Texts being LIST, and with the Back-Cover Texts + being LIST. + + If you have Invariant Sections without Cover Texts, or some other +combination of the three, merge those two alternatives to suit the +situation. + + If your document contains nontrivial examples of program code, we +recommend releasing these examples in parallel under your choice of +free software license, such as the GNU General Public License, to +permit their use in free software. + + +File: gawk.info, Node: Index, Prev: GNU Free Documentation License, Up: Top + +Index +***** + + +* Menu: + +* ! (exclamation point), ! operator: Boolean Ops. (line 67) +* ! (exclamation point), ! operator <1>: Egrep Program. (line 160) +* ! (exclamation point), ! operator: Precedence. (line 52) +* ! (exclamation point), != operator <1>: Precedence. (line 65) +* ! (exclamation point), != operator: Comparison Operators. + (line 11) +* ! (exclamation point), !~ operator <1>: Expression Patterns. + (line 24) +* ! (exclamation point), !~ operator <2>: Precedence. (line 81) +* ! (exclamation point), !~ operator <3>: Comparison Operators. + (line 11) +* ! (exclamation point), !~ operator <4>: Regexp Constants. (line 6) +* ! (exclamation point), !~ operator <5>: Computed Regexps. (line 6) +* ! (exclamation point), !~ operator <6>: Case-sensitivity. (line 26) +* ! (exclamation point), !~ operator: Regexp Usage. (line 19) +* ! operator <1>: Egrep Program. (line 168) +* ! operator: Ranges. (line 48) +* " (double quote) <1>: Quoting. (line 33) +* " (double quote): Read Terminal. (line 25) +* " (double quote), regexp constants: Computed Regexps. (line 28) +* # (number sign), #! (executable scripts): Executable Scripts. + (line 6) +* # (number sign), #! (executable scripts), portability issues with: Executable Scripts. + (line 6) +* # (number sign), commenting: Comments. (line 6) +* $ (dollar sign): Regexp Operators. (line 35) +* $ (dollar sign), $ field operator <1>: Precedence. (line 43) +* $ (dollar sign), $ field operator: Fields. (line 19) +* $ (dollar sign), incrementing fields and arrays: Increment Ops. + (line 30) +* $ field operator: Fields. (line 19) +* % (percent sign), % operator: Precedence. (line 55) +* % (percent sign), %= operator <1>: Precedence. (line 96) +* % (percent sign), %= operator: Assignment Ops. (line 129) +* & (ampersand), && operator <1>: Precedence. (line 87) +* & (ampersand), && operator: Boolean Ops. (line 57) +* & (ampersand), gsub/gensub/sub functions and: Gory Details. (line 6) +* ' (single quote) <1>: Quoting. (line 27) +* ' (single quote) <2>: Long. (line 33) +* ' (single quote): One-shot. (line 15) +* ' (single quote), vs. apostrophe: Comments. (line 27) +* ' (single quote), with double quotes: Quoting. (line 49) +* () (parentheses): Regexp Operators. (line 78) +* () (parentheses), pgawk program: Profiling. (line 144) +* * (asterisk), * operator, as multiplication operator: Precedence. + (line 55) +* * (asterisk), * operator, as regexp operator: Regexp Operators. + (line 86) +* * (asterisk), * operator, null strings, matching: Gory Details. + (line 160) +* * (asterisk), ** operator <1>: Options. (line 192) +* * (asterisk), ** operator <2>: Precedence. (line 49) +* * (asterisk), ** operator: Arithmetic Ops. (line 81) +* * (asterisk), **= operator <1>: Options. (line 192) +* * (asterisk), **= operator <2>: Precedence. (line 96) +* * (asterisk), **= operator: Assignment Ops. (line 129) +* * (asterisk), *= operator <1>: Precedence. (line 96) +* * (asterisk), *= operator: Assignment Ops. (line 129) +* + (plus sign): Regexp Operators. (line 101) +* + (plus sign), + operator: Precedence. (line 52) +* + (plus sign), ++ operator <1>: Precedence. (line 46) +* + (plus sign), ++ operator: Increment Ops. (line 40) +* + (plus sign), += operator <1>: Precedence. (line 96) +* + (plus sign), += operator: Assignment Ops. (line 82) +* + (plus sign), decrement/increment operators: Increment Ops. + (line 11) +* , (comma), in range patterns: Ranges. (line 6) +* - (hyphen), - operator: Precedence. (line 52) +* - (hyphen), -- (decrement/increment) operator: Precedence. (line 46) +* - (hyphen), -- operator: Increment Ops. (line 48) +* - (hyphen), -= operator <1>: Precedence. (line 96) +* - (hyphen), -= operator: Assignment Ops. (line 129) +* - (hyphen), filenames beginning with: Options. (line 67) +* - (hyphen), in character lists: Character Lists. (line 17) +* --assign option: Options. (line 30) +* --compat option: Options. (line 79) +* --copyleft option: Options. (line 92) +* --copyright option: Options. (line 87) +* --disable-directories-fatal configuration option: Additional Configuration Options. + (line 37) +* --disable-lint configuration option: Additional Configuration Options. + (line 17) +* --disable-nls configuration option: Additional Configuration Options. + (line 32) +* --dump-variables option <1>: Library Names. (line 45) +* --dump-variables option: Options. (line 95) +* --enable-portals configuration option <1>: Additional Configuration Options. + (line 9) +* --enable-portals configuration option: Portal Files. (line 6) +* --enable-switch configuration option: Additional Configuration Options. + (line 13) +* --exec option: Options. (line 111) +* --field-separator option: Options. (line 21) +* --file option: Options. (line 25) +* --gen-po option <1>: Options. (line 130) +* --gen-po option: String Extraction. (line 6) +* --help option: Options. (line 139) +* --lint option <1>: Options. (line 144) +* --lint option: Command Line. (line 20) +* --lint-old option: Options. (line 163) +* --non-decimal-data option <1>: Options. (line 168) +* --non-decimal-data option: Nondecimal Data. (line 6) +* --non-decimal-data option, strtonum function and: Nondecimal Data. + (line 36) +* --posix option: Options. (line 176) +* --posix option, --traditional option and: Options. (line 206) +* --profile option <1>: Options. (line 212) +* --profile option: Profiling. (line 15) +* --re-interval option: Options. (line 224) +* --source option: Options. (line 231) +* --traditional option: Options. (line 79) +* --traditional option, --posix option and: Options. (line 206) +* --usage option: Options. (line 139) +* --use-lc-numeric option: Options. (line 239) +* --version option: Options. (line 244) +* -f option: Options. (line 25) +* -F option <1>: Options. (line 21) +* -F option: Command Line Field Separator. + (line 6) +* -f option: Long. (line 12) +* -F option, -Ft sets FS to TAB: Options. (line 252) +* -f option, on command line: Options. (line 257) +* -F option, troubleshooting: Known Bugs. (line 6) +* -mf/-mr options: Options. (line 45) +* -v option: Options. (line 30) +* -v option, variables, assigning: Assignment Options. (line 12) +* -W option: Options. (line 55) +* . (period): Regexp Operators. (line 43) +* .mo files: Explaining gettext. (line 39) +* .mo files, converting from .po: I18N Example. (line 62) +* .mo files, specifying directory of <1>: Programmer i18n. (line 45) +* .mo files, specifying directory of: Explaining gettext. (line 51) +* .po files <1>: Translator i18n. (line 6) +* .po files: Explaining gettext. (line 36) +* .po files, converting to .mo: I18N Example. (line 62) +* / (forward slash): Regexp. (line 10) +* / (forward slash), / operator: Precedence. (line 55) +* / (forward slash), /= operator <1>: Precedence. (line 96) +* / (forward slash), /= operator: Assignment Ops. (line 129) +* / (forward slash), /= operator, vs. /=.../ regexp constant: Assignment Ops. + (line 148) +* / (forward slash), patterns and: Expression Patterns. (line 24) +* /= operator vs. /=.../ regexp constant: Assignment Ops. (line 148) +* /dev/... special files (gawk): Special FD. (line 41) +* /inet/ files (gawk): TCP/IP Networking. (line 6) +* /p files (gawk): Portal Files. (line 6) +* ; (semicolon): Statements/Lines. (line 90) +* ; (semicolon), AWKPATH variable and: PC Using. (line 11) +* ; (semicolon), separating statements in actions <1>: Statements. + (line 10) +* ; (semicolon), separating statements in actions: Action Overview. + (line 19) +* < (left angle bracket), < operator <1>: Precedence. (line 65) +* < (left angle bracket), < operator: Comparison Operators. + (line 11) +* < (left angle bracket), < operator (I/O): Getline/File. (line 6) +* < (left angle bracket), <= operator <1>: Precedence. (line 65) +* < (left angle bracket), <= operator: Comparison Operators. + (line 11) +* = (equals sign), = operator: Assignment Ops. (line 6) +* = (equals sign), == operator <1>: Precedence. (line 65) +* = (equals sign), == operator: Comparison Operators. + (line 11) +* > (right angle bracket), > operator <1>: Precedence. (line 65) +* > (right angle bracket), > operator: Comparison Operators. + (line 11) +* > (right angle bracket), > operator (I/O): Redirection. (line 19) +* > (right angle bracket), >= operator <1>: Precedence. (line 65) +* > (right angle bracket), >= operator: Comparison Operators. + (line 11) +* > (right angle bracket), >> operator (I/O) <1>: Precedence. (line 65) +* > (right angle bracket), >> operator (I/O): Redirection. (line 47) +* ? (question mark) <1>: GNU Regexp Operators. + (line 51) +* ? (question mark): Regexp Operators. (line 110) +* ? (question mark), ?: operator: Precedence. (line 93) +* [] (square brackets): Regexp Operators. (line 55) +* \ (backslash) <1>: Regexp Operators. (line 18) +* \ (backslash) <2>: Quoting. (line 27) +* \ (backslash) <3>: Comments. (line 50) +* \ (backslash): Read Terminal. (line 25) +* \ (backslash), \" escape sequence: Escape Sequences. (line 76) +* \ (backslash), \' operator (gawk): GNU Regexp Operators. + (line 48) +* \ (backslash), \/ escape sequence: Escape Sequences. (line 69) +* \ (backslash), \< operator (gawk): GNU Regexp Operators. + (line 22) +* \ (backslash), \> operator (gawk): GNU Regexp Operators. + (line 26) +* \ (backslash), \` operator (gawk): GNU Regexp Operators. + (line 46) +* \ (backslash), \a escape sequence: Escape Sequences. (line 34) +* \ (backslash), \b escape sequence: Escape Sequences. (line 38) +* \ (backslash), \B operator (gawk): GNU Regexp Operators. + (line 35) +* \ (backslash), \f escape sequence: Escape Sequences. (line 41) +* \ (backslash), \n escape sequence: Escape Sequences. (line 44) +* \ (backslash), \NNN escape sequence: Escape Sequences. (line 56) +* \ (backslash), \r escape sequence: Escape Sequences. (line 47) +* \ (backslash), \t escape sequence: Escape Sequences. (line 50) +* \ (backslash), \v escape sequence: Escape Sequences. (line 53) +* \ (backslash), \W operator (gawk): GNU Regexp Operators. + (line 18) +* \ (backslash), \w operator (gawk): GNU Regexp Operators. + (line 13) +* \ (backslash), \x escape sequence: Escape Sequences. (line 61) +* \ (backslash), \y operator (gawk): GNU Regexp Operators. + (line 30) +* \ (backslash), as field separators: Command Line Field Separator. + (line 27) +* \ (backslash), continuing lines and <1>: Egrep Program. (line 218) +* \ (backslash), continuing lines and: Statements/Lines. (line 19) +* \ (backslash), continuing lines and, comments and: Statements/Lines. + (line 75) +* \ (backslash), continuing lines and, in csh <1>: Statements/Lines. + (line 44) +* \ (backslash), continuing lines and, in csh: More Complex. (line 15) +* \ (backslash), gsub/gensub/sub functions and: Gory Details. (line 6) +* \ (backslash), in character lists: Character Lists. (line 17) +* \ (backslash), in escape sequences: Escape Sequences. (line 6) +* \ (backslash), in escape sequences, POSIX and: Escape Sequences. + (line 113) +* \ (backslash), regexp constants: Computed Regexps. (line 28) +* ^ (caret) <1>: GNU Regexp Operators. + (line 51) +* ^ (caret): Regexp Operators. (line 22) +* ^ (caret), ^ operator <1>: Options. (line 192) +* ^ (caret), ^ operator: Precedence. (line 49) +* ^ (caret), ^= operator <1>: Options. (line 192) +* ^ (caret), ^= operator <2>: Precedence. (line 96) +* ^ (caret), ^= operator: Assignment Ops. (line 129) +* ^ (caret), in character lists: Character Lists. (line 17) +* _ (underscore), _ C macro: Explaining gettext. (line 68) +* _ (underscore), in names of private variables: Library Names. + (line 29) +* _ (underscore), translatable string: Programmer i18n. (line 67) +* _gr_init user-defined function: Group Functions. (line 80) +* _pw_init user-defined function: Passwd Functions. (line 91) +* accessing fields: Fields. (line 6) +* account information <1>: Group Functions. (line 6) +* account information: Passwd Functions. (line 16) +* actions: Action Overview. (line 6) +* actions, control statements in: Statements. (line 6) +* actions, default: Very Simple. (line 34) +* actions, empty: Very Simple. (line 39) +* adding, features to gawk: Adding Code. (line 6) +* adding, fields: Changing Fields. (line 53) +* adding, functions to gawk: Dynamic Extensions. (line 10) +* advanced features, buffering: I/O Functions. (line 95) +* advanced features, close function: Close Files And Pipes. + (line 130) +* advanced features, constants, values of: Nondecimal-numbers. + (line 67) +* advanced features, data files as single record: Records. (line 170) +* advanced features, fixed-width data: Constant Size. (line 9) +* advanced features, FNR/NR variables: Auto-set. (line 187) +* advanced features, gawk: Advanced Features. (line 6) +* advanced features, gawk, BSD portals: Portal Files. (line 6) +* advanced features, gawk, network programming: TCP/IP Networking. + (line 6) +* advanced features, gawk, nondecimal input data: Nondecimal Data. + (line 6) +* advanced features, gawk, processes, communicating with: Two-way I/O. + (line 23) +* advanced features, network connections, See Also networks, connections: Advanced Features. + (line 6) +* advanced features, null strings, matching: Gory Details. (line 160) +* advanced features, operators, precedence: Increment Ops. (line 61) +* advanced features, piping into sh: Redirection. (line 140) +* advanced features, regexp constants: Assignment Ops. (line 148) +* Aho, Alfred <1>: Contributors. (line 12) +* Aho, Alfred: History. (line 17) +* alarm clock example program: Alarm Program. (line 9) +* alarm.awk program: Alarm Program. (line 27) +* algorithms: Basic High Level. (line 66) +* Alpha (DEC): Manual History. (line 28) +* amazing awk assembler (aaa): Glossary. (line 12) +* amazingly workable formatter (awf): Glossary. (line 20) +* ambiguity, syntactic: /= operator vs. /=.../ regexp constant: Assignment Ops. + (line 148) +* amiga: Amiga Installation. (line 6) +* ampersand (&), && operator: Boolean Ops. (line 57) +* ampersand (&), &&operator: Precedence. (line 87) +* ampersand (&), gsub/gensub/sub functions and: Gory Details. (line 6) +* AND bitwise operation: Bitwise Functions. (line 6) +* and Boolean-logic operator: Boolean Ops. (line 6) +* and function (gawk): Bitwise Functions. (line 39) +* ANSI: Glossary. (line 31) +* archeologists: Bugs. (line 6) +* ARGC/ARGV variables <1>: ARGC and ARGV. (line 6) +* ARGC/ARGV variables: Auto-set. (line 11) +* ARGC/ARGV variables, command-line arguments: Other Arguments. + (line 12) +* ARGC/ARGV variables, portability and: Executable Scripts. (line 43) +* ARGIND variable: Auto-set. (line 40) +* ARGIND variable, command-line arguments: Other Arguments. (line 12) +* arguments, command-line <1>: Other Arguments. (line 6) +* arguments, command-line <2>: ARGC and ARGV. (line 6) +* arguments, command-line: Auto-set. (line 11) +* arguments, command-line, invoking awk: Command Line. (line 6) +* arguments, in function calls: Function Calls. (line 16) +* arguments, processing: Getopt Function. (line 6) +* arguments, retrieving: Internals. (line 121) +* arithmetic operators: Arithmetic Ops. (line 6) +* arrays: Arrays. (line 6) +* arrays, as parameters to functions: Function Caveats. (line 55) +* arrays, associative: Array Intro. (line 45) +* arrays, associative, clearing: Internals. (line 66) +* arrays, associative, library functions and: Library Names. (line 57) +* arrays, deleting entire contents: Delete. (line 39) +* arrays, elements, assigning: Assigning Elements. (line 6) +* arrays, elements, deleting: Delete. (line 6) +* arrays, elements, installing: Internals. (line 70) +* arrays, elements, order of: Scanning an Array. (line 47) +* arrays, elements, referencing: Reference to Elements. + (line 6) +* arrays, elements, retrieving number of: String Functions. (line 18) +* arrays, for statement and: Scanning an Array. (line 20) +* arrays, IGNORECASE variable and: Array Intro. (line 87) +* arrays, indexing: Array Intro. (line 45) +* arrays, merging into strings: Join Function. (line 6) +* arrays, multidimensional: Multi-dimensional. (line 6) +* arrays, multidimensional, scanning: Multi-scanning. (line 11) +* arrays, names of: Arrays. (line 17) +* arrays, scanning: Scanning an Array. (line 6) +* arrays, sorting: Array Sorting. (line 6) +* arrays, sorting, IGNORECASE variable and: Array Sorting. (line 86) +* arrays, sparse: Array Intro. (line 66) +* arrays, subscripts: Numeric Array Subscripts. + (line 6) +* arrays, subscripts, uninitialized variables as: Uninitialized Subscripts. + (line 6) +* artificial intelligence, gawk and: Distribution contents. + (line 47) +* ASCII: Ordinal Functions. (line 44) +* asort function (gawk) <1>: String Functions. (line 18) +* asort function (gawk): Array Sorting. (line 6) +* asort function (gawk), arrays, sorting: Array Sorting. (line 6) +* asorti function (gawk): String Functions. (line 47) +* assert function (C library): Assert Function. (line 6) +* assert user-defined function: Assert Function. (line 28) +* assertions: Assert Function. (line 6) +* assignment operators: Assignment Ops. (line 6) +* assignment operators, evaluation order: Assignment Ops. (line 111) +* assignment operators, lvalues/rvalues: Assignment Ops. (line 32) +* assignments as filenames: Ignoring Assigns. (line 6) +* assoc_clear internal function: Internals. (line 66) +* assoc_lookup internal function: Internals. (line 70) +* associative arrays: Array Intro. (line 45) +* asterisk (*), * operator, as multiplication operator: Precedence. + (line 55) +* asterisk (*), * operator, as regexp operator: Regexp Operators. + (line 86) +* asterisk (*), * operator, null strings, matching: Gory Details. + (line 160) +* asterisk (*), ** operator <1>: Options. (line 192) +* asterisk (*), ** operator <2>: Precedence. (line 49) +* asterisk (*), ** operator: Arithmetic Ops. (line 81) +* asterisk (*), **= operator <1>: Options. (line 192) +* asterisk (*), **= operator <2>: Precedence. (line 96) +* asterisk (*), **= operator: Assignment Ops. (line 129) +* asterisk (*), *= operator <1>: Precedence. (line 96) +* asterisk (*), *= operator: Assignment Ops. (line 129) +* atan2 function: Numeric Functions. (line 37) +* atari: Atari Installation. (line 9) +* awf (amazingly workable formatter) program: Glossary. (line 20) +* awk language, POSIX version: Assignment Ops. (line 136) +* awk programs <1>: Two Rules. (line 6) +* awk programs <2>: Executable Scripts. (line 6) +* awk programs: Getting Started. (line 12) +* awk programs, complex: When. (line 30) +* awk programs, documenting <1>: Library Names. (line 6) +* awk programs, documenting: Comments. (line 6) +* awk programs, examples of: Sample Programs. (line 6) +* awk programs, execution of: Next Statement. (line 16) +* awk programs, internationalizing <1>: Programmer i18n. (line 6) +* awk programs, internationalizing: I18N Functions. (line 6) +* awk programs, lengthy: Long. (line 6) +* awk programs, lengthy, assertions: Assert Function. (line 6) +* awk programs, location of: Options. (line 25) +* awk programs, one-line examples: Very Simple. (line 45) +* awk programs, profiling: Profiling. (line 6) +* awk programs, profiling, enabling: Options. (line 212) +* awk programs, running <1>: Long. (line 6) +* awk programs, running: Running gawk. (line 6) +* awk programs, running, from shell scripts: One-shot. (line 22) +* awk programs, running, without input files: Read Terminal. (line 17) +* awk programs, shell variables in: Using Shell Variables. + (line 6) +* awk, function of: Getting Started. (line 6) +* awk, gawk and <1>: This Manual. (line 13) +* awk, gawk and: Preface. (line 22) +* awk, history of: History. (line 17) +* awk, implementation issues, pipes: Redirection. (line 132) +* awk, implementations: Other Versions. (line 6) +* awk, implementations, limits: Getline Notes. (line 14) +* awk, invoking: Command Line. (line 6) +* awk, new vs. old: Names. (line 6) +* awk, new vs. old, OFMT variable: Conversion. (line 54) +* awk, POSIX and: Preface. (line 22) +* awk, POSIX and, See Also POSIX awk: Preface. (line 22) +* awk, regexp constants and: Comparison Operators. + (line 102) +* awk, See Also gawk: Preface. (line 35) +* awk, terms describing: This Manual. (line 6) +* awk, uses for <1>: When. (line 6) +* awk, uses for <2>: Getting Started. (line 12) +* awk, uses for: Preface. (line 22) +* awk, versions of <1>: V7/SVR3.1. (line 6) +* awk, versions of: Names. (line 10) +* awk, versions of, changes between SVR3.1 and SVR4: SVR4. (line 6) +* awk, versions of, changes between SVR4 and POSIX awk: POSIX. + (line 6) +* awk, versions of, changes between V7 and SVR3.1: V7/SVR3.1. (line 6) +* awk, versions of, See Also Bell Laboratories awk: BTL. (line 6) +* awk.h file (internal): Internals. (line 15) +* awka compiler for awk: Other Versions. (line 76) +* AWKNUM internal type: Internals. (line 19) +* AWKPATH environment variable <1>: PC Using. (line 11) +* AWKPATH environment variable: AWKPATH Variable. (line 6) +* awkprof.out file: Profiling. (line 10) +* awksed.awk program: Simple Sed. (line 25) +* awkvars.out file: Options. (line 95) +* backslash (\) <1>: Regexp Operators. (line 18) +* backslash (\) <2>: Quoting. (line 27) +* backslash (\) <3>: Comments. (line 50) +* backslash (\): Read Terminal. (line 25) +* backslash (\), \" escape sequence: Escape Sequences. (line 76) +* backslash (\), \' operator (gawk): GNU Regexp Operators. + (line 48) +* backslash (\), \/ escape sequence: Escape Sequences. (line 69) +* backslash (\), \< operator (gawk): GNU Regexp Operators. + (line 22) +* backslash (\), \> operator (gawk): GNU Regexp Operators. + (line 26) +* backslash (\), \` operator (gawk): GNU Regexp Operators. + (line 46) +* backslash (\), \a escape sequence: Escape Sequences. (line 34) +* backslash (\), \b escape sequence: Escape Sequences. (line 38) +* backslash (\), \B operator (gawk): GNU Regexp Operators. + (line 35) +* backslash (\), \f escape sequence: Escape Sequences. (line 41) +* backslash (\), \n escape sequence: Escape Sequences. (line 44) +* backslash (\), \NNN escape sequence: Escape Sequences. (line 56) +* backslash (\), \r escape sequence: Escape Sequences. (line 47) +* backslash (\), \t escape sequence: Escape Sequences. (line 50) +* backslash (\), \v escape sequence: Escape Sequences. (line 53) +* backslash (\), \W operator (gawk): GNU Regexp Operators. + (line 18) +* backslash (\), \w operator (gawk): GNU Regexp Operators. + (line 13) +* backslash (\), \x escape sequence: Escape Sequences. (line 61) +* backslash (\), \y operator (gawk): GNU Regexp Operators. + (line 30) +* backslash (\), as field separators: Command Line Field Separator. + (line 27) +* backslash (\), continuing lines and <1>: Egrep Program. (line 218) +* backslash (\), continuing lines and: Statements/Lines. (line 19) +* backslash (\), continuing lines and, comments and: Statements/Lines. + (line 75) +* backslash (\), continuing lines and, in csh <1>: Statements/Lines. + (line 44) +* backslash (\), continuing lines and, in csh: More Complex. (line 15) +* backslash (\), gsub/gensub/sub functions and: Gory Details. (line 6) +* backslash (\), in character lists: Character Lists. (line 17) +* backslash (\), in escape sequences: Escape Sequences. (line 6) +* backslash (\), in escape sequences, POSIX and: Escape Sequences. + (line 113) +* backslash (\), regexp constants: Computed Regexps. (line 28) +* BBS-list file: Sample Data Files. (line 6) +* Beebe, Nelson: Acknowledgments. (line 53) +* Beebe, Nelson H.F.: Other Versions. (line 88) +* BEGIN pattern <1>: BEGIN/END. (line 6) +* BEGIN pattern <2>: Field Separators. (line 43) +* BEGIN pattern: Records. (line 29) +* BEGIN pattern, assert user-defined function and: Assert Function. + (line 82) +* BEGIN pattern, Boolean patterns and: Expression Patterns. (line 73) +* BEGIN pattern, exit statement and: Exit Statement. (line 12) +* BEGIN pattern, getline and: Getline Notes. (line 19) +* BEGIN pattern, headings, adding: Print Examples. (line 43) +* BEGIN pattern, next/nextfile statements and <1>: Next Statement. + (line 39) +* BEGIN pattern, next/nextfile statements and: I/O And BEGIN/END. + (line 36) +* BEGIN pattern, OFS/ORS variables, assigning values to: Output Separators. + (line 20) +* BEGIN pattern, operators and: Using BEGIN/END. (line 17) +* BEGIN pattern, pgawk program: Profiling. (line 69) +* BEGIN pattern, print statement and: I/O And BEGIN/END. (line 16) +* BEGIN pattern, pwcat program: Passwd Functions. (line 125) +* BEGIN pattern, running awk programs and: Cut Program. (line 66) +* BEGIN pattern, TEXTDOMAIN variable and: Programmer i18n. (line 58) +* beginfile user-defined function: Filetrans Function. (line 60) +* Bell Laboratories awk extensions: BTL. (line 6) +* Benzinger, Michael: Contributors. (line 86) +* BeOS: BeOS Installation. (line 6) +* Berry, Karl: Acknowledgments. (line 30) +* binary input/output: User-modified. (line 10) +* bindtextdomain function (C library): Explaining gettext. (line 47) +* bindtextdomain function (gawk) <1>: Programmer i18n. (line 45) +* bindtextdomain function (gawk): I18N Functions. (line 26) +* bindtextdomain function (gawk), portability and: I18N Portability. + (line 32) +* BINMODE variable <1>: PC Using. (line 40) +* BINMODE variable: User-modified. (line 10) +* bits2str user-defined function: Bitwise Functions. (line 60) +* bitwise, complement: Bitwise Functions. (line 25) +* bitwise, operations: Bitwise Functions. (line 6) +* bitwise, shift: Bitwise Functions. (line 32) +* body, in actions: Statements. (line 10) +* body, in loops: While Statement. (line 14) +* Boolean expressions: Boolean Ops. (line 6) +* Boolean expressions, as patterns: Expression Patterns. (line 41) +* Boolean operators, See Boolean expressions: Boolean Ops. (line 6) +* Bourne shell, quoting rules for: Quoting. (line 14) +* braces ({}), actions and: Action Overview. (line 19) +* braces ({}), pgawk program: Profiling. (line 140) +* braces ({}), statements, grouping: Statements. (line 10) +* bracket expressions, See character lists: Regexp Operators. (line 55) +* break statement: Break Statement. (line 6) +* Brennan, Michael <1>: Other Versions. (line 6) +* Brennan, Michael <2>: Simple Sed. (line 25) +* Brennan, Michael <3>: Two-way I/O. (line 6) +* Brennan, Michael: Delete. (line 51) +* Broder, Alan J.: Contributors. (line 77) +* Brown, Martin <1>: Bugs. (line 57) +* Brown, Martin <2>: Contributors. (line 72) +* Brown, Martin: Acknowledgments. (line 53) +* BSD portals: Portal Files. (line 6) +* BSD-based operating systems: Glossary. (line 582) +* Buening, Andreas <1>: Contributors. (line 81) +* Buening, Andreas: Acknowledgments. (line 53) +* buffering, input/output <1>: Two-way I/O. (line 71) +* buffering, input/output: I/O Functions. (line 127) +* buffering, interactive vs. noninteractive: I/O Functions. (line 95) +* buffers, flushing: I/O Functions. (line 29) +* buffers, operators for: GNU Regexp Operators. + (line 40) +* bug reports, email address, bug-gawk@gnu.org: Bugs. (line 27) +* bug-gawk@gnu.org bug reporting address: Bugs. (line 27) +* built-in functions: Functions. (line 6) +* built-in functions, evaluation order: Calling Built-in. (line 30) +* built-in variables: Built-in Variables. (line 6) +* built-in variables, -v option, setting with: Options. (line 38) +* built-in variables, conveying information: Auto-set. (line 6) +* built-in variables, user-modifiable: User-modified. (line 6) +* call by reference: Function Caveats. (line 55) +* call by value: Function Caveats. (line 26) +* caret (^) <1>: GNU Regexp Operators. + (line 51) +* caret (^): Regexp Operators. (line 22) +* caret (^), ^ operator <1>: Options. (line 192) +* caret (^), ^ operator: Precedence. (line 49) +* caret (^), ^= operator <1>: Options. (line 192) +* caret (^), ^= operator <2>: Precedence. (line 96) +* caret (^), ^= operator: Assignment Ops. (line 129) +* caret (^), in character lists: Character Lists. (line 17) +* case keyword: Switch Statement. (line 6) +* case sensitivity, array indices and: Array Intro. (line 87) +* case sensitivity, converting case: String Functions. (line 453) +* case sensitivity, example programs: Library Functions. (line 43) +* case sensitivity, gawk: Case-sensitivity. (line 26) +* case sensitivity, regexps and <1>: User-modified. (line 68) +* case sensitivity, regexps and: Case-sensitivity. (line 6) +* case sensitivity, string comparisons and: User-modified. (line 68) +* CGI, awk scripts for: Options. (line 111) +* character encodings: Ordinal Functions. (line 44) +* character lists <1>: Character Lists. (line 6) +* character lists: Regexp Operators. (line 55) +* character lists, character classes: Character Lists. (line 30) +* character lists, collating elements: Character Lists. (line 71) +* character lists, collating symbols: Character Lists. (line 78) +* character lists, complemented: Regexp Operators. (line 62) +* character lists, equivalence classes: Character Lists. (line 84) +* character lists, non-ASCII: Character Lists. (line 71) +* character lists, range expressions: Character Lists. (line 6) +* character sets: Ordinal Functions. (line 44) +* character sets (machine character encodings): Glossary. (line 138) +* character sets, See Also character lists: Regexp Operators. (line 55) +* characters, counting: Wc Program. (line 6) +* characters, transliterating: Translate Program. (line 6) +* characters, values of as numbers: Ordinal Functions. (line 6) +* Chassell, Robert J.: Acknowledgments. (line 30) +* chdir function, implementing in gawk: Sample Library. (line 6) +* chem utility: Glossary. (line 146) +* chr user-defined function: Ordinal Functions. (line 16) +* Cliff random numbers: Cliff Random Function. + (line 6) +* cliff_rand user-defined function: Cliff Random Function. + (line 11) +* close function <1>: I/O Functions. (line 10) +* close function <2>: Close Files And Pipes. + (line 18) +* close function <3>: Getline/Pipe. (line 24) +* close function: Getline/Variable/File. + (line 30) +* close function, return values: Close Files And Pipes. + (line 130) +* close function, two-way pipes and: Two-way I/O. (line 78) +* Close, Diane <1>: Contributors. (line 21) +* Close, Diane: Manual History. (line 40) +* close_func input method: Internals. (line 178) +* collating elements: Character Lists. (line 71) +* collating symbols: Character Lists. (line 78) +* columns, aligning: Print Examples. (line 70) +* columns, cutting: Cut Program. (line 6) +* comma (,), in range patterns: Ranges. (line 6) +* command line, arguments <1>: Other Arguments. (line 6) +* command line, arguments <2>: ARGC and ARGV. (line 6) +* command line, arguments: Auto-set. (line 11) +* command line, formats: Running gawk. (line 12) +* command line, FS on, setting: Command Line Field Separator. + (line 6) +* command line, invoking awk from: Command Line. (line 6) +* command line, options <1>: Options. (line 6) +* command line, options <2>: Command Line Field Separator. + (line 6) +* command line, options: Long. (line 12) +* command line, options, end of: Options. (line 62) +* command line, variables, assigning on: Assignment Options. (line 6) +* command-line options, processing: Getopt Function. (line 6) +* command-line options, string extraction: String Extraction. (line 6) +* commenting: Comments. (line 6) +* commenting, backslash continuation and: Statements/Lines. (line 75) +* comp.lang.awk newsgroup: Bugs. (line 37) +* comparison expressions: Typing and Comparison. + (line 9) +* comparison expressions, as patterns: Expression Patterns. (line 14) +* comparison expressions, string vs. regexp: Comparison Operators. + (line 79) +* compatibility mode (gawk), extensions: POSIX/GNU. (line 6) +* compatibility mode (gawk), file names: Special Caveats. (line 9) +* compatibility mode (gawk), hexadecimal numbers: Nondecimal-numbers. + (line 60) +* compatibility mode (gawk), octal numbers: Nondecimal-numbers. + (line 60) +* compatibility mode (gawk), specifying: Options. (line 79) +* compiled programs <1>: Glossary. (line 156) +* compiled programs: Basic High Level. (line 14) +* compl function (gawk): Bitwise Functions. (line 43) +* complement, bitwise: Bitwise Functions. (line 25) +* compound statements, control statements and: Statements. (line 10) +* concatenating: Concatenation. (line 9) +* conditional expressions: Conditional Exp. (line 6) +* configuration option, --disable-directories-fatal: Additional Configuration Options. + (line 37) +* configuration option, --disable-lint: Additional Configuration Options. + (line 17) +* configuration option, --disable-nls: Additional Configuration Options. + (line 32) +* configuration option, --enable-portals: Additional Configuration Options. + (line 9) +* configuration option, --enable-switch: Additional Configuration Options. + (line 13) +* configuration options, gawk: Additional Configuration Options. + (line 6) +* constants, nondecimal: Nondecimal Data. (line 6) +* constants, types of: Constants. (line 6) +* continue statement: Continue Statement. (line 6) +* control statements: Statements. (line 6) +* converting, case: String Functions. (line 453) +* converting, dates to timestamps: Time Functions. (line 72) +* converting, during subscripting: Numeric Array Subscripts. + (line 31) +* converting, numbers: Conversion. (line 6) +* converting, numbers, to strings: Bitwise Functions. (line 99) +* converting, strings to numbers: Conversion. (line 6) +* CONVFMT variable <1>: User-modified. (line 26) +* CONVFMT variable: Conversion. (line 29) +* CONVFMT variable, array subscripts and: Numeric Array Subscripts. + (line 6) +* coprocesses <1>: Two-way I/O. (line 44) +* coprocesses: Redirection. (line 99) +* coprocesses, closing: Close Files And Pipes. + (line 6) +* coprocesses, getline from: Getline/Coprocess. (line 6) +* cos function: Numeric Functions. (line 34) +* counting: Wc Program. (line 6) +* csh utility: Statements/Lines. (line 44) +* csh utility, backslash continuation and: More Complex. (line 15) +* csh utility, POSIXLY_CORRECT environment variable: Options. (line 295) +* csh utility, |& operator, comparison with: Two-way I/O. (line 44) +* ctime user-defined function: Function Example. (line 72) +* currency symbols, localization: Explaining gettext. (line 99) +* custom.h file: Configuration Philosophy. + (line 29) +* cut utility: Cut Program. (line 6) +* cut.awk program: Cut Program. (line 44) +* d.c., See dark corner: Conventions. (line 37) +* dark corner <1>: Glossary. (line 188) +* dark corner <2>: Truth Values. (line 24) +* dark corner <3>: Assignment Ops. (line 148) +* dark corner <4>: Format Modifiers. (line 59) +* dark corner: Conventions. (line 37) +* dark corner, array subscripts: Uninitialized Subscripts. + (line 42) +* dark corner, break statement: Break Statement. (line 47) +* dark corner, close function: Close Files And Pipes. + (line 130) +* dark corner, command-line arguments: Assignment Options. (line 43) +* dark corner, continue statement: Continue Statement. (line 43) +* dark corner, CONVFMT variable: Conversion. (line 40) +* dark corner, escape sequences: Other Arguments. (line 31) +* dark corner, escape sequences, for metacharacters: Escape Sequences. + (line 136) +* dark corner, exit statement: Exit Statement. (line 29) +* dark corner, field separators: Field Splitting Summary. + (line 47) +* dark corner, FILENAME variable <1>: Auto-set. (line 88) +* dark corner, FILENAME variable: Getline Notes. (line 19) +* dark corner, FNR/NR variables: Auto-set. (line 187) +* dark corner, format-control characters: Control Letters. (line 80) +* dark corner, FS as null string: Single Character Fields. + (line 20) +* dark corner, input files: Records. (line 98) +* dark corner, invoking awk: Command Line. (line 16) +* dark corner, multiline records: Multiple Line. (line 35) +* dark corner, NF variable, decrementing: Changing Fields. (line 107) +* dark corner, OFMT variable: OFMT. (line 27) +* dark corner, regexp constants: Using Constant Regexps. + (line 6) +* dark corner, regexp constants, /= operator and: Assignment Ops. + (line 148) +* dark corner, regexp constants, as arguments to user-defined functions: Using Constant Regexps. + (line 44) +* dark corner, split function: String Functions. (line 220) +* dark corner, strings, storing: Records. (line 186) +* data, fixed-width: Constant Size. (line 9) +* data-driven languages: Basic High Level. (line 83) +* database, group, reading: Group Functions. (line 6) +* database, users, reading: Passwd Functions. (line 6) +* date utility, GNU: Time Functions. (line 17) +* date utility, POSIX: Time Functions. (line 259) +* dates, converting to timestamps: Time Functions. (line 72) +* dates, information related to, localization: Explaining gettext. + (line 111) +* Davies, Stephen <1>: Bugs. (line 62) +* Davies, Stephen: Contributors. (line 68) +* dcgettext function (gawk) <1>: Programmer i18n. (line 19) +* dcgettext function (gawk): I18N Functions. (line 12) +* dcgettext function (gawk), portability and: I18N Portability. + (line 32) +* dcngettext function (gawk) <1>: Programmer i18n. (line 35) +* dcngettext function (gawk): I18N Functions. (line 18) +* dcngettext function (gawk), portability and: I18N Portability. + (line 32) +* deadlocks: Two-way I/O. (line 71) +* debugging gawk: Known Bugs. (line 6) +* debugging gawk, bug reports: Bugs. (line 9) +* decimal point character, locale specific: Options. (line 200) +* decrement operators: Increment Ops. (line 35) +* default keyword: Switch Statement. (line 6) +* Deifik, Scott <1>: Bugs. (line 58) +* Deifik, Scott <2>: Contributors. (line 52) +* Deifik, Scott: Acknowledgments. (line 53) +* delete statement: Delete. (line 6) +* deleting elements in arrays: Delete. (line 6) +* deleting entire arrays: Delete. (line 39) +* differences between gawk and awk: String Functions. (line 88) +* differences in awk and gawk, ARGC/ARGV variables: ARGC and ARGV. + (line 85) +* differences in awk and gawk, ARGIND variable: Auto-set. (line 40) +* differences in awk and gawk, array elements, deleting: Delete. + (line 39) +* differences in awk and gawk, AWKPATH environment variable: AWKPATH Variable. + (line 6) +* differences in awk and gawk, BEGIN/END patterns: I/O And BEGIN/END. + (line 16) +* differences in awk and gawk, BINMODE variable <1>: PC Using. + (line 40) +* differences in awk and gawk, BINMODE variable: User-modified. + (line 21) +* differences in awk and gawk, close function: Close Files And Pipes. + (line 81) +* differences in awk and gawk, ERRNO variable: Auto-set. (line 72) +* differences in awk and gawk, error messages: Special FD. (line 15) +* differences in awk and gawk, FIELDWIDTHS variable: User-modified. + (line 33) +* differences in awk and gawk, function arguments (gawk): Calling Built-in. + (line 16) +* differences in awk and gawk, getline command: Getline. (line 19) +* differences in awk and gawk, IGNORECASE variable: User-modified. + (line 68) +* differences in awk and gawk, implementation limitations <1>: Redirection. + (line 132) +* differences in awk and gawk, implementation limitations: Getline Notes. + (line 14) +* differences in awk and gawk, input/output operators <1>: Redirection. + (line 99) +* differences in awk and gawk, input/output operators: Getline/Coprocess. + (line 6) +* differences in awk and gawk, line continuations: Conditional Exp. + (line 34) +* differences in awk and gawk, LINT variable: User-modified. (line 83) +* differences in awk and gawk, match function: String Functions. + (line 151) +* differences in awk and gawk, next/nextfile statements: Nextfile Statement. + (line 6) +* differences in awk and gawk, print/printf statements: Format Modifiers. + (line 13) +* differences in awk and gawk, PROCINFO array: Auto-set. (line 119) +* differences in awk and gawk, record separators: Records. (line 112) +* differences in awk and gawk, regexp constants: Using Constant Regexps. + (line 44) +* differences in awk and gawk, regular expressions: Case-sensitivity. + (line 26) +* differences in awk and gawk, RS/RT variables: Records. (line 162) +* differences in awk and gawk, RT variable: Auto-set. (line 176) +* differences in awk and gawk, single-character fields: Single Character Fields. + (line 6) +* differences in awk and gawk, split function: String Functions. + (line 209) +* differences in awk and gawk, strings: Scalar Constants. (line 20) +* differences in awk and gawk, strings, storing: Records. (line 182) +* differences in awk and gawk, strtonum function (gawk): String Functions. + (line 247) +* differences in awk and gawk, TEXTDOMAIN variable: User-modified. + (line 138) +* differences in awk and gawk, trunc-mod operation: Arithmetic Ops. + (line 66) +* directories, changing: Sample Library. (line 6) +* directories, searching <1>: Igawk Program. (line 358) +* directories, searching: AWKPATH Variable. (line 6) +* division: Arithmetic Ops. (line 44) +* do-while statement <1>: Do Statement. (line 6) +* do-while statement: Regexp Usage. (line 19) +* documentation, of awk programs: Library Names. (line 6) +* documentation, online: Manual History. (line 11) +* documents, searching: Dupword Program. (line 6) +* dollar sign ($): Regexp Operators. (line 35) +* dollar sign ($), $ field operator <1>: Precedence. (line 43) +* dollar sign ($), $ field operator: Fields. (line 19) +* dollar sign ($), incrementing fields and arrays: Increment Ops. + (line 30) +* double quote (") <1>: Quoting. (line 33) +* double quote ("): Read Terminal. (line 25) +* double quote ("), regexp constants: Computed Regexps. (line 28) +* double-precision floating-point: Basic Data Typing. (line 33) +* Drepper, Ulrich: Acknowledgments. (line 49) +* dupnode internal function: Internals. (line 97) +* dupword.awk program: Dupword Program. (line 31) +* EBCDIC: Ordinal Functions. (line 44) +* egrep utility <1>: Egrep Program. (line 6) +* egrep utility: Character Lists. (line 24) +* egrep.awk program: Egrep Program. (line 54) +* elements in arrays: Reference to Elements. + (line 6) +* elements in arrays, assigning: Assigning Elements. (line 6) +* elements in arrays, deleting: Delete. (line 6) +* elements in arrays, order of: Scanning an Array. (line 47) +* elements in arrays, scanning: Scanning an Array. (line 6) +* email address for bug reports, bug-gawk@gnu.org: Bugs. (line 27) +* EMISTERED: TCP/IP Networking. (line 6) +* empty pattern: Empty. (line 6) +* empty strings, See null strings: Regexp Field Splitting. + (line 43) +* END pattern: BEGIN/END. (line 6) +* END pattern, assert user-defined function and: Assert Function. + (line 74) +* END pattern, backslash continuation and: Egrep Program. (line 218) +* END pattern, Boolean patterns and: Expression Patterns. (line 73) +* END pattern, exit statement and: Exit Statement. (line 12) +* END pattern, next/nextfile statements and <1>: Next Statement. + (line 39) +* END pattern, next/nextfile statements and: I/O And BEGIN/END. + (line 36) +* END pattern, operators and: Using BEGIN/END. (line 17) +* END pattern, pgawk program: Profiling. (line 69) +* END pattern, print statement and: I/O And BEGIN/END. (line 16) +* endfile user-defined function: Filetrans Function. (line 60) +* endgrent function (C library): Group Functions. (line 213) +* endgrent user-defined function: Group Functions. (line 216) +* endpwent function (C library): Passwd Functions. (line 192) +* endpwent user-defined function: Passwd Functions. (line 195) +* ENVIRON variable <1>: Internals. (line 165) +* ENVIRON variable: Auto-set. (line 60) +* environment variables: Auto-set. (line 60) +* epoch, definition of: Glossary. (line 230) +* equals sign (=), = operator: Assignment Ops. (line 6) +* equals sign (=), == operator <1>: Precedence. (line 65) +* equals sign (=), == operator: Comparison Operators. + (line 11) +* EREs (Extended Regular Expressions): Character Lists. (line 24) +* ERRNO variable <1>: Internals. (line 152) +* ERRNO variable <2>: Auto-set. (line 72) +* ERRNO variable: Getline. (line 19) +* error handling: Special FD. (line 15) +* error handling, ERRNO variable and: Auto-set. (line 72) +* error output: Special FD. (line 6) +* escape processing, gsub/gensub/sub functions: Gory Details. (line 6) +* escape sequences: Escape Sequences. (line 6) +* escape sequences, unrecognized: Options. (line 180) +* evaluation order: Increment Ops. (line 61) +* evaluation order, concatenation: Concatenation. (line 42) +* evaluation order, functions: Calling Built-in. (line 30) +* examining fields: Fields. (line 6) +* exclamation point (!), ! operator <1>: Egrep Program. (line 160) +* exclamation point (!), ! operator <2>: Precedence. (line 52) +* exclamation point (!), ! operator: Boolean Ops. (line 67) +* exclamation point (!), != operator <1>: Precedence. (line 65) +* exclamation point (!), != operator: Comparison Operators. + (line 11) +* exclamation point (!), !~ operator <1>: Expression Patterns. + (line 24) +* exclamation point (!), !~ operator <2>: Precedence. (line 81) +* exclamation point (!), !~ operator <3>: Comparison Operators. + (line 11) +* exclamation point (!), !~ operator <4>: Regexp Constants. (line 6) +* exclamation point (!), !~ operator <5>: Computed Regexps. (line 6) +* exclamation point (!), !~ operator <6>: Case-sensitivity. (line 26) +* exclamation point (!), !~ operator: Regexp Usage. (line 19) +* exit statement: Exit Statement. (line 6) +* exp function: Numeric Functions. (line 22) +* expand utility: Very Simple. (line 69) +* expressions: Expressions. (line 6) +* expressions, as patterns: Expression Patterns. (line 6) +* expressions, assignment: Assignment Ops. (line 6) +* expressions, Boolean: Boolean Ops. (line 6) +* expressions, comparison: Typing and Comparison. + (line 9) +* expressions, conditional: Conditional Exp. (line 6) +* expressions, matching, See comparison expressions: Typing and Comparison. + (line 9) +* expressions, selecting: Conditional Exp. (line 6) +* Extended Regular Expressions (EREs): Character Lists. (line 24) +* extension function (gawk): Using Internal File Ops. + (line 15) +* extensions, Bell Laboratories awk: BTL. (line 6) +* extensions, in gawk, not in POSIX awk: POSIX/GNU. (line 6) +* extensions, mawk: Other Versions. (line 46) +* extract.awk program: Extract Program. (line 77) +* extraction, of marked strings (internationalization): String Extraction. + (line 6) +* false, logical: Truth Values. (line 6) +* FDL (Free Documentation License): GNU Free Documentation License. + (line 6) +* features, adding to gawk: Adding Code. (line 6) +* features, advanced, See advanced features: Obsolete. (line 6) +* features, deprecated: Obsolete. (line 6) +* features, undocumented: Undocumented. (line 6) +* Fenlason, Jay <1>: Contributors. (line 19) +* Fenlason, Jay: History. (line 30) +* fflush function: I/O Functions. (line 25) +* fflush function, unsupported: Options. (line 203) +* field numbers: Nonconstant Fields. (line 6) +* field operator $: Fields. (line 19) +* field operators, dollar sign as: Fields. (line 19) +* field separators <1>: User-modified. (line 43) +* field separators: Field Separators. (line 13) +* field separators, choice of: Field Separators. (line 49) +* field separators, FIELDWIDTHS variable and: User-modified. (line 33) +* field separators, in multiline records: Multiple Line. (line 41) +* field separators, on command line: Command Line Field Separator. + (line 6) +* field separators, POSIX and <1>: Field Splitting Summary. + (line 41) +* field separators, POSIX and: Fields. (line 6) +* field separators, regular expressions as <1>: Regexp Field Splitting. + (line 6) +* field separators, regular expressions as: Field Separators. (line 49) +* field separators, See Also OFS: Changing Fields. (line 64) +* field separators, spaces as: Cut Program. (line 106) +* fields <1>: Basic High Level. (line 71) +* fields <2>: Fields. (line 6) +* fields: Reading Files. (line 14) +* fields, adding: Changing Fields. (line 53) +* fields, changing contents of: Changing Fields. (line 6) +* fields, cutting: Cut Program. (line 6) +* fields, examining: Fields. (line 6) +* fields, number of: Fields. (line 33) +* fields, numbers: Nonconstant Fields. (line 6) +* fields, printing: Print Examples. (line 21) +* fields, separating: Field Separators. (line 13) +* fields, single-character: Single Character Fields. + (line 6) +* FIELDWIDTHS variable <1>: User-modified. (line 33) +* FIELDWIDTHS variable: Constant Size. (line 22) +* file descriptors: Special FD. (line 6) +* file names, distinguishing: Auto-set. (line 52) +* file names, in compatibility mode: Special Caveats. (line 9) +* file names, standard streams in gawk: Special FD. (line 41) +* FILENAME variable <1>: Auto-set. (line 88) +* FILENAME variable: Reading Files. (line 6) +* FILENAME variable, getline, setting with: Getline Notes. (line 19) +* filenames, assignments as: Ignoring Assigns. (line 6) +* files, .mo: Explaining gettext. (line 39) +* files, .mo, converting from .po: I18N Example. (line 62) +* files, .mo, specifying directory of <1>: Programmer i18n. (line 45) +* files, .mo, specifying directory of: Explaining gettext. (line 51) +* files, .po <1>: Translator i18n. (line 6) +* files, .po: Explaining gettext. (line 36) +* files, .po, converting to .mo: I18N Example. (line 62) +* files, /dev/... special files: Special FD. (line 41) +* files, /inet/ (gawk): TCP/IP Networking. (line 6) +* files, /p (gawk): Portal Files. (line 6) +* files, as single records: Records. (line 191) +* files, awk programs in: Long. (line 6) +* files, awkprof.out: Profiling. (line 10) +* files, awkvars.out: Options. (line 95) +* files, closing: I/O Functions. (line 10) +* files, descriptors, See file descriptors: Special FD. (line 6) +* files, for process information: Special Process. (line 6) +* files, group: Group Functions. (line 6) +* files, information about, retrieving: Sample Library. (line 6) +* files, initialization and cleanup: Filetrans Function. (line 6) +* files, input, See input files: Read Terminal. (line 17) +* files, log, timestamps in: Time Functions. (line 6) +* files, managing: Data File Management. + (line 6) +* files, managing, data file boundaries: Filetrans Function. (line 6) +* files, message object: Explaining gettext. (line 39) +* files, message object, converting from portable object files: I18N Example. + (line 62) +* files, message object, specifying directory of <1>: Programmer i18n. + (line 45) +* files, message object, specifying directory of: Explaining gettext. + (line 51) +* files, multiple passes over: Other Arguments. (line 49) +* files, multiple, duplicating output into: Tee Program. (line 6) +* files, output, See output files: Close Files And Pipes. + (line 6) +* files, password: Passwd Functions. (line 16) +* files, portable object <1>: Translator i18n. (line 6) +* files, portable object: Explaining gettext. (line 36) +* files, portable object, converting to message object files: I18N Example. + (line 62) +* files, portable object, generating: Options. (line 130) +* files, portal: Portal Files. (line 6) +* files, processing, ARGIND variable and: Auto-set. (line 47) +* files, reading: Rewind Function. (line 6) +* files, reading, multiline records: Multiple Line. (line 6) +* files, searching for regular expressions: Egrep Program. (line 6) +* files, skipping: File Checking. (line 6) +* files, source, search path for: Igawk Program. (line 358) +* files, splitting: Split Program. (line 6) +* files, Texinfo, extracting programs from: Extract Program. (line 6) +* Fish, Fred <1>: Bugs. (line 57) +* Fish, Fred: Contributors. (line 50) +* fixed-width data: Constant Size. (line 9) +* flag variables <1>: Tee Program. (line 20) +* flag variables: Boolean Ops. (line 67) +* floating-point: Unexpected Results. (line 6) +* floating-point, numbers: Basic Data Typing. (line 21) +* floating-point, numbers, AWKNUM internal type: Internals. (line 19) +* FNR variable <1>: Auto-set. (line 98) +* FNR variable: Records. (line 6) +* FNR variable, changing: Auto-set. (line 187) +* for statement: For Statement. (line 6) +* for statement, in arrays: Scanning an Array. (line 20) +* force_number internal function: Internals. (line 27) +* force_string internal function: Internals. (line 32) +* format specifiers, mixing regular with positional specifiers: Printf Ordering. + (line 57) +* format specifiers, printf statement: Control Letters. (line 6) +* format specifiers, strftime function (gawk): Time Functions. + (line 85) +* format strings: Basic Printf. (line 15) +* formats, numeric output: OFMT. (line 6) +* formatting output: Printf. (line 6) +* forward slash (/): Regexp. (line 10) +* forward slash (/), / operator: Precedence. (line 55) +* forward slash (/), /= operator <1>: Precedence. (line 96) +* forward slash (/), /= operator: Assignment Ops. (line 129) +* forward slash (/), /= operator, vs. /=.../ regexp constant: Assignment Ops. + (line 148) +* forward slash (/), patterns and: Expression Patterns. (line 24) +* Free Documentation License (FDL): GNU Free Documentation License. + (line 6) +* Free Software Foundation (FSF) <1>: Glossary. (line 284) +* Free Software Foundation (FSF) <2>: Getting. (line 10) +* Free Software Foundation (FSF): Manual History. (line 6) +* free_temp internal macro: Internals. (line 102) +* FreeBSD: Glossary. (line 582) +* FS variable <1>: User-modified. (line 43) +* FS variable: Field Separators. (line 13) +* FS variable, --field-separator option and: Options. (line 21) +* FS variable, as null string: Single Character Fields. + (line 20) +* FS variable, as TAB character: Options. (line 196) +* FS variable, changing value of <1>: Known Bugs. (line 6) +* FS variable, changing value of: Field Separators. (line 33) +* FS variable, running awk programs and: Cut Program. (line 66) +* FS variable, setting from command line: Command Line Field Separator. + (line 6) +* FSF (Free Software Foundation) <1>: Glossary. (line 284) +* FSF (Free Software Foundation) <2>: Getting. (line 10) +* FSF (Free Software Foundation): Manual History. (line 6) +* function calls: Function Calls. (line 6) +* functions, arrays as parameters to: Function Caveats. (line 55) +* functions, built-in <1>: Functions. (line 6) +* functions, built-in: Function Calls. (line 10) +* functions, built-in, adding to gawk: Dynamic Extensions. (line 10) +* functions, built-in, evaluation order: Calling Built-in. (line 30) +* functions, defining: Definition Syntax. (line 6) +* functions, library: Library Functions. (line 6) +* functions, library, assertions: Assert Function. (line 6) +* functions, library, associative arrays and: Library Names. (line 57) +* functions, library, C library: Getopt Function. (line 6) +* functions, library, character values as numbers: Ordinal Functions. + (line 6) +* functions, library, Cliff random numbers: Cliff Random Function. + (line 6) +* functions, library, command-line options: Getopt Function. (line 6) +* functions, library, example program for using: Igawk Program. + (line 6) +* functions, library, group database, reading: Group Functions. + (line 6) +* functions, library, managing data files: Data File Management. + (line 6) +* functions, library, managing time: Gettimeofday Function. + (line 6) +* functions, library, merging arrays into strings: Join Function. + (line 6) +* functions, library, nextfile statement: Nextfile Function. (line 6) +* functions, library, rounding numbers: Round Function. (line 6) +* functions, library, user database, reading: Passwd Functions. + (line 6) +* functions, names of <1>: Definition Syntax. (line 20) +* functions, names of: Arrays. (line 17) +* functions, recursive: Definition Syntax. (line 68) +* functions, return values, setting: Internals. (line 146) +* functions, string-translation: I18N Functions. (line 6) +* functions, undefined: Function Caveats. (line 79) +* functions, user-defined: User-defined. (line 6) +* functions, user-defined, calling: Function Caveats. (line 6) +* functions, user-defined, counts: Profiling. (line 135) +* functions, user-defined, library of: Library Functions. (line 6) +* functions, user-defined, next/nextfile statements and <1>: Nextfile Statement. + (line 39) +* functions, user-defined, next/nextfile statements and: Next Statement. + (line 39) +* G-d: Acknowledgments. (line 70) +* Garfinkle, Scott: Contributors. (line 37) +* gawk, awk and <1>: This Manual. (line 13) +* gawk, awk and: Preface. (line 22) +* gawk, bitwise operations in: Bitwise Functions. (line 39) +* gawk, break statement in: Break Statement. (line 47) +* gawk, built-in variables and: Built-in Variables. (line 14) +* gawk, character classes and: Character Lists. (line 92) +* gawk, coding style in: Adding Code. (line 32) +* gawk, command-line options: GNU Regexp Operators. + (line 62) +* gawk, comparison operators and: Comparison Operators. + (line 50) +* gawk, configuring: Configuration Philosophy. + (line 6) +* gawk, configuring, options: Additional Configuration Options. + (line 6) +* gawk, continue statement in: Continue Statement. (line 43) +* gawk, debugging: Known Bugs. (line 6) +* gawk, distribution: Distribution contents. + (line 6) +* gawk, escape sequences: Escape Sequences. (line 125) +* gawk, extensions, disabling: Options. (line 176) +* gawk, features, adding: Adding Code. (line 6) +* gawk, features, advanced: Advanced Features. (line 6) +* gawk, fflush function in: I/O Functions. (line 45) +* gawk, field separators and: User-modified. (line 63) +* gawk, FIELDWIDTHS variable in: User-modified. (line 39) +* gawk, file names in: Special Files. (line 6) +* gawk, format-control characters: Control Letters. (line 80) +* gawk, function arguments and: Calling Built-in. (line 16) +* gawk, functions, adding: Dynamic Extensions. (line 10) +* gawk, hexadecimal numbers and: Nondecimal-numbers. (line 42) +* gawk, IGNORECASE variable in: User-modified. (line 79) +* gawk, implementation issues: Notes. (line 6) +* gawk, implementation issues, debugging: Compatibility Mode. (line 6) +* gawk, implementation issues, downward compatibility: Compatibility Mode. + (line 6) +* gawk, implementation issues, limits: Getline Notes. (line 14) +* gawk, implementation issues, pipes: Redirection. (line 132) +* gawk, installing: Installation. (line 6) +* gawk, internals: Internals. (line 6) +* gawk, internationalization and, See internationalization: Internationalization. + (line 13) +* gawk, interpreter, adding code to <1>: Future Extensions. (line 87) +* gawk, interpreter, adding code to: Using Internal File Ops. + (line 6) +* gawk, interval expressions and: Regexp Operators. (line 138) +* gawk, line continuation in: Conditional Exp. (line 34) +* gawk, LINT variable in: User-modified. (line 92) +* gawk, list of contributors to: Contributors. (line 6) +* gawk, MS-DOS version of: PC Using. (line 11) +* gawk, newlines in: Statements/Lines. (line 12) +* gawk, next file statement in: Nextfile Statement. (line 46) +* gawk, nextfile statement in <1>: Nextfile Function. (line 6) +* gawk, nextfile statement in: Nextfile Statement. (line 46) +* gawk, octal numbers and: Nondecimal-numbers. (line 42) +* gawk, OS/2 version of: PC Using. (line 11) +* gawk, regexp constants and: Using Constant Regexps. + (line 28) +* gawk, regular expressions, case sensitivity: Case-sensitivity. + (line 26) +* gawk, regular expressions, operators: GNU Regexp Operators. + (line 6) +* gawk, regular expressions, precedence: Regexp Operators. (line 154) +* gawk, See Also awk: Preface. (line 35) +* gawk, source code, obtaining: Getting. (line 6) +* gawk, splitting fields and: Constant Size. (line 87) +* gawk, string-translation functions: I18N Functions. (line 6) +* gawk, timestamps: Time Functions. (line 6) +* gawk, uses for: Preface. (line 35) +* gawk, versions of, information about, printing: Options. (line 244) +* gawk, word-boundary operator: GNU Regexp Operators. + (line 55) +* General Public License (GPL): Glossary. (line 293) +* General Public License, See GPL: Manual History. (line 11) +* gensub function (gawk) <1>: String Functions. (line 361) +* gensub function (gawk): Using Constant Regexps. + (line 44) +* gensub function (gawk), escape processing: Gory Details. (line 6) +* get_actual_argument internal function: Internals. (line 126) +* get_argument internal function: Internals. (line 121) +* get_array_argument internal macro: Internals. (line 141) +* get_curfunc_arg_count internal function: Internals. (line 37) +* get_record input method: Internals. (line 178) +* get_scalar_argument internal macro: Internals. (line 136) +* getgrent function (C library): Group Functions. (line 6) +* getgrent user-defined function: Group Functions. (line 6) +* getgrgid function (C library): Group Functions. (line 180) +* getgrgid user-defined function: Group Functions. (line 183) +* getgrnam function (C library): Group Functions. (line 168) +* getgrnam user-defined function: Group Functions. (line 172) +* getgruser function (C library): Group Functions. (line 191) +* getgruser function, user-defined: Group Functions. (line 194) +* getline command: Reading Files. (line 20) +* getline command, _gr_init user-defined function: Group Functions. + (line 80) +* getline command, _pw_init function: Passwd Functions. (line 136) +* getline command, coprocesses, using from <1>: Close Files And Pipes. + (line 6) +* getline command, coprocesses, using from: Getline/Coprocess. + (line 6) +* getline command, deadlock and: Two-way I/O. (line 71) +* getline command, explicit input with: Getline. (line 6) +* getline command, FILENAME variable and: Getline Notes. (line 19) +* getline command, return values: Getline. (line 19) +* getline command, variants: Getline Summary. (line 6) +* getopt function (C library): Getopt Function. (line 15) +* getopt user-defined function: Getopt Function. (line 106) +* getpwent function (C library): Passwd Functions. (line 16) +* getpwent user-defined function: Passwd Functions. (line 16) +* getpwnam function (C library): Passwd Functions. (line 156) +* getpwnam user-defined function: Passwd Functions. (line 160) +* getpwuid function (C library): Passwd Functions. (line 168) +* getpwuid user-defined function: Passwd Functions. (line 172) +* getservbyname function (C library): TCP/IP Networking. (line 34) +* gettext function (C library): Explaining gettext. (line 60) +* gettext library: Explaining gettext. (line 6) +* gettext library, locale categories: Explaining gettext. (line 78) +* gettimeofday user-defined function: Gettimeofday Function. + (line 16) +* GNITS mailing list: Acknowledgments. (line 49) +* GNU awk, See gawk: Preface. (line 48) +* GNU Free Documentation License: GNU Free Documentation License. + (line 6) +* GNU General Public License: Glossary. (line 293) +* GNU Lesser General Public License: Glossary. (line 373) +* GNU long options <1>: Options. (line 6) +* GNU long options: Command Line. (line 13) +* GNU long options, printing list of: Options. (line 139) +* GNU Project <1>: Glossary. (line 302) +* GNU Project: Manual History. (line 11) +* GNU/Linux <1>: Glossary. (line 582) +* GNU/Linux <2>: Atari Compiling. (line 16) +* GNU/Linux <3>: I18N Example. (line 55) +* GNU/Linux: Manual History. (line 28) +* GPL (General Public License) <1>: Glossary. (line 293) +* GPL (General Public License): Manual History. (line 11) +* GPL (General Public License), printing: Options. (line 87) +* grcat program: Group Functions. (line 15) +* Grigera, Juan <1>: Bugs. (line 59) +* Grigera, Juan: Contributors. (line 54) +* group database, reading: Group Functions. (line 6) +* group file: Group Functions. (line 6) +* groups, information about: Group Functions. (line 6) +* gsub function <1>: String Functions. (line 345) +* gsub function: Using Constant Regexps. + (line 44) +* gsub function, arguments of: String Functions. (line 325) +* gsub function, escape processing: Gory Details. (line 6) +* Hankerson, Darrel <1>: Bugs. (line 58) +* Hankerson, Darrel <2>: Contributors. (line 56) +* Hankerson, Darrel: Acknowledgments. (line 53) +* Hartholz, Elaine: Acknowledgments. (line 35) +* Hartholz, Marshall: Acknowledgments. (line 35) +* Hasegawa, Isamu <1>: Contributors. (line 83) +* Hasegawa, Isamu: Acknowledgments. (line 53) +* hexadecimal numbers: Nondecimal-numbers. (line 6) +* hexadecimal values, enabling interpretation of: Options. (line 168) +* histsort.awk program: History Sorting. (line 25) +* Hughes, Phil: Acknowledgments. (line 40) +* HUP signal: Profiling. (line 207) +* hyphen (-), - operator: Precedence. (line 52) +* hyphen (-), -- (decrement/increment) operators: Precedence. (line 46) +* hyphen (-), -- operator: Increment Ops. (line 48) +* hyphen (-), -= operator <1>: Precedence. (line 96) +* hyphen (-), -= operator: Assignment Ops. (line 129) +* hyphen (-), filenames beginning with: Options. (line 67) +* hyphen (-), in character lists: Character Lists. (line 17) +* id utility: Id Program. (line 6) +* id.awk program: Id Program. (line 30) +* if statement <1>: If Statement. (line 6) +* if statement: Regexp Usage. (line 19) +* if statement, actions, changing: Ranges. (line 25) +* igawk.sh program: Igawk Program. (line 118) +* IGNORECASE variable <1>: User-modified. (line 68) +* IGNORECASE variable: Case-sensitivity. (line 26) +* IGNORECASE variable, array sorting and: Array Sorting. (line 86) +* IGNORECASE variable, array subscripts and: Array Intro. (line 87) +* IGNORECASE variable, in example programs: Library Functions. + (line 43) +* implementation issues, gawk: Notes. (line 6) +* implementation issues, gawk, debugging: Compatibility Mode. (line 6) +* implementation issues, gawk, limits <1>: Redirection. (line 132) +* implementation issues, gawk, limits: Getline Notes. (line 14) +* in operator <1>: Id Program. (line 93) +* in operator <2>: For Statement. (line 74) +* in operator <3>: Precedence. (line 84) +* in operator: Comparison Operators. + (line 11) +* in operator, arrays and <1>: Scanning an Array. (line 17) +* in operator, arrays and: Reference to Elements. + (line 25) +* increment operators: Increment Ops. (line 6) +* index function: String Functions. (line 60) +* indexing arrays: Array Intro. (line 45) +* initialization, automatic: More Complex. (line 38) +* input files: Reading Files. (line 6) +* input files, closing: Close Files And Pipes. + (line 6) +* input files, counting elements in: Wc Program. (line 6) +* input files, examples: Sample Data Files. (line 6) +* input files, reading: Reading Files. (line 6) +* input files, running awk without: Read Terminal. (line 6) +* input files, skipping: Nextfile Function. (line 6) +* input files, variable assignments and: Other Arguments. (line 19) +* input pipeline: Getline/Pipe. (line 6) +* input redirection: Getline/File. (line 6) +* input, data, nondecimal: Nondecimal Data. (line 6) +* input, explicit: Getline. (line 6) +* input, files, See input files: Multiple Line. (line 6) +* input, multiline records: Multiple Line. (line 6) +* input, splitting into records: Records. (line 6) +* input, standard <1>: Special FD. (line 6) +* input, standard: Read Terminal. (line 6) +* input/output, binary: User-modified. (line 10) +* input/output, from BEGIN and END: I/O And BEGIN/END. (line 6) +* input/output, two-way: Two-way I/O. (line 44) +* insomnia, cure for: Alarm Program. (line 6) +* installation, amiga: Amiga Installation. (line 6) +* installation, atari: Atari Installation. (line 9) +* installation, beos: BeOS Installation. (line 6) +* installation, tandem: Tandem Installation. (line 6) +* installation, vms: VMS Installation. (line 6) +* installing gawk: Installation. (line 6) +* int function: Numeric Functions. (line 11) +* INT signal (MS-DOS): Profiling. (line 210) +* integers: Basic Data Typing. (line 21) +* integers, unsigned: Basic Data Typing. (line 28) +* interacting with other programs: I/O Functions. (line 63) +* internationalization <1>: I18N and L10N. (line 6) +* internationalization: I18N Functions. (line 6) +* internationalization, localization <1>: Internationalization. + (line 13) +* internationalization, localization: User-modified. (line 138) +* internationalization, localization, character classes: Character Lists. + (line 92) +* internationalization, localization, gawk and: Internationalization. + (line 13) +* internationalization, localization, locale categories: Explaining gettext. + (line 78) +* internationalization, localization, marked strings: Programmer i18n. + (line 14) +* internationalization, localization, portability and: I18N Portability. + (line 6) +* internationalizing a program: Explaining gettext. (line 6) +* interpreted programs <1>: Glossary. (line 342) +* interpreted programs: Basic High Level. (line 14) +* interval expressions: Regexp Operators. (line 115) +* inventory-shipped file: Sample Data Files. (line 32) +* IOBUF internal structure: Internals. (line 178) +* iop_alloc internal function: Internals. (line 178) +* ISO: Glossary. (line 353) +* ISO 8859-1: Glossary. (line 138) +* ISO Latin-1: Glossary. (line 138) +* Jacobs, Andrew: Passwd Functions. (line 76) +* Jaegermann, Michal <1>: Contributors. (line 45) +* Jaegermann, Michal: Acknowledgments. (line 53) +* Java implementation of awk: Other Versions. (line 105) +* jawk: Other Versions. (line 105) +* Jedi knights: Undocumented. (line 6) +* join user-defined function: Join Function. (line 18) +* Kahrs, Ju"rgen <1>: Contributors. (line 64) +* Kahrs, Ju"rgen: Acknowledgments. (line 53) +* Kenobi, Obi-Wan: Undocumented. (line 6) +* Kernighan, Brian <1>: Basic Data Typing. (line 71) +* Kernighan, Brian <2>: Other Versions. (line 13) +* Kernighan, Brian <3>: Contributors. (line 12) +* Kernighan, Brian <4>: BTL. (line 6) +* Kernighan, Brian <5>: Concatenation. (line 6) +* Kernighan, Brian <6>: Acknowledgments. (line 60) +* Kernighan, Brian <7>: Conventions. (line 33) +* Kernighan, Brian: History. (line 17) +* kill command, dynamic profiling: Profiling. (line 185) +* Knights, jedi: Undocumented. (line 6) +* Kwok, Conrad: Contributors. (line 37) +* labels.awk program: Labels Program. (line 48) +* languages, data-driven: Basic High Level. (line 83) +* LC_ALL locale category: Explaining gettext. (line 116) +* LC_COLLATE locale category: Explaining gettext. (line 89) +* LC_CTYPE locale category: Explaining gettext. (line 93) +* LC_MESSAGES locale category: Explaining gettext. (line 83) +* LC_MESSAGES locale category, bindtextdomain function (gawk): Programmer i18n. + (line 86) +* LC_MONETARY locale category: Explaining gettext. (line 99) +* LC_NUMERIC locale category: Explaining gettext. (line 103) +* LC_RESPONSE locale category: Explaining gettext. (line 107) +* LC_TIME locale category: Explaining gettext. (line 111) +* left angle bracket (<), < operator <1>: Precedence. (line 65) +* left angle bracket (<), < operator: Comparison Operators. + (line 11) +* left angle bracket (<), < operator (I/O): Getline/File. (line 6) +* left angle bracket (<), <= operator <1>: Precedence. (line 65) +* left angle bracket (<), <= operator: Comparison Operators. + (line 11) +* left shift, bitwise: Bitwise Functions. (line 32) +* leftmost longest match: Multiple Line. (line 26) +* length function: String Functions. (line 71) +* Lesser General Public License (LGPL): Glossary. (line 373) +* LGPL (Lesser General Public License): Glossary. (line 373) +* libraries of awk functions: Library Functions. (line 6) +* libraries of awk functions, assertions: Assert Function. (line 6) +* libraries of awk functions, associative arrays and: Library Names. + (line 57) +* libraries of awk functions, character values as numbers: Ordinal Functions. + (line 6) +* libraries of awk functions, command-line options: Getopt Function. + (line 6) +* libraries of awk functions, example program for using: Igawk Program. + (line 6) +* libraries of awk functions, group database, reading: Group Functions. + (line 6) +* libraries of awk functions, managing, data files: Data File Management. + (line 6) +* libraries of awk functions, managing, time: Gettimeofday Function. + (line 6) +* libraries of awk functions, merging arrays into strings: Join Function. + (line 6) +* libraries of awk functions, nextfile statement: Nextfile Function. + (line 6) +* libraries of awk functions, rounding numbers: Round Function. + (line 6) +* libraries of awk functions, user database, reading: Passwd Functions. + (line 6) +* line breaks: Statements/Lines. (line 6) +* line continuations: Boolean Ops. (line 62) +* line continuations, gawk: Conditional Exp. (line 34) +* line continuations, in print statement: Print Examples. (line 76) +* line continuations, with C shell: More Complex. (line 30) +* lines, blank, printing: Print. (line 22) +* lines, counting: Wc Program. (line 6) +* lines, duplicate, removing: History Sorting. (line 6) +* lines, matching ranges of: Ranges. (line 6) +* lines, skipping between markers: Ranges. (line 43) +* lint checking: User-modified. (line 83) +* lint checking, array elements: Delete. (line 34) +* lint checking, array subscripts: Uninitialized Subscripts. + (line 42) +* lint checking, empty programs: Command Line. (line 16) +* lint checking, issuing warnings: Options. (line 144) +* lint checking, POSIXLY_CORRECT environment variable: Options. + (line 282) +* lint checking, undefined functions: Function Caveats. (line 96) +* LINT variable: User-modified. (line 83) +* Linux <1>: Glossary. (line 582) +* Linux <2>: Atari Compiling. (line 16) +* Linux <3>: I18N Example. (line 55) +* Linux: Manual History. (line 28) +* locale categories: Explaining gettext. (line 78) +* locale decimal point character: Options. (line 200) +* locale, definition of: Locales. (line 6) +* localization: I18N and L10N. (line 6) +* localization, See internationalization, localization: I18N and L10N. + (line 6) +* log files, timestamps in: Time Functions. (line 6) +* log function: Numeric Functions. (line 27) +* logical false/true: Truth Values. (line 6) +* logical operators, See Boolean expressions: Boolean Ops. (line 6) +* login information: Passwd Functions. (line 16) +* long options: Command Line. (line 13) +* loops: While Statement. (line 6) +* loops, continue statements and: For Statement. (line 63) +* loops, count for header: Profiling. (line 129) +* loops, exiting: Break Statement. (line 6) +* loops, See Also while statement: While Statement. (line 6) +* Lost In Space: Dynamic Extensions. (line 6) +* ls utility: More Complex. (line 15) +* lshift function (gawk): Bitwise Functions. (line 45) +* lvalues/rvalues: Assignment Ops. (line 32) +* mailing labels, printing: Labels Program. (line 6) +* mailing list, GNITS: Acknowledgments. (line 49) +* make_builtin internal function: Internals. (line 107) +* make_number internal function: Internals. (line 82) +* make_string internal function: Internals. (line 77) +* mark parity: Ordinal Functions. (line 44) +* marked string extraction (internationalization): String Extraction. + (line 6) +* marked strings, extracting: String Extraction. (line 6) +* Marx, Groucho: Increment Ops. (line 61) +* match function: String Functions. (line 98) +* match function, RSTART/RLENGTH variables: String Functions. (line 115) +* matching, expressions, See comparison expressions: Typing and Comparison. + (line 9) +* matching, leftmost longest: Multiple Line. (line 26) +* matching, null strings: Gory Details. (line 160) +* mawk program: Other Versions. (line 33) +* McPhee, Patrick: Contributors. (line 89) +* memory, releasing: Internals. (line 102) +* memory, setting limits: Options. (line 45) +* message object files: Explaining gettext. (line 39) +* message object files, converting from portable object files: I18N Example. + (line 62) +* message object files, specifying directory of <1>: Programmer i18n. + (line 45) +* message object files, specifying directory of: Explaining gettext. + (line 51) +* metacharacters, escape sequences for: Escape Sequences. (line 132) +* mktime function (gawk): Time Functions. (line 30) +* modifiers, in format specifiers: Format Modifiers. (line 6) +* monetary information, localization: Explaining gettext. (line 99) +* msgfmt utility: I18N Example. (line 62) +* names, arrays/variables <1>: Library Names. (line 6) +* names, arrays/variables: Arrays. (line 17) +* names, functions <1>: Library Names. (line 6) +* names, functions: Definition Syntax. (line 20) +* namespace issues <1>: Library Names. (line 6) +* namespace issues: Arrays. (line 17) +* namespace issues, functions: Definition Syntax. (line 20) +* nawk utility: Names. (line 17) +* negative zero: Unexpected Results. (line 28) +* NetBSD: Glossary. (line 582) +* networks, programming: TCP/IP Networking. (line 6) +* networks, support for: Special Network. (line 6) +* newlines <1>: Options. (line 183) +* newlines <2>: Boolean Ops. (line 67) +* newlines: Statements/Lines. (line 6) +* newlines, as field separators: Field Separators. (line 63) +* newlines, as record separators: Records. (line 20) +* newlines, in dynamic regexps: Computed Regexps. (line 59) +* newlines, in regexp constants: Computed Regexps. (line 69) +* newlines, printing: Print Examples. (line 12) +* newlines, separating statements in actions <1>: Statements. (line 10) +* newlines, separating statements in actions: Action Overview. + (line 19) +* next file statement: POSIX/GNU. (line 155) +* next file statement, deprecated: Obsolete. (line 11) +* next file statement, in gawk: Nextfile Statement. (line 46) +* next statement <1>: Next Statement. (line 6) +* next statement: Boolean Ops. (line 85) +* next statement, BEGIN/END patterns and: I/O And BEGIN/END. (line 36) +* next statement, user-defined functions and: Next Statement. (line 39) +* nextfile statement: Nextfile Statement. (line 6) +* nextfile statement, BEGIN/END patterns and: I/O And BEGIN/END. + (line 36) +* nextfile statement, implementing: Nextfile Function. (line 6) +* nextfile statement, in gawk: Nextfile Statement. (line 46) +* nextfile statement, next file statement and: Obsolete. (line 11) +* nextfile statement, user-defined functions and: Nextfile Statement. + (line 39) +* nextfile user-defined function: Nextfile Function. (line 38) +* NF variable <1>: Auto-set. (line 103) +* NF variable: Fields. (line 33) +* NF variable, decrementing: Changing Fields. (line 107) +* noassign.awk program: Ignoring Assigns. (line 15) +* NODE internal type: Internals. (line 23) +* nodes, duplicating: Internals. (line 97) +* not Boolean-logic operator: Boolean Ops. (line 6) +* NR variable <1>: Auto-set. (line 114) +* NR variable: Records. (line 6) +* NR variable, changing: Auto-set. (line 187) +* null strings <1>: Basic Data Typing. (line 47) +* null strings <2>: Truth Values. (line 6) +* null strings <3>: Regexp Field Splitting. + (line 43) +* null strings: Records. (line 102) +* null strings, array elements and: Delete. (line 27) +* null strings, as array subscripts: Uninitialized Subscripts. + (line 42) +* null strings, converting numbers to strings: Conversion. (line 21) +* null strings, matching: Gory Details. (line 160) +* null strings, quoting and: Quoting. (line 58) +* number sign (#), #! (executable scripts): Executable Scripts. + (line 6) +* number sign (#), #! (executable scripts), portability issues with: Executable Scripts. + (line 6) +* number sign (#), commenting: Comments. (line 6) +* numbers: Internals. (line 82) +* numbers, as array subscripts: Numeric Array Subscripts. + (line 6) +* numbers, as values of characters: Ordinal Functions. (line 6) +* numbers, Cliff random: Cliff Random Function. + (line 6) +* numbers, converting: Conversion. (line 6) +* numbers, converting, to strings <1>: Bitwise Functions. (line 99) +* numbers, converting, to strings: User-modified. (line 26) +* numbers, floating-point: Basic Data Typing. (line 21) +* numbers, floating-point, AWKNUM internal type: Internals. (line 19) +* numbers, hexadecimal: Nondecimal-numbers. (line 6) +* numbers, NODE internal type: Internals. (line 23) +* numbers, octal: Nondecimal-numbers. (line 6) +* numbers, random: Numeric Functions. (line 70) +* numbers, rounding: Round Function. (line 6) +* numeric, constants: Scalar Constants. (line 6) +* numeric, output format: OFMT. (line 6) +* numeric, strings: Variable Typing. (line 6) +* numeric, values: Internals. (line 27) +* oawk utility: Names. (line 17) +* obsolete features: Obsolete. (line 6) +* octal numbers: Nondecimal-numbers. (line 6) +* octal values, enabling interpretation of: Options. (line 168) +* OFMT variable <1>: User-modified. (line 100) +* OFMT variable <2>: Conversion. (line 54) +* OFMT variable: OFMT. (line 15) +* OFMT variable, POSIX awk and: OFMT. (line 27) +* OFS variable <1>: User-modified. (line 109) +* OFS variable <2>: Output Separators. (line 6) +* OFS variable: Changing Fields. (line 64) +* OpenBSD: Glossary. (line 582) +* OpenSolaris: Other Versions. (line 96) +* operating systems, BSD-based <1>: Portal Files. (line 6) +* operating systems, BSD-based: Manual History. (line 28) +* operating systems, PC, gawk on: PC Using. (line 6) +* operating systems, PC, gawk on, installing: PC Installation. + (line 6) +* operating systems, porting gawk to: New Ports. (line 6) +* operating systems, See Also GNU/Linux, PC operating systems, Unix: Installation. + (line 6) +* operations, bitwise: Bitwise Functions. (line 6) +* operators, arithmetic: Arithmetic Ops. (line 6) +* operators, assignment: Assignment Ops. (line 6) +* operators, assignment, evaluation order: Assignment Ops. (line 111) +* operators, Boolean, See Boolean expressions: Boolean Ops. (line 6) +* operators, decrement/increment: Increment Ops. (line 6) +* operators, GNU-specific: GNU Regexp Operators. + (line 6) +* operators, input/output <1>: Precedence. (line 65) +* operators, input/output <2>: Redirection. (line 19) +* operators, input/output <3>: Getline/Coprocess. (line 6) +* operators, input/output <4>: Getline/Pipe. (line 6) +* operators, input/output: Getline/File. (line 6) +* operators, logical, See Boolean expressions: Boolean Ops. (line 6) +* operators, precedence <1>: Precedence. (line 6) +* operators, precedence: Increment Ops. (line 61) +* operators, relational, See operators, comparison: Typing and Comparison. + (line 9) +* operators, short-circuit: Boolean Ops. (line 57) +* operators, string: Concatenation. (line 9) +* operators, string-matching: Regexp Usage. (line 19) +* operators, string-matching, for buffers: GNU Regexp Operators. + (line 40) +* operators, word-boundary (gawk): GNU Regexp Operators. + (line 55) +* options, command-line <1>: Options. (line 6) +* options, command-line <2>: Command Line Field Separator. + (line 6) +* options, command-line: Long. (line 12) +* options, command-line, end of: Options. (line 62) +* options, command-line, invoking awk: Command Line. (line 6) +* options, command-line, processing: Getopt Function. (line 6) +* options, deprecated: Obsolete. (line 6) +* options, long <1>: Options. (line 6) +* options, long: Command Line. (line 13) +* options, printing list of: Options. (line 139) +* OR bitwise operation: Bitwise Functions. (line 6) +* or Boolean-logic operator: Boolean Ops. (line 6) +* or function (gawk): Bitwise Functions. (line 39) +* ord user-defined function: Ordinal Functions. (line 16) +* order of evaluation, concatenation: Concatenation. (line 42) +* ORS variable <1>: User-modified. (line 114) +* ORS variable: Output Separators. (line 20) +* output field separator, See OFS variable: Changing Fields. (line 64) +* output record separator, See ORS variable: Output Separators. + (line 20) +* output redirection: Redirection. (line 6) +* output, buffering: I/O Functions. (line 29) +* output, duplicating into files: Tee Program. (line 6) +* output, files, closing: Close Files And Pipes. + (line 6) +* output, format specifier, OFMT: OFMT. (line 15) +* output, formatted: Printf. (line 6) +* output, pipes: Redirection. (line 54) +* output, printing, See printing: Printing. (line 6) +* output, records: Output Separators. (line 20) +* output, standard: Special FD. (line 6) +* P1003.2 POSIX standard: Glossary. (line 426) +* param_cnt internal variable: Internals. (line 46) +* parameters, number of: Internals. (line 46) +* parentheses (): Regexp Operators. (line 78) +* parentheses (), pgawk program: Profiling. (line 144) +* password file: Passwd Functions. (line 16) +* patterns: Patterns and Actions. + (line 6) +* patterns, comparison expressions as: Expression Patterns. (line 14) +* patterns, counts: Profiling. (line 116) +* patterns, default: Very Simple. (line 34) +* patterns, empty: Empty. (line 6) +* patterns, expressions as: Regexp Patterns. (line 6) +* patterns, ranges in: Ranges. (line 6) +* patterns, regexp constants as: Expression Patterns. (line 36) +* patterns, types of: Pattern Overview. (line 14) +* pawk profiling Bell Labs awk: Other Versions. (line 88) +* PC operating systems, gawk on: PC Using. (line 6) +* PC operating systems, gawk on, installing: PC Installation. (line 6) +* percent sign (%), % operator: Precedence. (line 55) +* percent sign (%), %= operator <1>: Precedence. (line 96) +* percent sign (%), %= operator: Assignment Ops. (line 129) +* period (.): Regexp Operators. (line 43) +* PERL: Future Extensions. (line 6) +* Peters, Arno: Contributors. (line 74) +* Peterson, Hal: Contributors. (line 40) +* pgawk program: Profiling. (line 6) +* pgawk program, awkprof.out file: Profiling. (line 10) +* pgawk program, dynamic profiling: Profiling. (line 177) +* pipes, closing: Close Files And Pipes. + (line 6) +* pipes, input: Getline/Pipe. (line 6) +* pipes, output: Redirection. (line 54) +* plus sign (+): Regexp Operators. (line 101) +* plus sign (+), + operator: Precedence. (line 52) +* plus sign (+), ++ operator <1>: Precedence. (line 46) +* plus sign (+), ++ operator: Increment Ops. (line 40) +* plus sign (+), += operator <1>: Precedence. (line 96) +* plus sign (+), += operator: Assignment Ops. (line 82) +* plus sign (+), decrement/increment operators: Increment Ops. + (line 11) +* portability: Escape Sequences. (line 94) +* portability, #! (executable scripts): Executable Scripts. (line 34) +* portability, ** operator and: Arithmetic Ops. (line 81) +* portability, **= operator and: Assignment Ops. (line 142) +* portability, ARGV variable: Executable Scripts. (line 43) +* portability, backslash continuation and: Statements/Lines. (line 30) +* portability, backslash in escape sequences: Escape Sequences. + (line 113) +* portability, close function and: Close Files And Pipes. + (line 81) +* portability, data files as single record: Records. (line 170) +* portability, deleting array elements: Delete. (line 51) +* portability, example programs: Library Functions. (line 31) +* portability, fflush function and: I/O Functions. (line 29) +* portability, functions, defining: Definition Syntax. (line 88) +* portability, gawk: New Ports. (line 6) +* portability, gettext library and: Explaining gettext. (line 10) +* portability, internationalization and: I18N Portability. (line 6) +* portability, length function: String Functions. (line 80) +* portability, new awk vs. old awk: Conversion. (line 54) +* portability, next statement in user-defined functions: Function Caveats. + (line 99) +* portability, NF variable, decrementing: Changing Fields. (line 115) +* portability, operators: Increment Ops. (line 61) +* portability, operators, not in POSIX awk: Precedence. (line 100) +* portability, POSIXLY_CORRECT environment variable: Options. (line 300) +* portability, substr function: String Functions. (line 443) +* portable object files <1>: Translator i18n. (line 6) +* portable object files: Explaining gettext. (line 36) +* portable object files, converting to message object files: I18N Example. + (line 62) +* portable object files, generating: Options. (line 130) +* portal files: Portal Files. (line 6) +* porting gawk: New Ports. (line 6) +* positional specifiers, printf statement <1>: Printf Ordering. + (line 6) +* positional specifiers, printf statement: Format Modifiers. (line 13) +* positional specifiers, printf statement, mixing with regular formats: Printf Ordering. + (line 57) +* positive zero: Unexpected Results. (line 28) +* POSIX awk <1>: Assignment Ops. (line 136) +* POSIX awk: This Manual. (line 13) +* POSIX awk, **= operator and: Assignment Ops. (line 142) +* POSIX awk, < operator and: Getline/File. (line 26) +* POSIX awk, arithmetic operators and: Arithmetic Ops. (line 36) +* POSIX awk, backslashes in string constants: Escape Sequences. + (line 113) +* POSIX awk, BEGIN/END patterns: I/O And BEGIN/END. (line 16) +* POSIX awk, break statement and: Break Statement. (line 47) +* POSIX awk, changes in awk versions: POSIX. (line 6) +* POSIX awk, character lists and: Character Lists. (line 24) +* POSIX awk, character lists and, character classes: Character Lists. + (line 30) +* POSIX awk, continue statement and: Continue Statement. (line 43) +* POSIX awk, CONVFMT variable and: User-modified. (line 26) +* POSIX awk, date utility and: Time Functions. (line 259) +* POSIX awk, field separators and <1>: Field Splitting Summary. + (line 41) +* POSIX awk, field separators and: Fields. (line 6) +* POSIX awk, FS variable and: User-modified. (line 52) +* POSIX awk, function keyword in: Definition Syntax. (line 73) +* POSIX awk, functions and, gsub/sub: Gory Details. (line 53) +* POSIX awk, functions and, length: String Functions. (line 80) +* POSIX awk, GNU long options and: Options. (line 15) +* POSIX awk, interval expressions in: Regexp Operators. (line 134) +* POSIX awk, next/nextfile statements and: Next Statement. (line 39) +* POSIX awk, numeric strings and: Variable Typing. (line 6) +* POSIX awk, OFMT variable and <1>: Conversion. (line 54) +* POSIX awk, OFMT variable and: OFMT. (line 27) +* POSIX awk, period (.), using: Regexp Operators. (line 50) +* POSIX awk, printf format strings and: Format Modifiers. (line 159) +* POSIX awk, regular expressions and: Regexp Operators. (line 154) +* POSIX awk, timestamps and: Time Functions. (line 6) +* POSIX awk, | I/O operator and: Getline/Pipe. (line 52) +* POSIX mode: Options. (line 176) +* POSIX, awk and: Preface. (line 22) +* POSIX, gawk extensions not included in: POSIX/GNU. (line 6) +* POSIX, programs, implementing in awk: Clones. (line 6) +* POSIXLY_CORRECT environment variable: Options. (line 282) +* precedence <1>: Precedence. (line 6) +* precedence: Increment Ops. (line 61) +* precedence, regexp operators: Regexp Operators. (line 149) +* print statement: Printing. (line 16) +* print statement, BEGIN/END patterns and: I/O And BEGIN/END. (line 16) +* print statement, commas, omitting: Print Examples. (line 31) +* print statement, I/O operators in: Precedence. (line 72) +* print statement, line continuations and: Print Examples. (line 76) +* print statement, OFMT variable and: User-modified. (line 109) +* print statement, See Also redirection, of output: Redirection. + (line 14) +* print statement, sprintf function and: Round Function. (line 6) +* printf statement <1>: Printf. (line 6) +* printf statement: Printing. (line 16) +* printf statement, columns, aligning: Print Examples. (line 70) +* printf statement, format-control characters: Control Letters. + (line 6) +* printf statement, I/O operators in: Precedence. (line 72) +* printf statement, modifiers: Format Modifiers. (line 6) +* printf statement, positional specifiers <1>: Printf Ordering. + (line 6) +* printf statement, positional specifiers: Format Modifiers. (line 13) +* printf statement, positional specifiers, mixing with regular formats: Printf Ordering. + (line 57) +* printf statement, See Also redirection, of output: Redirection. + (line 14) +* printf statement, sprintf function and: Round Function. (line 6) +* printf statement, syntax of: Basic Printf. (line 6) +* printing: Printing. (line 6) +* printing, list of options: Options. (line 139) +* printing, mailing labels: Labels Program. (line 6) +* printing, unduplicated lines of text: Uniq Program. (line 6) +* printing, user information: Id Program. (line 6) +* private variables: Library Names. (line 11) +* process information, files for: Special Process. (line 6) +* processes, two-way communications with: Two-way I/O. (line 23) +* processing data: Basic High Level. (line 6) +* PROCINFO array <1>: Group Functions. (line 6) +* PROCINFO array <2>: Passwd Functions. (line 6) +* PROCINFO array <3>: Auto-set. (line 119) +* PROCINFO array: Special Caveats. (line 12) +* PROCINFO variable: Internals. (line 165) +* profiling awk programs: Profiling. (line 6) +* profiling awk programs, dynamically: Profiling. (line 177) +* profiling gawk, See pgawk program: Profiling. (line 6) +* program, definition of: Getting Started. (line 21) +* programmers, attractiveness of: Two-way I/O. (line 6) +* programming conventions, --non-decimal-data option: Nondecimal Data. + (line 36) +* programming conventions, ARGC/ARGV variables: Auto-set. (line 31) +* programming conventions, exit statement: Exit Statement. (line 36) +* programming conventions, function parameters: Return Statement. + (line 39) +* programming conventions, functions, calling: Calling Built-in. + (line 10) +* programming conventions, functions, writing: Definition Syntax. + (line 50) +* programming conventions, gawk internals: Internal File Ops. (line 33) +* programming conventions, nextfile statement: Nextfile Function. + (line 20) +* programming conventions, private variable names: Library Names. + (line 23) +* programming language, recipe for: History. (line 6) +* programming languages, data-driven vs. procedural: Getting Started. + (line 12) +* programming, basic steps: Basic High Level. (line 19) +* programming, concepts: Basic Concepts. (line 6) +* pwcat program: Passwd Functions. (line 23) +* question mark (?) <1>: GNU Regexp Operators. + (line 51) +* question mark (?): Regexp Operators. (line 110) +* question mark (?), ?: operator: Precedence. (line 93) +* QUIT signal (MS-DOS): Profiling. (line 210) +* quoting <1>: Comments. (line 27) +* quoting <2>: Long. (line 26) +* quoting: Read Terminal. (line 25) +* quoting, rules for: Quoting. (line 6) +* quoting, tricks for: Quoting. (line 67) +* Rakitzis, Byron: History Sorting. (line 25) +* rand function: Numeric Functions. (line 40) +* random numbers, Cliff: Cliff Random Function. + (line 6) +* random numbers, rand/srand functions: Numeric Functions. (line 40) +* random numbers, seed of: Numeric Functions. (line 70) +* range expressions: Character Lists. (line 6) +* range patterns: Ranges. (line 6) +* Rankin, Pat <1>: Bugs. (line 64) +* Rankin, Pat <2>: Contributors. (line 35) +* Rankin, Pat <3>: Assignment Ops. (line 100) +* Rankin, Pat: Acknowledgments. (line 53) +* raw sockets: TCP/IP Networking. (line 30) +* readable data files, checking: File Checking. (line 6) +* readable.awk program: File Checking. (line 11) +* recipe for a programming language: History. (line 6) +* record separators <1>: User-modified. (line 119) +* record separators: Records. (line 14) +* record separators, changing: Records. (line 81) +* record separators, regular expressions as: Records. (line 112) +* record separators, with multiline records: Multiple Line. (line 10) +* records <1>: Basic High Level. (line 71) +* records: Reading Files. (line 14) +* records, multiline: Multiple Line. (line 6) +* records, printing: Print. (line 22) +* records, splitting input into: Records. (line 6) +* records, terminating: Records. (line 112) +* records, treating files as: Records. (line 191) +* recursive functions: Definition Syntax. (line 68) +* redirection of input: Getline/File. (line 6) +* redirection of output: Redirection. (line 6) +* reference counting, sorting arrays: Array Sorting. (line 79) +* regexp constants <1>: Comparison Operators. + (line 102) +* regexp constants <2>: Regexp Constants. (line 6) +* regexp constants: Regexp Usage. (line 58) +* regexp constants, /=.../, /= operator and: Assignment Ops. (line 148) +* regexp constants, as patterns: Expression Patterns. (line 36) +* regexp constants, in gawk: Using Constant Regexps. + (line 28) +* regexp constants, slashes vs. quotes: Computed Regexps. (line 28) +* regexp constants, vs. string constants: Computed Regexps. (line 38) +* regexp, See regular expressions: Regexp. (line 6) +* register_deferred_variable internal function: Internals. (line 165) +* register_open_hook internal function: Internals. (line 178) +* regular expressions: Regexp. (line 6) +* regular expressions as field separators: Field Separators. (line 49) +* regular expressions, anchors in: Regexp Operators. (line 22) +* regular expressions, as field separators: Regexp Field Splitting. + (line 6) +* regular expressions, as patterns <1>: Regexp Patterns. (line 6) +* regular expressions, as patterns: Regexp Usage. (line 6) +* regular expressions, as record separators: Records. (line 112) +* regular expressions, case sensitivity <1>: User-modified. (line 68) +* regular expressions, case sensitivity: Case-sensitivity. (line 6) +* regular expressions, computed: Computed Regexps. (line 6) +* regular expressions, constants, See regexp constants: Regexp Usage. + (line 58) +* regular expressions, dynamic: Computed Regexps. (line 6) +* regular expressions, dynamic, with embedded newlines: Computed Regexps. + (line 59) +* regular expressions, gawk, command-line options: GNU Regexp Operators. + (line 62) +* regular expressions, interval expressions and: Options. (line 224) +* regular expressions, leftmost longest match: Leftmost Longest. + (line 6) +* regular expressions, operators <1>: Regexp Operators. (line 6) +* regular expressions, operators: Regexp Usage. (line 19) +* regular expressions, operators, for buffers: GNU Regexp Operators. + (line 40) +* regular expressions, operators, for words: GNU Regexp Operators. + (line 6) +* regular expressions, operators, gawk: GNU Regexp Operators. + (line 6) +* regular expressions, operators, precedence of: Regexp Operators. + (line 149) +* regular expressions, searching for: Egrep Program. (line 6) +* relational operators, See comparison operators: Typing and Comparison. + (line 9) +* return statement, user-defined functions: Return Statement. (line 6) +* return values, close function: Close Files And Pipes. + (line 130) +* rev user-defined function: Function Example. (line 52) +* rewind user-defined function: Rewind Function. (line 16) +* right angle bracket (>), > operator <1>: Precedence. (line 65) +* right angle bracket (>), > operator: Comparison Operators. + (line 11) +* right angle bracket (>), > operator (I/O): Redirection. (line 19) +* right angle bracket (>), >= operator <1>: Precedence. (line 65) +* right angle bracket (>), >= operator: Comparison Operators. + (line 11) +* right angle bracket (>), >> operator (I/O) <1>: Precedence. (line 65) +* right angle bracket (>), >> operator (I/O): Redirection. (line 47) +* right shift, bitwise: Bitwise Functions. (line 32) +* Ritchie, Dennis: Basic Data Typing. (line 71) +* RLENGTH variable: Auto-set. (line 163) +* RLENGTH variable, match function and: String Functions. (line 115) +* Robbins, Arnold <1>: Future Extensions. (line 6) +* Robbins, Arnold <2>: Bugs. (line 29) +* Robbins, Arnold <3>: Contributors. (line 92) +* Robbins, Arnold <4>: Alarm Program. (line 6) +* Robbins, Arnold <5>: Passwd Functions. (line 76) +* Robbins, Arnold <6>: Getline/Pipe. (line 36) +* Robbins, Arnold: Command Line Field Separator. + (line 80) +* Robbins, Bill: Getline/Pipe. (line 36) +* Robbins, Harry: Acknowledgments. (line 70) +* Robbins, Jean: Acknowledgments. (line 70) +* Robbins, Miriam <1>: Passwd Functions. (line 76) +* Robbins, Miriam <2>: Getline/Pipe. (line 36) +* Robbins, Miriam: Acknowledgments. (line 70) +* Robinson, Will: Dynamic Extensions. (line 6) +* robot, the: Dynamic Extensions. (line 6) +* Rommel, Kai Uwe <1>: Contributors. (line 42) +* Rommel, Kai Uwe: Acknowledgments. (line 53) +* round user-defined function: Round Function. (line 16) +* rounding: Round Function. (line 6) +* rounding numbers: Round Function. (line 6) +* RS variable <1>: User-modified. (line 119) +* RS variable: Records. (line 20) +* RS variable, multiline records and: Multiple Line. (line 17) +* rshift function (gawk): Bitwise Functions. (line 46) +* RSTART variable: Auto-set. (line 169) +* RSTART variable, match function and: String Functions. (line 115) +* RT variable <1>: Auto-set. (line 176) +* RT variable <2>: Multiple Line. (line 129) +* RT variable: Records. (line 112) +* Rubin, Paul <1>: Contributors. (line 16) +* Rubin, Paul: History. (line 30) +* rule, definition of: Getting Started. (line 21) +* rvalues/lvalues: Assignment Ops. (line 32) +* scalar values: Basic Data Typing. (line 13) +* Schreiber, Bert: Acknowledgments. (line 35) +* Schreiber, Rita: Acknowledgments. (line 35) +* search paths <1>: VMS Running. (line 28) +* search paths: PC Using. (line 11) +* search paths, for source files <1>: VMS Running. (line 28) +* search paths, for source files <2>: Igawk Program. (line 358) +* search paths, for source files: AWKPATH Variable. (line 6) +* searching: String Functions. (line 60) +* searching, files for regular expressions: Egrep Program. (line 6) +* searching, for words: Dupword Program. (line 6) +* sed utility <1>: Glossary. (line 12) +* sed utility <2>: Simple Sed. (line 6) +* sed utility: Field Splitting Summary. + (line 47) +* semicolon (;): Statements/Lines. (line 90) +* semicolon (;), AWKPATH variable and: PC Using. (line 11) +* semicolon (;), separating statements in actions <1>: Statements. + (line 10) +* semicolon (;), separating statements in actions: Action Overview. + (line 19) +* separators, field: User-modified. (line 43) +* separators, field, FIELDWIDTHS variable and: User-modified. (line 33) +* separators, field, POSIX and: Fields. (line 6) +* separators, for records: Records. (line 14) +* separators, for records, regular expressions as: Records. (line 112) +* separators, for statements in actions: Action Overview. (line 19) +* separators, record: User-modified. (line 119) +* separators, subscript: User-modified. (line 132) +* set_value internal function: Internals. (line 146) +* shells, piping commands into: Redirection. (line 140) +* shells, quoting: Using Shell Variables. + (line 12) +* shells, quoting, rules for: Quoting. (line 14) +* shells, scripts: One-shot. (line 22) +* shells, variables: Using Shell Variables. + (line 6) +* shift, bitwise: Bitwise Functions. (line 32) +* short-circuit operators: Boolean Ops. (line 57) +* side effects <1>: Increment Ops. (line 11) +* side effects: Concatenation. (line 42) +* side effects, array indexing: Reference to Elements. + (line 30) +* side effects, asort function: Array Sorting. (line 25) +* side effects, assignment expressions: Assignment Ops. (line 23) +* side effects, Boolean operators: Boolean Ops. (line 30) +* side effects, conditional expressions: Conditional Exp. (line 22) +* side effects, decrement/increment operators: Increment Ops. (line 11) +* side effects, FILENAME variable: Getline Notes. (line 19) +* side effects, function calls: Function Calls. (line 49) +* side effects, statements: Action Overview. (line 32) +* signals, HUP/SIGHUP: Profiling. (line 207) +* signals, INT/SIGINT (MS-DOS): Profiling. (line 210) +* signals, QUIT/SIGQUIT (MS-DOS): Profiling. (line 210) +* signals, USR1/SIGUSR1: Profiling. (line 185) +* sin function: Numeric Functions. (line 31) +* single quote (') <1>: Quoting. (line 27) +* single quote (') <2>: Long. (line 33) +* single quote ('): One-shot. (line 15) +* single quote ('), vs. apostrophe: Comments. (line 27) +* single quote ('), with double quotes: Quoting. (line 49) +* single-character fields: Single Character Fields. + (line 6) +* single-precision floating-point: Basic Data Typing. (line 33) +* Skywalker, Luke: Undocumented. (line 6) +* sleep utility: Alarm Program. (line 102) +* sockets: TCP/IP Networking. (line 30) +* Solaris, POSIX compliant awk: Other Versions. (line 96) +* sort function, arrays, sorting: Array Sorting. (line 6) +* sort utility: Word Sorting. (line 54) +* sort utility, coprocesses and: Two-way I/O. (line 84) +* sorting characters in different languages: Explaining gettext. + (line 89) +* source code, awka: Other Versions. (line 76) +* source code, Bell Laboratories awk: Other Versions. (line 13) +* source code, gawk: Gawk Distribution. (line 6) +* source code, mawk: Other Versions. (line 33) +* source code, mixing: Options. (line 231) +* source files, search path for: Igawk Program. (line 358) +* sparse arrays: Array Intro. (line 66) +* Spencer, Henry: Glossary. (line 12) +* split function: String Functions. (line 186) +* split function, array elements, deleting: Delete. (line 56) +* split utility: Split Program. (line 6) +* split.awk program: Split Program. (line 30) +* sprintf function <1>: String Functions. (line 239) +* sprintf function: OFMT. (line 15) +* sprintf function, OFMT variable and: User-modified. (line 109) +* sprintf function, print/printf statements and: Round Function. + (line 6) +* sqrt function: Numeric Functions. (line 18) +* square brackets ([]): Regexp Operators. (line 55) +* srand function: Numeric Functions. (line 80) +* Stallman, Richard <1>: Glossary. (line 284) +* Stallman, Richard <2>: Contributors. (line 24) +* Stallman, Richard <3>: Acknowledgments. (line 18) +* Stallman, Richard: Manual History. (line 6) +* standard input <1>: Special FD. (line 6) +* standard input: Read Terminal. (line 6) +* standard output: Special FD. (line 6) +* stat function, implementing in gawk: Sample Library. (line 6) +* statements, compound, control statements and: Statements. (line 10) +* statements, control, in actions: Statements. (line 6) +* statements, multiple: Statements/Lines. (line 90) +* stlen internal variable: Internals. (line 50) +* stptr internal variable: Internals. (line 50) +* stream editors <1>: Simple Sed. (line 6) +* stream editors: Field Splitting Summary. + (line 47) +* strftime function (gawk): Time Functions. (line 53) +* string constants: Scalar Constants. (line 15) +* string constants, vs. regexp constants: Computed Regexps. (line 38) +* string extraction (internationalization): String Extraction. + (line 6) +* string operators: Concatenation. (line 9) +* string-matching operators: Regexp Usage. (line 19) +* strings: Internals. (line 77) +* strings, converting: Conversion. (line 6) +* strings, converting, numbers to <1>: Bitwise Functions. (line 99) +* strings, converting, numbers to: User-modified. (line 26) +* strings, empty, See null strings: Records. (line 102) +* strings, extracting: String Extraction. (line 6) +* strings, for localization: Programmer i18n. (line 14) +* strings, length of: Scalar Constants. (line 20) +* strings, merging arrays into: Join Function. (line 6) +* strings, NODE internal type: Internals. (line 23) +* strings, null: Regexp Field Splitting. + (line 43) +* strings, numeric: Variable Typing. (line 6) +* strings, splitting: String Functions. (line 200) +* strtonum function (gawk): String Functions. (line 247) +* strtonum function (gawk), --non-decimal-data option and: Nondecimal Data. + (line 36) +* sub function <1>: String Functions. (line 268) +* sub function: Using Constant Regexps. + (line 44) +* sub function, arguments of: String Functions. (line 325) +* sub function, escape processing: Gory Details. (line 6) +* subscript separators: User-modified. (line 132) +* subscripts in arrays, multidimensional: Multi-dimensional. (line 6) +* subscripts in arrays, multidimensional, scanning: Multi-scanning. + (line 11) +* subscripts in arrays, numbers as: Numeric Array Subscripts. + (line 6) +* subscripts in arrays, uninitialized variables as: Uninitialized Subscripts. + (line 6) +* SUBSEP variable: User-modified. (line 132) +* SUBSEP variable, multidimensional arrays: Multi-dimensional. + (line 12) +* substr function: String Functions. (line 412) +* Sumner, Andrew: Other Versions. (line 76) +* switch statement: Switch Statement. (line 6) +* syntactic ambiguity: /= operator vs. /=.../ regexp constant: Assignment Ops. + (line 148) +* system function: I/O Functions. (line 63) +* systime function (gawk): Time Functions. (line 24) +* tandem: Tandem Installation. (line 6) +* Tcl: Library Names. (line 57) +* TCP/IP: TCP/IP Networking. (line 6) +* TCP/IP, support for: Special Network. (line 6) +* tee utility: Tee Program. (line 6) +* tee.awk program: Tee Program. (line 26) +* terminating records: Records. (line 112) +* testbits.awk program: Bitwise Functions. (line 60) +* Texinfo <1>: Adding Code. (line 99) +* Texinfo <2>: Distribution contents. + (line 68) +* Texinfo <3>: Extract Program. (line 12) +* Texinfo <4>: Dupword Program. (line 17) +* Texinfo <5>: Library Functions. (line 22) +* Texinfo <6>: Sample Data Files. (line 66) +* Texinfo: Conventions. (line 6) +* Texinfo, chapter beginnings in files: Regexp Operators. (line 22) +* Texinfo, extracting programs from source files: Extract Program. + (line 6) +* text, printing: Print. (line 22) +* text, printing, unduplicated lines of: Uniq Program. (line 6) +* textdomain function (C library): Explaining gettext. (line 27) +* TEXTDOMAIN variable <1>: Programmer i18n. (line 9) +* TEXTDOMAIN variable: User-modified. (line 138) +* TEXTDOMAIN variable, BEGIN pattern and: Programmer i18n. (line 58) +* TEXTDOMAIN variable, portability and: I18N Portability. (line 20) +* tilde (~), ~ operator <1>: Expression Patterns. (line 24) +* tilde (~), ~ operator <2>: Precedence. (line 81) +* tilde (~), ~ operator <3>: Comparison Operators. + (line 11) +* tilde (~), ~ operator <4>: Regexp Constants. (line 6) +* tilde (~), ~ operator <5>: Computed Regexps. (line 6) +* tilde (~), ~ operator <6>: Case-sensitivity. (line 26) +* tilde (~), ~ operator: Regexp Usage. (line 19) +* time, alarm clock example program: Alarm Program. (line 9) +* time, localization and: Explaining gettext. (line 111) +* time, managing: Gettimeofday Function. + (line 6) +* time, retrieving: Time Functions. (line 17) +* timestamps: Time Functions. (line 6) +* timestamps, converting dates to: Time Functions. (line 72) +* timestamps, formatted: Gettimeofday Function. + (line 6) +* tmp_number internal function: Internals. (line 92) +* tmp_string internal function: Internals. (line 87) +* tolower function: String Functions. (line 454) +* toupper function: String Functions. (line 460) +* tr utility: Translate Program. (line 6) +* translate.awk program: Translate Program. (line 55) +* troubleshooting, --non-decimal-data option: Options. (line 171) +* troubleshooting, -F option: Known Bugs. (line 6) +* troubleshooting, == operator: Comparison Operators. + (line 37) +* troubleshooting, awk uses FS not IFS: Field Separators. (line 28) +* troubleshooting, backslash before nonspecial character: Escape Sequences. + (line 113) +* troubleshooting, division: Arithmetic Ops. (line 44) +* troubleshooting, fatal errors, field widths, specifying: Constant Size. + (line 22) +* troubleshooting, fatal errors, printf format strings: Format Modifiers. + (line 159) +* troubleshooting, fflush function: I/O Functions. (line 51) +* troubleshooting, function call syntax: Function Calls. (line 28) +* troubleshooting, gawk <1>: Compatibility Mode. (line 6) +* troubleshooting, gawk: Known Bugs. (line 6) +* troubleshooting, gawk, bug reports: Bugs. (line 9) +* troubleshooting, gawk, fatal errors, function arguments: Calling Built-in. + (line 16) +* troubleshooting, getline function: File Checking. (line 24) +* troubleshooting, gsub/sub functions: String Functions. (line 335) +* troubleshooting, match function: String Functions. (line 181) +* troubleshooting, print statement, omitting commas: Print Examples. + (line 31) +* troubleshooting, printing: Redirection. (line 115) +* troubleshooting, quotes with file names: Special FD. (line 63) +* troubleshooting, readable data files: File Checking. (line 6) +* troubleshooting, regexp constants vs. string constants: Computed Regexps. + (line 38) +* troubleshooting, string concatenation: Concatenation. (line 27) +* troubleshooting, substr function: String Functions. (line 430) +* troubleshooting, system function: I/O Functions. (line 87) +* troubleshooting, typographical errors, global variables: Options. + (line 101) +* true, logical: Truth Values. (line 6) +* Trueman, David <1>: Contributors. (line 31) +* Trueman, David <2>: Acknowledgments. (line 44) +* Trueman, David: History. (line 30) +* trunc-mod operation: Arithmetic Ops. (line 66) +* truth values: Truth Values. (line 6) +* type conversion: Conversion. (line 21) +* type internal variable: Internals. (line 58) +* undefined functions: Function Caveats. (line 79) +* underscore (_), _ C macro: Explaining gettext. (line 68) +* underscore (_), in names of private variables: Library Names. + (line 29) +* underscore (_), translatable string: Programmer i18n. (line 67) +* undocumented features: Undocumented. (line 6) +* uninitialized variables, as array subscripts: Uninitialized Subscripts. + (line 6) +* uniq utility: Uniq Program. (line 6) +* uniq.awk program: Uniq Program. (line 65) +* Unix: Glossary. (line 582) +* Unix awk, backslashes in escape sequences: Escape Sequences. + (line 125) +* Unix awk, close function and: Close Files And Pipes. + (line 130) +* Unix awk, password files, field separators and: Command Line Field Separator. + (line 72) +* Unix, awk scripts and: Executable Scripts. (line 6) +* unsigned integers: Basic Data Typing. (line 28) +* update_ERRNO internal function: Internals. (line 152) +* update_ERRNO_saved internal function: Internals. (line 157) +* user database, reading: Passwd Functions. (line 6) +* user-defined, functions: User-defined. (line 6) +* user-defined, functions, counts: Profiling. (line 135) +* user-defined, variables: Variables. (line 6) +* user-modifiable variables: User-modified. (line 6) +* users, information about, printing: Id Program. (line 6) +* users, information about, retrieving: Passwd Functions. (line 16) +* USR1 signal: Profiling. (line 185) +* values, numeric: Basic Data Typing. (line 13) +* values, string: Basic Data Typing. (line 13) +* variable typing: Typing and Comparison. + (line 9) +* variables <1>: Basic Data Typing. (line 6) +* variables: Other Features. (line 6) +* variables, assigning on command line: Assignment Options. (line 6) +* variables, built-in <1>: Built-in Variables. (line 6) +* variables, built-in: Using Variables. (line 17) +* variables, built-in, -v option, setting with: Options. (line 38) +* variables, built-in, conveying information: Auto-set. (line 6) +* variables, flag: Boolean Ops. (line 67) +* variables, getline command into, using <1>: Getline/Variable/Coprocess. + (line 6) +* variables, getline command into, using <2>: Getline/Variable/Pipe. + (line 6) +* variables, getline command into, using <3>: Getline/Variable/File. + (line 6) +* variables, getline command into, using: Getline/Variable. (line 6) +* variables, global, for library functions: Library Names. (line 11) +* variables, global, printing list of: Options. (line 95) +* variables, initializing: Using Variables. (line 17) +* variables, names of: Arrays. (line 17) +* variables, private: Library Names. (line 11) +* variables, setting: Options. (line 30) +* variables, shadowing: Definition Syntax. (line 56) +* variables, types of: Assignment Ops. (line 40) +* variables, types of, comparison expressions and: Typing and Comparison. + (line 9) +* variables, uninitialized, as array subscripts: Uninitialized Subscripts. + (line 6) +* variables, user-defined: Variables. (line 6) +* vertical bar (|): Regexp Operators. (line 68) +* vertical bar (|), | operator (I/O) <1>: Precedence. (line 65) +* vertical bar (|), | operator (I/O): Getline/Pipe. (line 6) +* vertical bar (|), |& I/O operator (I/O): Two-way I/O. (line 44) +* vertical bar (|), |& operator (I/O) <1>: Precedence. (line 65) +* vertical bar (|), |& operator (I/O): Getline/Coprocess. (line 6) +* vertical bar (|), |& operator (I/O), two-way communications: Portal Files. + (line 10) +* vertical bar (|), || operator <1>: Precedence. (line 90) +* vertical bar (|), || operator: Boolean Ops. (line 57) +* vname internal variable: Internals. (line 62) +* w utility: Constant Size. (line 22) +* Wall, Larry: Future Extensions. (line 6) +* warnings, issuing: Options. (line 144) +* wc utility: Wc Program. (line 6) +* wc.awk program: Wc Program. (line 45) +* Weinberger, Peter <1>: Contributors. (line 12) +* Weinberger, Peter: History. (line 17) +* while statement <1>: While Statement. (line 6) +* while statement: Regexp Usage. (line 19) +* whitespace, as field separators: Field Separators. (line 63) +* whitespace, functions, calling: Calling Built-in. (line 10) +* whitespace, newlines as: Options. (line 183) +* Williams, Kent: Contributors. (line 37) +* Woods, John: Contributors. (line 28) +* word boundaries, matching: GNU Regexp Operators. + (line 30) +* word, regexp definition of: GNU Regexp Operators. + (line 6) +* word-boundary operator (gawk): GNU Regexp Operators. + (line 55) +* wordfreq.awk program: Word Sorting. (line 60) +* words, counting: Wc Program. (line 6) +* words, duplicate, searching for: Dupword Program. (line 6) +* words, usage counts, generating: Word Sorting. (line 6) +* xgettext utility: String Extraction. (line 13) +* XML: Internals. (line 178) +* XOR bitwise operation: Bitwise Functions. (line 6) +* xor function (gawk): Bitwise Functions. (line 41) +* Zaretskii, Eli: Acknowledgments. (line 53) +* zero, negative vs. positive: Unexpected Results. (line 28) +* zerofile.awk program: Empty Files. (line 21) +* Zoulas, Christos: Contributors. (line 61) +* {} (braces), actions and: Action Overview. (line 19) +* {} (braces), pgawk program: Profiling. (line 140) +* {} (braces), statements, grouping: Statements. (line 10) +* | (vertical bar): Regexp Operators. (line 68) +* | (vertical bar), | operator (I/O) <1>: Precedence. (line 65) +* | (vertical bar), | operator (I/O) <2>: Redirection. (line 54) +* | (vertical bar), | operator (I/O): Getline/Pipe. (line 6) +* | (vertical bar), |& operator (I/O) <1>: Two-way I/O. (line 44) +* | (vertical bar), |& operator (I/O) <2>: Precedence. (line 65) +* | (vertical bar), |& operator (I/O) <3>: Redirection. (line 99) +* | (vertical bar), |& operator (I/O): Getline/Coprocess. (line 6) +* | (vertical bar), |& operator (I/O), pipes, closing: Close Files And Pipes. + (line 117) +* | (vertical bar), |& operator (I/O), two-way communications: Portal Files. + (line 10) +* | (vertical bar), || operator <1>: Precedence. (line 90) +* | (vertical bar), || operator: Boolean Ops. (line 57) +* ~ (tilde), ~ operator <1>: Expression Patterns. (line 24) +* ~ (tilde), ~ operator <2>: Precedence. (line 81) +* ~ (tilde), ~ operator <3>: Comparison Operators. + (line 11) +* ~ (tilde), ~ operator <4>: Regexp Constants. (line 6) +* ~ (tilde), ~ operator <5>: Computed Regexps. (line 6) +* ~ (tilde), ~ operator: Case-sensitivity. (line 26) + + + +Tag Table: +Node: Top1336 +Node: Foreword27371 +Node: Preface31692 +Ref: Preface-Footnote-134571 +Node: History34803 +Node: Names37019 +Ref: Names-Footnote-138491 +Node: This Manual38563 +Ref: This Manual-Footnote-143318 +Node: Conventions43418 +Node: Manual History45292 +Ref: Manual History-Footnote-148745 +Ref: Manual History-Footnote-248786 +Node: How To Contribute48860 +Node: Acknowledgments49458 +Node: Getting Started53260 +Node: Running gawk55632 +Node: One-shot56818 +Node: Read Terminal58043 +Ref: Read Terminal-Footnote-159701 +Node: Long59872 +Node: Executable Scripts61248 +Ref: Executable Scripts-Footnote-163144 +Ref: Executable Scripts-Footnote-263295 +Node: Comments63746 +Node: Quoting66114 +Node: Sample Data Files70615 +Node: Very Simple73647 +Node: Two Rules78252 +Node: More Complex80399 +Ref: More Complex-Footnote-183322 +Ref: More Complex-Footnote-283770 +Node: Statements/Lines83853 +Ref: Statements/Lines-Footnote-188235 +Node: Other Features88500 +Node: When89352 +Ref: When-Footnote-191591 +Node: Regexp91676 +Node: Regexp Usage93130 +Node: Escape Sequences95182 +Node: Regexp Operators100921 +Ref: Regexp Operators-Footnote-1108028 +Ref: Regexp Operators-Footnote-2108175 +Node: Character Lists108273 +Ref: table-char-classes110230 +Node: GNU Regexp Operators112855 +Node: Case-sensitivity116499 +Ref: Case-sensitivity-Footnote-1119672 +Node: Leftmost Longest119907 +Node: Computed Regexps121098 +Node: Locales124479 +Node: Reading Files126745 +Node: Records128502 +Ref: Records-Footnote-1137060 +Node: Fields137097 +Ref: Fields-Footnote-1140127 +Node: Nonconstant Fields140213 +Node: Changing Fields142415 +Node: Field Separators147696 +Node: Regexp Field Splitting151187 +Node: Single Character Fields153652 +Node: Command Line Field Separator154703 +Node: Field Splitting Summary158142 +Ref: Field Splitting Summary-Footnote-1161328 +Node: Constant Size161429 +Node: Multiple Line165906 +Ref: Multiple Line-Footnote-1171637 +Node: Getline171816 +Node: Plain Getline173884 +Node: Getline/Variable175901 +Node: Getline/File177042 +Node: Getline/Variable/File178366 +Node: Getline/Pipe179925 +Node: Getline/Variable/Pipe182522 +Node: Getline/Coprocess183629 +Node: Getline/Variable/Coprocess184872 +Node: Getline Notes185586 +Node: Getline Summary187229 +Ref: table-getline-variants187513 +Node: Printing188079 +Node: Print189708 +Node: Print Examples191034 +Node: Output Separators193829 +Node: OFMT195590 +Node: Printf196945 +Node: Basic Printf197864 +Node: Control Letters199399 +Node: Format Modifiers202617 +Node: Printf Examples208635 +Node: Redirection211352 +Node: Special Files218249 +Node: Special FD218883 +Node: Special Process221909 +Node: Special Network224144 +Node: Special Caveats224986 +Ref: Special Caveats-Footnote-1226184 +Node: Close Files And Pipes226567 +Ref: Close Files And Pipes-Footnote-1233488 +Ref: Close Files And Pipes-Footnote-2233636 +Node: Expressions233784 +Node: Constants235973 +Node: Scalar Constants236654 +Ref: Scalar Constants-Footnote-1237509 +Node: Nondecimal-numbers237691 +Node: Regexp Constants240749 +Node: Using Constant Regexps241222 +Node: Variables244305 +Node: Using Variables244961 +Node: Assignment Options246471 +Node: Conversion248348 +Ref: table-locale-affects253780 +Ref: Conversion-Footnote-1254404 +Node: Arithmetic Ops254513 +Node: Concatenation257025 +Ref: Concatenation-Footnote-1259807 +Node: Assignment Ops259898 +Ref: table-assign-ops264876 +Node: Increment Ops266277 +Node: Truth Values269770 +Node: Typing and Comparison270820 +Node: Variable Typing271523 +Ref: Variable Typing-Footnote-1275198 +Node: Comparison Operators275342 +Ref: table-relational-ops275718 +Node: Boolean Ops279267 +Ref: Boolean Ops-Footnote-1283327 +Node: Conditional Exp283418 +Node: Function Calls285155 +Node: Precedence288437 +Node: Patterns and Actions292093 +Node: Pattern Overview293147 +Node: Regexp Patterns294584 +Node: Expression Patterns295127 +Node: Ranges298677 +Node: BEGIN/END301766 +Node: Using BEGIN/END302516 +Ref: Using BEGIN/END-Footnote-1305248 +Node: I/O And BEGIN/END305362 +Node: Empty307629 +Node: Using Shell Variables307937 +Node: Action Overview310218 +Node: Statements312576 +Node: If Statement314432 +Node: While Statement315931 +Node: Do Statement317963 +Node: For Statement319112 +Node: Switch Statement322252 +Node: Break Statement324528 +Node: Continue Statement326585 +Node: Next Statement328489 +Node: Nextfile Statement330769 +Node: Exit Statement333366 +Node: Built-in Variables335437 +Node: User-modified336532 +Ref: User-modified-Footnote-1343775 +Node: Auto-set343837 +Ref: Auto-set-Footnote-1352177 +Node: ARGC and ARGV352382 +Node: Arrays356094 +Node: Array Intro358002 +Node: Reference to Elements362199 +Node: Assigning Elements364066 +Node: Array Example364533 +Node: Scanning an Array366255 +Node: Delete368522 +Ref: Delete-Footnote-1370904 +Node: Numeric Array Subscripts370961 +Node: Uninitialized Subscripts373148 +Node: Multi-dimensional374754 +Node: Multi-scanning377767 +Node: Array Sorting379382 +Node: Functions383045 +Node: Built-in383780 +Node: Calling Built-in384750 +Node: Numeric Functions386717 +Ref: Numeric Functions-Footnote-1390459 +Ref: Numeric Functions-Footnote-2390785 +Node: String Functions391054 +Ref: String Functions-Footnote-1410916 +Ref: String Functions-Footnote-2411045 +Ref: String Functions-Footnote-3411293 +Node: Gory Details411380 +Ref: table-sub-escapes413015 +Ref: table-sub-posix-92414350 +Ref: table-sub-proposed415689 +Ref: table-posix-2001-sub417041 +Ref: table-gensub-escapes418378 +Ref: Gory Details-Footnote-1419564 +Node: I/O Functions419615 +Ref: I/O Functions-Footnote-1426189 +Node: Time Functions426280 +Ref: Time Functions-Footnote-1437072 +Ref: Time Functions-Footnote-2437140 +Ref: Time Functions-Footnote-3437298 +Ref: Time Functions-Footnote-4437409 +Ref: Time Functions-Footnote-5437534 +Ref: Time Functions-Footnote-6437761 +Node: Bitwise Functions438023 +Ref: table-bitwise-ops438601 +Ref: Bitwise Functions-Footnote-1442835 +Node: I18N Functions443019 +Node: User-defined444740 +Node: Definition Syntax445521 +Node: Function Example449880 +Node: Function Caveats452460 +Node: Return Statement456385 +Node: Dynamic Typing459042 +Node: Internationalization459779 +Node: I18N and L10N461198 +Node: Explaining gettext461882 +Ref: Explaining gettext-Footnote-1466789 +Ref: Explaining gettext-Footnote-2467028 +Node: Programmer i18n467197 +Node: Translator i18n471420 +Node: String Extraction472210 +Ref: String Extraction-Footnote-1473160 +Node: Printf Ordering473286 +Ref: Printf Ordering-Footnote-1476064 +Node: I18N Portability476128 +Ref: I18N Portability-Footnote-1478556 +Node: I18N Example478619 +Ref: I18N Example-Footnote-1481231 +Node: Gawk I18N481303 +Node: Advanced Features481885 +Node: Nondecimal Data483284 +Node: Two-way I/O484843 +Ref: Two-way I/O-Footnote-1490324 +Node: TCP/IP Networking490401 +Node: Portal Files492830 +Node: Profiling493474 +Node: Invoking Gawk500930 +Node: Command Line502110 +Node: Options502895 +Ref: Options-Footnote-1515735 +Node: Other Arguments515760 +Node: AWKPATH Variable518441 +Ref: AWKPATH Variable-Footnote-1521213 +Node: Obsolete521473 +Node: Undocumented522473 +Node: Known Bugs522735 +Node: Library Functions523337 +Ref: Library Functions-Footnote-1526318 +Node: Library Names526489 +Ref: Library Names-Footnote-1529962 +Ref: Library Names-Footnote-2530181 +Node: General Functions530267 +Node: Nextfile Function531326 +Node: Strtonum Function535690 +Node: Assert Function538625 +Node: Round Function541929 +Node: Cliff Random Function543436 +Ref: Cliff Random Function-Footnote-1544425 +Node: Ordinal Functions544496 +Ref: Ordinal Functions-Footnote-1547556 +Node: Join Function547772 +Ref: Join Function-Footnote-1549532 +Node: Gettimeofday Function549732 +Node: Data File Management553435 +Node: Filetrans Function554067 +Node: Rewind Function557493 +Node: File Checking558939 +Node: Empty Files559991 +Node: Ignoring Assigns562216 +Node: Getopt Function563764 +Ref: Getopt Function-Footnote-1575042 +Node: Passwd Functions575243 +Ref: Passwd Functions-Footnote-1583904 +Node: Group Functions583992 +Node: Sample Programs591990 +Node: Running Examples592667 +Node: Clones593395 +Node: Cut Program594527 +Node: Egrep Program604284 +Ref: Egrep Program-Footnote-1612034 +Node: Id Program612144 +Node: Split Program615751 +Node: Tee Program619215 +Node: Uniq Program621892 +Node: Wc Program629260 +Ref: Wc Program-Footnote-1633504 +Node: Miscellaneous Programs633700 +Node: Dupword Program634696 +Node: Alarm Program636727 +Node: Translate Program641267 +Ref: Translate Program-Footnote-1645513 +Ref: Translate Program-Footnote-2645750 +Node: Labels Program645884 +Ref: Labels Program-Footnote-1649175 +Node: Word Sorting649259 +Node: History Sorting653542 +Node: Extract Program655380 +Node: Simple Sed662732 +Node: Igawk Program665787 +Ref: Igawk Program-Footnote-1680492 +Ref: Igawk Program-Footnote-2680693 +Node: Language History680831 +Node: V7/SVR3.1682215 +Node: SVR4684479 +Node: POSIX685918 +Node: BTL687526 +Node: POSIX/GNU689051 +Node: Contributors696885 +Node: Installation700421 +Node: Gawk Distribution701392 +Node: Getting701876 +Node: Extracting703110 +Node: Distribution contents704498 +Node: Unix Installation709579 +Node: Quick Installation710170 +Node: Additional Configuration Options711872 +Node: Configuration Philosophy713734 +Node: Non-Unix Installation716098 +Node: Amiga Installation716685 +Node: BeOS Installation717781 +Node: PC Installation718934 +Node: PC Binary Installation720164 +Node: PC Compiling722007 +Node: PC Dynamic726559 +Node: PC Using728920 +Node: Cygwin733533 +Ref: Cygwin-Footnote-1734531 +Node: VMS Installation734563 +Node: VMS Compilation735167 +Node: VMS Installation Details736744 +Node: VMS Running738374 +Node: VMS POSIX739971 +Node: VMS Old Gawk741269 +Node: Unsupported741738 +Node: Atari Installation742141 +Node: Atari Compiling743430 +Node: Atari Using745315 +Node: Tandem Installation748160 +Node: Bugs749840 +Node: Other Versions753145 +Ref: Other Versions-Footnote-1757571 +Ref: Other Versions-Footnote-2757613 +Ref: Other Versions-Footnote-3757650 +Node: Notes757688 +Node: Compatibility Mode758380 +Node: Additions759174 +Node: Adding Code759924 +Node: New Ports765974 +Node: Dynamic Extensions770106 +Node: Internals771363 +Node: Sample Library782366 +Node: Internal File Description783025 +Node: Internal File Ops786718 +Ref: Internal File Ops-Footnote-1792044 +Node: Using Internal File Ops792192 +Node: Future Extensions794215 +Node: Basic Concepts798168 +Node: Basic High Level798925 +Ref: Basic High Level-Footnote-1802957 +Node: Basic Data Typing803151 +Node: Floating Point Issues807588 +Ref: Floating Point Issues-Footnote-1808674 +Node: String Conversion Precision808727 +Ref: String Conversion Precision-Footnote-1810421 +Node: Unexpected Results810530 +Node: POSIX Floating Point Problems812356 +Ref: POSIX Floating Point Problems-Footnote-1815830 +Node: Glossary815868 +Node: Copying839636 +Node: GNU Free Documentation License877193 +Node: Index899595 + +End Tag Table diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawkinet.info b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawkinet.info new file mode 100644 index 0000000..a496f6a --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawkinet.info @@ -0,0 +1,4404 @@ +INFO-DIR-SECTION Network applications +START-INFO-DIR-ENTRY +This is gawkinet.info, produced by makeinfo version 4.11 from gawkinet.texi. + +* Gawkinet: (gawkinet). TCP/IP Internetworking With `gawk'. +END-INFO-DIR-ENTRY + + This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the +3.1.4 (or later) version of the GNU implementation of AWK. + + + Copyright (C) 2000, 2001, 2002, 2004 Free Software Foundation, Inc. + + + Permission is granted to copy, distribute and/or modify this document +under the terms of the GNU Free Documentation License, Version 1.2 or +any later version published by the Free Software Foundation; with the +Invariant Sections being "GNU General Public License", the Front-Cover +texts being (a) (see below), and with the Back-Cover Texts being (b) +(see below). A copy of the license is included in the section entitled +"GNU Free Documentation License". + + a. "A GNU Manual" + + b. "You have freedom to copy and modify this GNU Manual, like GNU + software. Copies published by the Free Software Foundation raise + funds for GNU development." + + This file documents the networking features in GNU `awk'. + + This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the +3.1.4 (or later) version of the GNU implementation of AWK. + + + Copyright (C) 2000, 2001, 2002, 2004 Free Software Foundation, Inc. + + + Permission is granted to copy, distribute and/or modify this document +under the terms of the GNU Free Documentation License, Version 1.2 or +any later version published by the Free Software Foundation; with the +Invariant Sections being "GNU General Public License", the Front-Cover +texts being (a) (see below), and with the Back-Cover Texts being (b) +(see below). A copy of the license is included in the section entitled +"GNU Free Documentation License". + + a. "A GNU Manual" + + b. "You have freedom to copy and modify this GNU Manual, like GNU + software. Copies published by the Free Software Foundation raise + funds for GNU development." + + +File: gawkinet.info, Node: Top, Next: Preface, Prev: (dir), Up: (dir) + +General Introduction +******************** + +This file documents the networking features in GNU Awk (`gawk') version +3.1 and later. + + This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the +3.1.4 (or later) version of the GNU implementation of AWK. + + + Copyright (C) 2000, 2001, 2002, 2004 Free Software Foundation, Inc. + + + Permission is granted to copy, distribute and/or modify this document +under the terms of the GNU Free Documentation License, Version 1.2 or +any later version published by the Free Software Foundation; with the +Invariant Sections being "GNU General Public License", the Front-Cover +texts being (a) (see below), and with the Back-Cover Texts being (b) +(see below). A copy of the license is included in the section entitled +"GNU Free Documentation License". + + a. "A GNU Manual" + + b. "You have freedom to copy and modify this GNU Manual, like GNU + software. Copies published by the Free Software Foundation raise + funds for GNU development." + +* Menu: + +* Preface:: About this document. +* Introduction:: About networking. +* Using Networking:: Some examples. +* Some Applications and Techniques:: More extended examples. +* Links:: Where to find the stuff mentioned in this + document. +* GNU Free Documentation License:: The license for this document. +* Index:: The index. + +* Stream Communications:: Sending data streams. +* Datagram Communications:: Sending self-contained messages. +* The TCP/IP Protocols:: How these models work in the Internet. +* Basic Protocols:: The basic protocols. +* Ports:: The idea behind ports. +* Making Connections:: Making TCP/IP connections. +* Gawk Special Files:: How to do `gawk' networking. +* Special File Fields:: The fields in the special file name. +* Comparing Protocols:: Differences between the protocols. +* File /inet/tcp:: The TCP special file. +* File /inet/udp:: The UDP special file. +* File /inet/raw:: The RAW special file. +* TCP Connecting:: Making a TCP connection. +* Troubleshooting:: Troubleshooting TCP/IP connections. +* Interacting:: Interacting with a service. +* Setting Up:: Setting up a service. +* Email:: Reading email. +* Web page:: Reading a Web page. +* Primitive Service:: A primitive Web service. +* Interacting Service:: A Web service with interaction. +* CGI Lib:: A simple CGI library. +* Simple Server:: A simple Web server. +* Caveats:: Network programming caveats. +* Challenges:: Where to go from here. +* PANIC:: An Emergency Web Server. +* GETURL:: Retrieving Web Pages. +* REMCONF:: Remote Configuration Of Embedded Systems. +* URLCHK:: Look For Changed Web Pages. +* WEBGRAB:: Extract Links From A Page. +* STATIST:: Graphing A Statistical Distribution. +* MAZE:: Walking Through A Maze In Virtual Reality. +* MOBAGWHO:: A Simple Mobile Agent. +* STOXPRED:: Stock Market Prediction As A Service. +* PROTBASE:: Searching Through A Protein Database. + + +File: gawkinet.info, Node: Preface, Next: Introduction, Prev: Top, Up: Top + +Preface +******* + +In May of 1997, Ju"rgen Kahrs felt the need for network access from +`awk', and, with a little help from me, set about adding features to do +this for `gawk'. At that time, he wrote the bulk of this Info file. + + The code and documentation were added to the `gawk' 3.1 development +tree, and languished somewhat until I could finally get down to some +serious work on that version of `gawk'. This finally happened in the +middle of 2000. + + Meantime, Ju"rgen wrote an article about the Internet special files +and `|&' operator for `Linux Journal', and made a networking patch for +the production versions of `gawk' available from his home page. In +August of 2000 (for `gawk' 3.0.6), this patch also made it to the main +GNU `ftp' distribution site. + + For release with `gawk', I edited Ju"rgen's prose for English +grammar and style, as he is not a native English speaker. I also +rearranged the material somewhat for what I felt was a better order of +presentation, and (re)wrote some of the introductory material. + + The majority of this document and the code are his work, and the +high quality and interesting ideas speak for themselves. It is my hope +that these features will be of significant value to the `awk' community. + + +Arnold Robbins +Nof Ayalon, ISRAEL +March, 2001 + + +File: gawkinet.info, Node: Introduction, Next: Using Networking, Prev: Preface, Up: Top + +1 Networking Concepts +********************* + +This major node provides a (necessarily) brief introduction to computer +networking concepts. For many applications of `gawk' to TCP/IP +networking, we hope that this is enough. For more advanced tasks, you +will need deeper background, and it may be necessary to switch to +lower-level programming in C or C++. + + There are two real-life models for the way computers send messages +to each other over a network. While the analogies are not perfect, +they are close enough to convey the major concepts. These two models +are the phone system (reliable byte-stream communications), and the +postal system (best-effort datagrams). + +* Menu: + +* Stream Communications:: Sending data streams. +* Datagram Communications:: Sending self-contained messages. +* The TCP/IP Protocols:: How these models work in the Internet. +* Making Connections:: Making TCP/IP connections. + + +File: gawkinet.info, Node: Stream Communications, Next: Datagram Communications, Prev: Introduction, Up: Introduction + +1.1 Reliable Byte-streams (Phone Calls) +======================================= + +When you make a phone call, the following steps occur: + + 1. You dial a number. + + 2. The phone system connects to the called party, telling them there + is an incoming call. (Their phone rings.) + + 3. The other party answers the call, or, in the case of a computer + network, refuses to answer the call. + + 4. Assuming the other party answers, the connection between you is + now a "duplex" (two-way), "reliable" (no data lost), sequenced + (data comes out in the order sent) data stream. + + 5. You and your friend may now talk freely, with the phone system + moving the data (your voices) from one end to the other. From + your point of view, you have a direct end-to-end connection with + the person on the other end. + + The same steps occur in a duplex reliable computer networking +connection. There is considerably more overhead in setting up the +communications, but once it's done, data moves in both directions, +reliably, in sequence. + + +File: gawkinet.info, Node: Datagram Communications, Next: The TCP/IP Protocols, Prev: Stream Communications, Up: Introduction + +1.2 Best-effort Datagrams (Mailed Letters) +========================================== + +Suppose you mail three different documents to your office on the other +side of the country on two different days. Doing so entails the +following. + + 1. Each document travels in its own envelope. + + 2. Each envelope contains both the sender and the recipient address. + + 3. Each envelope may travel a different route to its destination. + + 4. The envelopes may arrive in a different order from the one in + which they were sent. + + 5. One or more may get lost in the mail. (Although, fortunately, + this does not occur very often.) + + 6. In a computer network, one or more "packets" may also arrive + multiple times. (This doesn't happen with the postal system!) + + + The important characteristics of datagram communications, like those +of the postal system are thus: + + * Delivery is "best effort;" the data may never get there. + + * Each message is self-contained, including the source and + destination addresses. + + * Delivery is _not_ sequenced; packets may arrive out of order, + and/or multiple times. + + * Unlike the phone system, overhead is considerably lower. It is + not necessary to set up the call first. + + The price the user pays for the lower overhead of datagram +communications is exactly the lower reliability; it is often necessary +for user-level protocols that use datagram communications to add their +own reliability features on top of the basic communications. + + +File: gawkinet.info, Node: The TCP/IP Protocols, Next: Making Connections, Prev: Datagram Communications, Up: Introduction + +1.3 The Internet Protocols +========================== + +The Internet Protocol Suite (usually referred to as just TCP/IP)(1) +consists of a number of different protocols at different levels or +"layers." For our purposes, three protocols provide the fundamental +communications mechanisms. All other defined protocols are referred to +as user-level protocols (e.g., HTTP, used later in this Info file). + +* Menu: + +* Basic Protocols:: The basic protocols. +* Ports:: The idea behind ports. + + ---------- Footnotes ---------- + + (1) It should be noted that although the Internet seems to have +conquered the world, there are other networking protocol suites in +existence and in use. + + +File: gawkinet.info, Node: Basic Protocols, Next: Ports, Prev: The TCP/IP Protocols, Up: The TCP/IP Protocols + +1.3.1 The Basic Internet Protocols +---------------------------------- + +IP + The Internet Protocol. This protocol is almost never used + directly by applications. It provides the basic packet delivery + and routing infrastructure of the Internet. Much like the phone + company's switching centers or the Post Office's trucks, it is not + of much day-to-day interest to the regular user (or programmer). + It happens to be a best effort datagram protocol. + +UDP + The User Datagram Protocol. This is a best effort datagram + protocol. It provides a small amount of extra reliability over + IP, and adds the notion of "ports", described in *note TCP and UDP + Ports: Ports. + +TCP + The Transmission Control Protocol. This is a duplex, reliable, + sequenced byte-stream protocol, again layered on top of IP, and + also providing the notion of ports. This is the protocol that you + will most likely use when using `gawk' for network programming. + + All other user-level protocols use either TCP or UDP to do their +basic communications. Examples are SMTP (Simple Mail Transfer +Protocol), FTP (File Transfer Protocol), and HTTP (HyperText Transfer +Protocol). + + +File: gawkinet.info, Node: Ports, Prev: Basic Protocols, Up: The TCP/IP Protocols + +1.3.2 TCP and UDP Ports +----------------------- + +In the postal system, the address on an envelope indicates a physical +location, such as a residence or office building. But there may be +more than one person at a location; thus you have to further quantify +the recipient by putting a person or company name on the envelope. + + In the phone system, one phone number may represent an entire +company, in which case you need a person's extension number in order to +reach that individual directly. Or, when you call a home, you have to +say, "May I please speak to ..." before talking to the person directly. + + IP networking provides the concept of addressing. An IP address +represents a particular computer, but no more. In order to reach the +mail service on a system, or the FTP or WWW service on a system, you +must have some way to further specify which service you want. In the +Internet Protocol suite, this is done with "port numbers", which +represent the services, much like an extension number used with a phone +number. + + Port numbers are 16-bit integers. Unix and Unix-like systems +reserve ports below 1024 for "well known" services, such as SMTP, FTP, +and HTTP. Numbers 1024 and above may be used by any application, +although there is no promise made that a particular port number is +always available. + + +File: gawkinet.info, Node: Making Connections, Prev: The TCP/IP Protocols, Up: Introduction + +1.4 Making TCP/IP Connections (And Some Terminology) +==================================================== + +Two terms come up repeatedly when discussing networking: "client" and +"server". For now, we'll discuss these terms at the "connection +level", when first establishing connections between two processes on +different systems over a network. (Once the connection is established, +the higher level, or "application level" protocols, such as HTTP or +FTP, determine who is the client and who is the server. Often, it +turns out that the client and server are the same in both roles.) + + The "server" is the system providing the service, such as the web +server or email server. It is the "host" (system) which is _connected +to_ in a transaction. For this to work though, the server must be +expecting connections. Much as there has to be someone at the office +building to answer the phone(1), the server process (usually) has to be +started first and be waiting for a connection. + + The "client" is the system requesting the service. It is the system +_initiating the connection_ in a transaction. (Just as when you pick +up the phone to call an office or store.) + + In the TCP/IP framework, each end of a connection is represented by +a pair of (ADDRESS, PORT) pairs. For the duration of the connection, +the ports in use at each end are unique, and cannot be used +simultaneously by other processes on the same system. (Only after +closing a connection can a new one be built up on the same port. This +is contrary to the usual behavior of fully developed web servers which +have to avoid situations in which they are not reachable. We have to +pay this price in order to enjoy the benefits of a simple communication +paradigm in `gawk'.) + + Furthermore, once the connection is established, communications are +"synchronous".(2) I.e., each end waits on the other to finish +transmitting, before replying. This is much like two people in a phone +conversation. While both could talk simultaneously, doing so usually +doesn't work too well. + + In the case of TCP, the synchronicity is enforced by the protocol +when sending data. Data writes "block" until the data have been +received on the other end. For both TCP and UDP, data reads block +until there is incoming data waiting to be read. This is summarized in +the following table, where an "X" indicates that the given action +blocks. + +TCP X X +UDP X +RAW X + + ---------- Footnotes ---------- + + (1) In the days before voice mail systems! + + (2) For the technically savvy, data reads block--if there's no +incoming data, the program is made to wait until there is, instead of +receiving a "there's no data" error return. + + +File: gawkinet.info, Node: Using Networking, Next: Some Applications and Techniques, Prev: Introduction, Up: Top + +2 Networking With `gawk' +************************ + +The `awk' programming language was originally developed as a +pattern-matching language for writing short programs to perform data +manipulation tasks. `awk''s strength is the manipulation of textual +data that is stored in files. It was never meant to be used for +networking purposes. To exploit its features in a networking context, +it's necessary to use an access mode for network connections that +resembles the access of files as closely as possible. + + `awk' is also meant to be a prototyping language. It is used to +demonstrate feasibility and to play with features and user interfaces. +This can be done with file-like handling of network connections. +`gawk' trades the lack of many of the advanced features of the TCP/IP +family of protocols for the convenience of simple connection handling. +The advanced features are available when programming in C or Perl. In +fact, the network programming in this major node is very similar to +what is described in books such as `Internet Programming with Python', +`Advanced Perl Programming', or `Web Client Programming with Perl'. + + However, you can do the programming here without first having to +learn object-oriented ideology; underlying languages such as Tcl/Tk, +Perl, Python; or all of the libraries necessary to extend these +languages before they are ready for the Internet. + + This major node demonstrates how to use the TCP protocol. The other +protocols are much less important for most users (UDP) or even +untractable (RAW). + +* Menu: + +* Gawk Special Files:: How to do `gawk' networking. +* TCP Connecting:: Making a TCP connection. +* Troubleshooting:: Troubleshooting TCP/IP connections. +* Interacting:: Interacting with a service. +* Setting Up:: Setting up a service. +* Email:: Reading email. +* Web page:: Reading a Web page. +* Primitive Service:: A primitive Web service. +* Interacting Service:: A Web service with interaction. +* Simple Server:: A simple Web server. +* Caveats:: Network programming caveats. +* Challenges:: Where to go from here. + + +File: gawkinet.info, Node: Gawk Special Files, Next: TCP Connecting, Prev: Using Networking, Up: Using Networking + +2.1 `gawk''s Networking Mechanisms +================================== + +The `|&' operator introduced in `gawk' 3.1 for use in communicating +with a "coprocess" is described in *note Two-way Communications With +Another Process: (gawk)Two-way I/O. It shows how to do two-way I/O to a +separate process, sending it data with `print' or `printf' and reading +data with `getline'. If you haven't read it already, you should detour +there to do so. + + `gawk' transparently extends the two-way I/O mechanism to simple +networking through the use of special file names. When a "coprocess" +that matches the special files we are about to describe is started, +`gawk' creates the appropriate network connection, and then two-way I/O +proceeds as usual. + + At the C, C++, and Perl level, networking is accomplished via +"sockets", an Application Programming Interface (API) originally +developed at the University of California at Berkeley that is now used +almost universally for TCP/IP networking. Socket level programming, +while fairly straightforward, requires paying attention to a number of +details, as well as using binary data. It is not well-suited for use +from a high-level language like `awk'. The special files provided in +`gawk' hide the details from the programmer, making things much simpler +and easier to use. + + The special file name for network access is made up of several +fields, all of which are mandatory: + + /inet/PROTOCOL/LOCALPORT/HOSTNAME/REMOTEPORT + + The `/inet/' field is, of course, constant when accessing the +network. The LOCALPORT and REMOTEPORT fields do not have a meaning +when used with `/inet/raw' because "ports" only apply to TCP and UDP. +So, when using `/inet/raw', the port fields always have to be `0'. + +* Menu: + +* Special File Fields:: The fields in the special file name. +* Comparing Protocols:: Differences between the protocols. + + +File: gawkinet.info, Node: Special File Fields, Next: Comparing Protocols, Prev: Gawk Special Files, Up: Gawk Special Files + +2.1.1 The Fields of the Special File Name +----------------------------------------- + +This node explains the meaning of all the other fields, as well as the +range of values and the defaults. All of the fields are mandatory. To +let the system pick a value, or if the field doesn't apply to the +protocol, specify it as `0': + +PROTOCOL + Determines which member of the TCP/IP family of protocols is + selected to transport the data across the network. There are three + possible values (always written in lowercase): `tcp', `udp', and + `raw'. The exact meaning of each is explained later in this node. + +LOCALPORT + Determines which port on the local machine is used to communicate + across the network. It has no meaning with `/inet/raw' and must + therefore be `0'. Application-level clients usually use `0' to + indicate they do not care which local port is used--instead they + specify a remote port to connect to. It is vital for + application-level servers to use a number different from `0' here + because their service has to be available at a specific publicly + known port number. It is possible to use a name from + `/etc/services' here. + +HOSTNAME + Determines which remote host is to be at the other end of the + connection. Application-level servers must fill this field with a + `0' to indicate their being open for all other hosts to connect to + them and enforce connection level server behavior this way. It is + not possible for an application-level server to restrict its + availability to one remote host by entering a host name here. + Application-level clients must enter a name different from `0'. + The name can be either symbolic (e.g., `jpl-devvax.jpl.nasa.gov') + or numeric (e.g., `128.149.1.143'). + +REMOTEPORT + Determines which port on the remote machine is used to communicate + across the network. It has no meaning with `/inet/raw' and must + therefore be 0. For `/inet/tcp' and `/inet/udp', + application-level clients _must_ use a number other than `0' to + indicate to which port on the remote machine they want to connect. + Application-level servers must not fill this field with a `0'. + Instead they specify a local port to which clients connect. It is + possible to use a name from `/etc/services' here. + + Experts in network programming will notice that the usual +client/server asymmetry found at the level of the socket API is not +visible here. This is for the sake of simplicity of the high-level +concept. If this asymmetry is necessary for your application, use +another language. For `gawk', it is more important to enable users to +write a client program with a minimum of code. What happens when first +accessing a network connection is seen in the following pseudocode: + + if ((name of remote host given) && (other side accepts connection)) { + rendez-vous successful; transmit with getline or print + } else { + if ((other side did not accept) && (localport == 0)) + exit unsuccessful + if (TCP) { + set up a server accepting connections + this means waiting for the client on the other side to connect + } else + ready + } + + The exact behavior of this algorithm depends on the values of the +fields of the special file name. When in doubt, *note +table-inet-components:: gives you the combinations of values and their +meaning. If this table is too complicated, focus on the three lines +printed in *bold*. All the examples in *note Networking With `gawk': +Using Networking, use only the patterns printed in bold letters. + +PROTOCOL LOCAL PORT HOST NAME REMOTE RESULTING CONNECTION-LEVEL + PORT BEHAVIOR +------------------------------------------------------------------------------ +*tcp* *0* *x* *x* *Dedicated client, fails if + immediately connecting to a + server on the + other side fails* +udp 0 x x Dedicated client +raw 0 x 0 Dedicated client, works only + as `root' +*tcp, udp* *x* *x* *x* *Client, switches to + dedicated server if + necessary* +*tcp, udp* *x* *0* *0* *Dedicated server* +raw 0 0 0 Dedicated server, works only + as `root' +tcp, udp, x x 0 Invalid +raw +tcp, udp, 0 0 x Invalid +raw +tcp, udp, x 0 x Invalid +raw +tcp, udp 0 0 0 Invalid +tcp, udp 0 x 0 Invalid +raw x 0 0 Invalid +raw 0 x x Invalid +raw x x x Invalid + +Table 2.1: /inet Special File Components + + In general, TCP is the preferred mechanism to use. It is the +simplest protocol to understand and to use. Use the others only if +circumstances demand low-overhead. + + +File: gawkinet.info, Node: Comparing Protocols, Prev: Special File Fields, Up: Gawk Special Files + +2.1.2 Comparing Protocols +------------------------- + +This node develops a pair of programs (sender and receiver) that do +nothing but send a timestamp from one machine to another. The sender +and the receiver are implemented with each of the three protocols +available and demonstrate the differences between them. + +* Menu: + +* File /inet/tcp:: The TCP special file. +* File /inet/udp:: The UDP special file. +* File /inet/raw:: The RAW special file. + + +File: gawkinet.info, Node: File /inet/tcp, Next: File /inet/udp, Prev: Comparing Protocols, Up: Comparing Protocols + +2.1.2.1 `/inet/tcp' +................... + +Once again, always use TCP. (Use UDP when low overhead is a necessity, +and use RAW for network experimentation.) The first example is the +sender program: + + # Server + BEGIN { + print strftime() |& "/inet/tcp/8888/0/0" + close("/inet/tcp/8888/0/0") + } + + The receiver is very simple: + + # Client + BEGIN { + "/inet/tcp/0/localhost/8888" |& getline + print $0 + close("/inet/tcp/0/localhost/8888") + } + + TCP guarantees that the bytes arrive at the receiving end in exactly +the same order that they were sent. No byte is lost (except for broken +connections), doubled, or out of order. Some overhead is necessary to +accomplish this, but this is the price to pay for a reliable service. +It does matter which side starts first. The sender/server has to be +started first, and it waits for the receiver to read a line. + + +File: gawkinet.info, Node: File /inet/udp, Next: File /inet/raw, Prev: File /inet/tcp, Up: Comparing Protocols + +2.1.2.2 `/inet/udp' +................... + +The server and client programs that use UDP are almost identical to +their TCP counterparts; only the PROTOCOL has changed. As before, it +does matter which side starts first. The receiving side blocks and +waits for the sender. In this case, the receiver/client has to be +started first: + + # Server + BEGIN { + print strftime() |& "/inet/udp/8888/0/0" + close("/inet/udp/8888/0/0") + } + + The receiver is almost identical to the TCP receiver: + + # Client + BEGIN { + "/inet/udp/0/localhost/8888" |& getline + print $0 + close("/inet/udp/0/localhost/8888") + } + + UDP cannot guarantee that the datagrams at the receiving end will +arrive in exactly the same order they were sent. Some datagrams could be +lost, some doubled, and some out of order. But no overhead is necessary +to accomplish this. This unreliable behavior is good enough for tasks +such as data acquisition, logging, and even stateless services like NFS. + + +File: gawkinet.info, Node: File /inet/raw, Prev: File /inet/udp, Up: Comparing Protocols + +2.1.2.3 `/inet/raw' +................... + +This is an IP-level protocol. Only `root' is allowed to access this +special file. It is meant to be the basis for implementing and +experimenting with transport-level protocols.(1) In the most general +case, the sender has to supply the encapsulating header bytes in front +of the packet and the receiver has to strip the additional bytes from +the message. + + RAW receivers cannot receive packets sent with TCP or UDP because the +operating system does not deliver the packets to a RAW receiver. The +operating system knows about some of the protocols on top of IP and +decides on its own which packet to deliver to which process. (d.c.) +Therefore, the UDP receiver must be used for receiving UDP datagrams +sent with the RAW sender. This is a dark corner, not only of `gawk', +but also of TCP/IP. + + For extended experimentation with protocols, look into the approach +implemented in a tool called SPAK. This tool reflects the hierarchical +layering of protocols (encapsulation) in the way data streams are piped +out of one program into the next one. It shows which protocol is based +on which other (lower-level) protocol by looking at the command-line +ordering of the program calls. Cleverly thought out, SPAK is much +better than `gawk''s `/inet' for learning the meaning of each and every +bit in the protocol headers. + + The next example uses the RAW protocol to emulate the behavior of +UDP. The sender program is the same as above, but with some additional +bytes that fill the places of the UDP fields: + + BEGIN { + Message = "Hello world\n" + SourcePort = 0 + DestinationPort = 8888 + MessageLength = length(Message)+8 + RawService = "/inet/raw/0/localhost/0" + printf("%c%c%c%c%c%c%c%c%s", + SourcePort/256, SourcePort%256, + DestinationPort/256, DestinationPort%256, + MessageLength/256, MessageLength%256, + 0, 0, Message) |& RawService + fflush(RawService) + close(RawService) + } + + Since this program tries to emulate the behavior of UDP, it checks if +the RAW sender is understood by the UDP receiver but not if the RAW +receiver can understand the UDP sender. In a real network, the RAW +receiver is hardly of any use because it gets every IP packet that +comes across the network. There are usually so many packets that `gawk' +would be too slow for processing them. Only on a network with little +traffic can the IP-level receiver program be tested. Programs for +analyzing IP traffic on modem or ISDN channels should be possible. + + Port numbers do not have a meaning when using `/inet/raw'. Their +fields have to be `0'. Only TCP and UDP use ports. Receiving data from +`/inet/raw' is difficult, not only because of processing speed but also +because data is usually binary and not restricted to ASCII. This +implies that line separation with `RS' does not work as usual. + + ---------- Footnotes ---------- + + (1) This special file is reserved, but not otherwise currently +implemented. + + +File: gawkinet.info, Node: TCP Connecting, Next: Troubleshooting, Prev: Gawk Special Files, Up: Using Networking + +2.2 Establishing a TCP Connection +================================= + +Let's observe a network connection at work. Type in the following +program and watch the output. Within a second, it connects via TCP +(`/inet/tcp') to the machine it is running on (`localhost') and asks +the service `daytime' on the machine what time it is: + + BEGIN { + "/inet/tcp/0/localhost/daytime" |& getline + print $0 + close("/inet/tcp/0/localhost/daytime") + } + + Even experienced `awk' users will find the second line strange in two +respects: + + * A special file is used as a shell command that pipes its output + into `getline'. One would rather expect to see the special file + being read like any other file (`getline < + "/inet/tcp/0/localhost/daytime")'. + + * The operator `|&' has not been part of any `awk' implementation + (until now). It is actually the only extension of the `awk' + language needed (apart from the special files) to introduce + network access. + + The `|&' operator was introduced in `gawk' 3.1 in order to overcome +the crucial restriction that access to files and pipes in `awk' is +always unidirectional. It was formerly impossible to use both access +modes on the same file or pipe. Instead of changing the whole concept +of file access, the `|&' operator behaves exactly like the usual pipe +operator except for two additions: + + * Normal shell commands connected to their `gawk' program with a `|&' + pipe can be accessed bidirectionally. The `|&' turns out to be a + quite general, useful, and natural extension of `awk'. + + * Pipes that consist of a special file name for network connections + are not executed as shell commands. Instead, they can be read and + written to, just like a full-duplex network connection. + + In the earlier example, the `|&' operator tells `getline' to read a +line from the special file `/inet/tcp/0/localhost/daytime'. We could +also have printed a line into the special file. But instead we just +read a line with the time, printed it, and closed the connection. +(While we could just let `gawk' close the connection by finishing the +program, in this Info file we are pedantic and always explicitly close +the connections.) + + +File: gawkinet.info, Node: Troubleshooting, Next: Interacting, Prev: TCP Connecting, Up: Using Networking + +2.3 Troubleshooting Connection Problems +======================================= + +It may well be that for some reason the program shown in the previous +example does not run on your machine. When looking at possible reasons +for this, you will learn much about typical problems that arise in +network programming. First of all, your implementation of `gawk' may +not support network access because it is a pre-3.1 version or you do +not have a network interface in your machine. Perhaps your machine +uses some other protocol, such as DECnet or Novell's IPX. For the rest +of this major node, we will assume you work on a Unix machine that +supports TCP/IP. If the previous example program does not run on your +machine, it may help to replace the name `localhost' with the name of +your machine or its IP address. If it does, you could replace +`localhost' with the name of another machine in your vicinity--this +way, the program connects to another machine. Now you should see the +date and time being printed by the program, otherwise your machine may +not support the `daytime' service. Try changing the service to +`chargen' or `ftp'. This way, the program connects to other services +that should give you some response. If you are curious, you should have +a look at your `/etc/services' file. It could look like this: + + # /etc/services: + # + # Network services, Internet style + # + # Name Number/Protcol Alternate name # Comments + + echo 7/tcp + echo 7/udp + discard 9/tcp sink null + discard 9/udp sink null + daytime 13/tcp + daytime 13/udp + chargen 19/tcp ttytst source + chargen 19/udp ttytst source + ftp 21/tcp + telnet 23/tcp + smtp 25/tcp mail + finger 79/tcp + www 80/tcp http # WorldWideWeb HTTP + www 80/udp # HyperText Transfer Protocol + pop-2 109/tcp postoffice # POP version 2 + pop-2 109/udp + pop-3 110/tcp # POP version 3 + pop-3 110/udp + nntp 119/tcp readnews untp # USENET News + irc 194/tcp # Internet Relay Chat + irc 194/udp + ... + + Here, you find a list of services that traditional Unix machines +usually support. If your GNU/Linux machine does not do so, it may be +that these services are switched off in some startup script. Systems +running some flavor of Microsoft Windows usually do _not_ support these +services. Nevertheless, it _is_ possible to do networking with `gawk' +on Microsoft Windows.(1) The first column of the file gives the name of +the service, and the second column gives a unique number and the +protocol that one can use to connect to this service. The rest of the +line is treated as a comment. You see that some services (`echo') +support TCP as well as UDP. + + ---------- Footnotes ---------- + + (1) Microsoft preferred to ignore the TCP/IP family of protocols +until 1995. Then came the rise of the Netscape browser as a landmark +"killer application." Microsoft added TCP/IP support and their own +browser to Microsoft Windows 95 at the last minute. They even +back-ported their TCP/IP implementation to Microsoft Windows for +Workgroups 3.11, but it was a rather rudimentary and half-hearted +implementation. Nevertheless, the equivalent of `/etc/services' resides +under `C:\WINNT\system32\drivers\etc\services' on Microsoft Windows +2000. + + +File: gawkinet.info, Node: Interacting, Next: Setting Up, Prev: Troubleshooting, Up: Using Networking + +2.4 Interacting with a Network Service +====================================== + +The next program makes use of the possibility to really interact with a +network service by printing something into the special file. It asks the +so-called `finger' service if a user of the machine is logged in. When +testing this program, try to change `localhost' to some other machine +name in your local network: + + BEGIN { + NetService = "/inet/tcp/0/localhost/finger" + print "NAME" |& NetService + while ((NetService |& getline) > 0) + print $0 + close(NetService) + } + + After telling the service on the machine which user to look for, the +program repeatedly reads lines that come as a reply. When no more lines +are coming (because the service has closed the connection), the program +also closes the connection. Try replacing `"NAME"' with your login name +(or the name of someone else logged in). For a list of all users +currently logged in, replace NAME with an empty string (`""'). + + The final `close' command could be safely deleted from the above +script, because the operating system closes any open connection by +default when a script reaches the end of execution. In order to avoid +portability problems, it is best to always close connections explicitly. +With the Linux kernel, for example, proper closing results in flushing +of buffers. Letting the close happen by default may result in +discarding buffers. + + When looking at `/etc/services' you may have noticed that the +`daytime' service is also available with `udp'. In the earlier example, +change `tcp' to `udp', and change `finger' to `daytime'. After +starting the modified program, you see the expected day and time +message. The program then hangs, because it waits for more lines +coming from the service. However, they never come. This behavior is a +consequence of the differences between TCP and UDP. When using UDP, +neither party is automatically informed about the other closing the +connection. Continuing to experiment this way reveals many other subtle +differences between TCP and UDP. To avoid such trouble, one should +always remember the advice Douglas E. Comer and David Stevens give in +Volume III of their series `Internetworking With TCP' (page 14): + + When designing client-server applications, beginners are strongly + advised to use TCP because it provides reliable, + connection-oriented communication. Programs only use UDP if the + application protocol handles reliability, the application requires + hardware broadcast or multicast, or the application cannot + tolerate virtual circuit overhead. + + +File: gawkinet.info, Node: Setting Up, Next: Email, Prev: Interacting, Up: Using Networking + +2.5 Setting Up a Service +======================== + +The preceding programs behaved as clients that connect to a server +somewhere on the Internet and request a particular service. Now we set +up such a service to mimic the behavior of the `daytime' service. Such +a server does not know in advance who is going to connect to it over +the network. Therefore, we cannot insert a name for the host to connect +to in our special file name. + + Start the following program in one window. Notice that the service +does not have the name `daytime', but the number `8888'. From looking +at `/etc/services', you know that names like `daytime' are just +mnemonics for predetermined 16-bit integers. Only the system +administrator (`root') could enter our new service into `/etc/services' +with an appropriate name. Also notice that the service name has to be +entered into a different field of the special file name because we are +setting up a server, not a client: + + BEGIN { + print strftime() |& "/inet/tcp/8888/0/0" + close("/inet/tcp/8888/0/0") + } + + Now open another window on the same machine. Copy the client +program given as the first example (*note Establishing a TCP +Connection: TCP Connecting.) to a new file and edit it, changing the +name `daytime' to `8888'. Then start the modified client. You should +get a reply like this: + + Sat Sep 27 19:08:16 CEST 1997 + +Both programs explicitly close the connection. + + Now we will intentionally make a mistake to see what happens when +the name `8888' (the so-called port) is already used by another service. +Start the server program in both windows. The first one works, but the +second one complains that it could not open the connection. Each port +on a single machine can only be used by one server program at a time. +Now terminate the server program and change the name `8888' to `echo'. +After restarting it, the server program does not run any more, and you +know why: there is already an `echo' service running on your machine. +But even if this isn't true, you would not get your own `echo' server +running on a Unix machine, because the ports with numbers smaller than +1024 (`echo' is at port 7) are reserved for `root'. On machines +running some flavor of Microsoft Windows, there is no restriction that +reserves ports 1 to 1024 for a privileged user; hence, you can start an +`echo' server there. + + Turning this short server program into something really useful is +simple. Imagine a server that first reads a file name from the client +through the network connection, then does something with the file and +sends a result back to the client. The server-side processing could be: + + BEGIN { + NetService = "/inet/tcp/8888/0/0" + NetService |& getline + CatPipe = ("cat " $1) # sets $0 and the fields + while ((CatPipe | getline) > 0) + print $0 |& NetService + close(NetService) + } + +and we would have a remote copying facility. Such a server reads the +name of a file from any client that connects to it and transmits the +contents of the named file across the net. The server-side processing +could also be the execution of a command that is transmitted across the +network. From this example, you can see how simple it is to open up a +security hole on your machine. If you allow clients to connect to your +machine and execute arbitrary commands, anyone would be free to do `rm +-rf *'. + + +File: gawkinet.info, Node: Email, Next: Web page, Prev: Setting Up, Up: Using Networking + +2.6 Reading Email +================= + +The distribution of email is usually done by dedicated email servers +that communicate with your machine using special protocols. To receive +email, we will use the Post Office Protocol (POP). Sending can be done +with the much older Simple Mail Transfer Protocol (SMTP). + + When you type in the following program, replace the EMAILHOST by the +name of your local email server. Ask your administrator if the server +has a POP service, and then use its name or number in the program below. +Now the program is ready to connect to your email server, but it will +not succeed in retrieving your mail because it does not yet know your +login name or password. Replace them in the program and it shows you +the first email the server has in store: + + BEGIN { + POPService = "/inet/tcp/0/EMAILHOST/pop3" + RS = ORS = "\r\n" + print "user NAME" |& POPService + POPService |& getline + print "pass PASSWORD" |& POPService + POPService |& getline + print "retr 1" |& POPService + POPService |& getline + if ($1 != "+OK") exit + print "quit" |& POPService + RS = "\r\n\\.\r\n" + POPService |& getline + print $0 + close(POPService) + } + + The record separators `RS' and `ORS' are redefined because the +protocol (POP) requires CR-LF to separate lines. After identifying +yourself to the email service, the command `retr 1' instructs the +service to send the first of all your email messages in line. If the +service replies with something other than `+OK', the program exits; +maybe there is no email. Otherwise, the program first announces that it +intends to finish reading email, and then redefines `RS' in order to +read the entire email as multiline input in one record. From the POP +RFC, we know that the body of the email always ends with a single line +containing a single dot. The program looks for this using `RS = +"\r\n\\.\r\n"'. When it finds this sequence in the mail message, it +quits. You can invoke this program as often as you like; it does not +delete the message it reads, but instead leaves it on the server. + + +File: gawkinet.info, Node: Web page, Next: Primitive Service, Prev: Email, Up: Using Networking + +2.7 Reading a Web Page +====================== + +Retrieving a web page from a web server is as simple as retrieving +email from an email server. We only have to use a similar, but not +identical, protocol and a different port. The name of the protocol is +HyperText Transfer Protocol (HTTP) and the port number is usually 80. +As in the preceding node, ask your administrator about the name of your +local web server or proxy web server and its port number for HTTP +requests. + + The following program employs a rather crude approach toward +retrieving a web page. It uses the prehistoric syntax of HTTP 0.9, +which almost all web servers still support. The most noticeable thing +about it is that the program directs the request to the local proxy +server whose name you insert in the special file name (which in turn +calls `www.yahoo.com'): + + BEGIN { + RS = ORS = "\r\n" + HttpService = "/inet/tcp/0/PROXY/80" + print "GET http://www.yahoo.com" |& HttpService + while ((HttpService |& getline) > 0) + print $0 + close(HttpService) + } + + Again, lines are separated by a redefined `RS' and `ORS'. The `GET' +request that we send to the server is the only kind of HTTP request +that existed when the web was created in the early 1990s. HTTP calls +this `GET' request a "method," which tells the service to transmit a +web page (here the home page of the Yahoo! search engine). Version 1.0 +added the request methods `HEAD' and `POST'. The current version of +HTTP is 1.1,(1) and knows the additional request methods `OPTIONS', +`PUT', `DELETE', and `TRACE'. You can fill in any valid web address, +and the program prints the HTML code of that page to your screen. + + Notice the similarity between the responses of the POP and HTTP +services. First, you get a header that is terminated by an empty line, +and then you get the body of the page in HTML. The lines of the +headers also have the same form as in POP. There is the name of a +parameter, then a colon, and finally the value of that parameter. + + Images (`.png' or `.gif' files) can also be retrieved this way, but +then you get binary data that should be redirected into a file. Another +application is calling a CGI (Common Gateway Interface) script on some +server. CGI scripts are used when the contents of a web page are not +constant, but generated instantly at the moment you send a request for +the page. For example, to get a detailed report about the current +quotes of Motorola stock shares, call a CGI script at Yahoo! with the +following: + + get = "GET http://quote.yahoo.com/q?s=MOT&d=t" + print get |& HttpService + + You can also request weather reports this way. + + ---------- Footnotes ---------- + + (1) Version 1.0 of HTTP was defined in RFC 1945. HTTP 1.1 was +initially specified in RFC 2068. In June 1999, RFC 2068 was made +obsolete by RFC 2616, an update without any substantial changes. + + +File: gawkinet.info, Node: Primitive Service, Next: Interacting Service, Prev: Web page, Up: Using Networking + +2.8 A Primitive Web Service +=========================== + +Now we know enough about HTTP to set up a primitive web service that +just says `"Hello, world"' when someone connects to it with a browser. +Compared to the situation in the preceding node, our program changes +the role. It tries to behave just like the server we have observed. +Since we are setting up a server here, we have to insert the port +number in the `localport' field of the special file name. The other two +fields (HOSTNAME and REMOTEPORT) have to contain a `0' because we do +not know in advance which host will connect to our service. + + In the early 1990s, all a server had to do was send an HTML document +and close the connection. Here, we adhere to the modern syntax of HTTP. +The steps are as follows: + + 1. Send a status line telling the web browser that everything is okay. + + 2. Send a line to tell the browser how many bytes follow in the body + of the message. This was not necessary earlier because both + parties knew that the document ended when the connection closed. + Nowadays it is possible to stay connected after the transmission + of one web page. This is to avoid the network traffic necessary + for repeatedly establishing TCP connections for requesting several + images. Thus, there is the need to tell the receiving party how + many bytes will be sent. The header is terminated as usual with an + empty line. + + 3. Send the `"Hello, world"' body in HTML. The useless `while' loop + swallows the request of the browser. We could actually omit the + loop, and on most machines the program would still work. First, + start the following program: + + BEGIN { + RS = ORS = "\r\n" + HttpService = "/inet/tcp/8080/0/0" + Hello = "<HTML><HEAD>" \ + "<TITLE>A Famous Greeting</TITLE></HEAD>" \ + "<BODY><H1>Hello, world</H1></BODY></HTML>" + Len = length(Hello) + length(ORS) + print "HTTP/1.0 200 OK" |& HttpService + print "Content-Length: " Len ORS |& HttpService + print Hello |& HttpService + while ((HttpService |& getline) > 0) + continue; + close(HttpService) + } + + Now, on the same machine, start your favorite browser and let it +point to `http://localhost:8080' (the browser needs to know on which +port our server is listening for requests). If this does not work, the +browser probably tries to connect to a proxy server that does not know +your machine. If so, change the browser's configuration so that the +browser does not try to use a proxy to connect to your machine. + + +File: gawkinet.info, Node: Interacting Service, Next: Simple Server, Prev: Primitive Service, Up: Using Networking + +2.9 A Web Service with Interaction +================================== + +This node shows how to set up a simple web server. The subnode is a +library file that we will use with all the examples in *note Some +Applications and Techniques::. + +* Menu: + +* CGI Lib:: A simple CGI library. + + Setting up a web service that allows user interaction is more +difficult and shows us the limits of network access in `gawk'. In this +node, we develop a main program (a `BEGIN' pattern and its action) +that will become the core of event-driven execution controlled by a +graphical user interface (GUI). Each HTTP event that the user triggers +by some action within the browser is received in this central +procedure. Parameters and menu choices are extracted from this request, +and an appropriate measure is taken according to the user's choice. +For example: + + BEGIN { + if (MyHost == "") { + "uname -n" | getline MyHost + close("uname -n") + } + if (MyPort == 0) MyPort = 8080 + HttpService = "/inet/tcp/" MyPort "/0/0" + MyPrefix = "http://" MyHost ":" MyPort + SetUpServer() + while ("awk" != "complex") { + # header lines are terminated this way + RS = ORS = "\r\n" + Status = 200 # this means OK + Reason = "OK" + Header = TopHeader + Document = TopDoc + Footer = TopFooter + if (GETARG["Method"] == "GET") { + HandleGET() + } else if (GETARG["Method"] == "HEAD") { + # not yet implemented + } else if (GETARG["Method"] != "") { + print "bad method", GETARG["Method"] + } + Prompt = Header Document Footer + print "HTTP/1.0", Status, Reason |& HttpService + print "Connection: Close" |& HttpService + print "Pragma: no-cache" |& HttpService + len = length(Prompt) + length(ORS) + print "Content-length:", len |& HttpService + print ORS Prompt |& HttpService + # ignore all the header lines + while ((HttpService |& getline) > 0) + ; + # stop talking to this client + close(HttpService) + # wait for new client request + HttpService |& getline + # do some logging + print systime(), strftime(), $0 + # read request parameters + CGI_setup($1, $2, $3) + } + } + + This web server presents menu choices in the form of HTML links. +Therefore, it has to tell the browser the name of the host it is +residing on. When starting the server, the user may supply the name of +the host from the command line with `gawk -v MyHost="Rumpelstilzchen"'. +If the user does not do this, the server looks up the name of the host +it is running on for later use as a web address in HTML documents. The +same applies to the port number. These values are inserted later into +the HTML content of the web pages to refer to the home system. + + Each server that is built around this core has to initialize some +application-dependent variables (such as the default home page) in a +procedure `SetUpServer', which is called immediately before entering the +infinite loop of the server. For now, we will write an instance that +initiates a trivial interaction. With this home page, the client user +can click on two possible choices, and receive the current date either +in human-readable format or in seconds since 1970: + + function SetUpServer() { + TopHeader = "<HTML><HEAD>" + TopHeader = TopHeader \ + "<title>My name is GAWK, GNU AWK</title></HEAD>" + TopDoc = "<BODY><h2>\ + Do you prefer your date <A HREF=" MyPrefix \ + "/human>human</A> or \ + <A HREF=" MyPrefix "/POSIX>POSIXed</A>?</h2>" ORS ORS + TopFooter = "</BODY></HTML>" + } + + On the first run through the main loop, the default line terminators +are set and the default home page is copied to the actual home page. +Since this is the first run, `GETARG["Method"]' is not initialized yet, +hence the case selection over the method does nothing. Now that the +home page is initialized, the server can start communicating to a +client browser. + + It does so by printing the HTTP header into the network connection +(`print ... |& HttpService'). This command blocks execution of the +server script until a client connects. If this server script is +compared with the primitive one we wrote before, you will notice two +additional lines in the header. The first instructs the browser to +close the connection after each request. The second tells the browser +that it should never try to _remember_ earlier requests that had +identical web addresses (no caching). Otherwise, it could happen that +the browser retrieves the time of day in the previous example just once, +and later it takes the web page from the cache, always displaying the +same time of day although time advances each second. + + Having supplied the initial home page to the browser with a valid +document stored in the parameter `Prompt', it closes the connection and +waits for the next request. When the request comes, a log line is +printed that allows us to see which request the server receives. The +final step in the loop is to call the function `CGI_setup', which reads +all the lines of the request (coming from the browser), processes them, +and stores the transmitted parameters in the array `PARAM'. The complete +text of these application-independent functions can be found in *note A +Simple CGI Library: CGI Lib. For now, we use a simplified version of +`CGI_setup': + + function CGI_setup( method, uri, version, i) { + delete GETARG; delete MENU; delete PARAM + GETARG["Method"] = $1 + GETARG["URI"] = $2 + GETARG["Version"] = $3 + i = index($2, "?") + # is there a "?" indicating a CGI request? + if (i > 0) { + split(substr($2, 1, i-1), MENU, "[/:]") + split(substr($2, i+1), PARAM, "&") + for (i in PARAM) { + j = index(PARAM[i], "=") + GETARG[substr(PARAM[i], 1, j-1)] = \ + substr(PARAM[i], j+1) + } + } else { # there is no "?", no need for splitting PARAMs + split($2, MENU, "[/:]") + } + } + + At first, the function clears all variables used for global storage +of request parameters. The rest of the function serves the purpose of +filling the global parameters with the extracted new values. To +accomplish this, the name of the requested resource is split into parts +and stored for later evaluation. If the request contains a `?', then +the request has CGI variables seamlessly appended to the web address. +Everything in front of the `?' is split up into menu items, and +everything behind the `?' is a list of `VARIABLE=VALUE' pairs +(separated by `&') that also need splitting. This way, CGI variables are +isolated and stored. This procedure lacks recognition of special +characters that are transmitted in coded form(1). Here, any optional +request header and body parts are ignored. We do not need header +parameters and the request body. However, when refining our approach or +working with the `POST' and `PUT' methods, reading the header and body +becomes inevitable. Header parameters should then be stored in a global +array as well as the body. + + On each subsequent run through the main loop, one request from a +browser is received, evaluated, and answered according to the user's +choice. This can be done by letting the value of the HTTP method guide +the main loop into execution of the procedure `HandleGET', which +evaluates the user's choice. In this case, we have only one +hierarchical level of menus, but in the general case, menus are nested. +The menu choices at each level are separated by `/', just as in file +names. Notice how simple it is to construct menus of arbitrary depth: + + function HandleGET() { + if ( MENU[2] == "human") { + Footer = strftime() TopFooter + } else if (MENU[2] == "POSIX") { + Footer = systime() TopFooter + } + } + + The disadvantage of this approach is that our server is slow and can +handle only one request at a time. Its main advantage, however, is that +the server consists of just one `gawk' program. No need for installing +an `httpd', and no need for static separate HTML files, CGI scripts, or +`root' privileges. This is rapid prototyping. This program can be +started on the same host that runs your browser. Then let your browser +point to `http://localhost:8080'. + + It is also possible to include images into the HTML pages. Most +browsers support the not very well-known `.xbm' format, which may +contain only monochrome pictures but is an ASCII format. Binary images +are possible but not so easy to handle. Another way of including images +is to generate them with a tool such as GNUPlot, by calling the tool +with the `system' function or through a pipe. + + ---------- Footnotes ---------- + + (1) As defined in RFC 2068. + + +File: gawkinet.info, Node: CGI Lib, Prev: Interacting Service, Up: Interacting Service + +2.9.1 A Simple CGI Library +-------------------------- + + HTTP is like being married: you have to be able to handle whatever + you're given, while being very careful what you send back. + Phil Smith III, + `http://www.netfunny.com/rhf/jokes/99/Mar/http.html' + + In *note A Web Service with Interaction: Interacting Service, we saw +the function `CGI_setup' as part of the web server "core logic" +framework. The code presented there handles almost everything necessary +for CGI requests. One thing it doesn't do is handle encoded characters +in the requests. For example, an `&' is encoded as a percent sign +followed by the hexadecimal value: `%26'. These encoded values should +be decoded. Following is a simple library to perform these tasks. +This code is used for all web server examples used throughout the rest +of this Info file. If you want to use it for your own web server, +store the source code into a file named `inetlib.awk'. Then you can +include these functions into your code by placing the following +statement into your program (on the first line of your script): + + @include inetlib.awk + +But beware, this mechanism is only possible if you invoke your web +server script with `igawk' instead of the usual `awk' or `gawk'. Here +is the code: + + # CGI Library and core of a web server + # Global arrays + # GETARG --- arguments to CGI GET command + # MENU --- menu items (path names) + # PARAM --- parameters of form x=y + + # Optional variable MyHost contains host address + # Optional variable MyPort contains port number + # Needs TopHeader, TopDoc, TopFooter + # Sets MyPrefix, HttpService, Status, Reason + + BEGIN { + if (MyHost == "") { + "uname -n" | getline MyHost + close("uname -n") + } + if (MyPort == 0) MyPort = 8080 + HttpService = "/inet/tcp/" MyPort "/0/0" + MyPrefix = "http://" MyHost ":" MyPort + SetUpServer() + while ("awk" != "complex") { + # header lines are terminated this way + RS = ORS = "\r\n" + Status = 200 # this means OK + Reason = "OK" + Header = TopHeader + Document = TopDoc + Footer = TopFooter + if (GETARG["Method"] == "GET") { + HandleGET() + } else if (GETARG["Method"] == "HEAD") { + # not yet implemented + } else if (GETARG["Method"] != "") { + print "bad method", GETARG["Method"] + } + Prompt = Header Document Footer + print "HTTP/1.0", Status, Reason |& HttpService + print "Connection: Close" |& HttpService + print "Pragma: no-cache" |& HttpService + len = length(Prompt) + length(ORS) + print "Content-length:", len |& HttpService + print ORS Prompt |& HttpService + # ignore all the header lines + while ((HttpService |& getline) > 0) + continue + # stop talking to this client + close(HttpService) + # wait for new client request + HttpService |& getline + # do some logging + print systime(), strftime(), $0 + CGI_setup($1, $2, $3) + } + } + + function CGI_setup( method, uri, version, i) + { + delete GETARG + delete MENU + delete PARAM + GETARG["Method"] = method + GETARG["URI"] = uri + GETARG["Version"] = version + + i = index(uri, "?") + if (i > 0) { # is there a "?" indicating a CGI request? + split(substr(uri, 1, i-1), MENU, "[/:]") + split(substr(uri, i+1), PARAM, "&") + for (i in PARAM) { + PARAM[i] = _CGI_decode(PARAM[i]) + j = index(PARAM[i], "=") + GETARG[substr(PARAM[i], 1, j-1)] = \ + substr(PARAM[i], j+1) + } + } else { # there is no "?", no need for splitting PARAMs + split(uri, MENU, "[/:]") + } + for (i in MENU) # decode characters in path + if (i > 4) # but not those in host name + MENU[i] = _CGI_decode(MENU[i]) + } + + This isolates details in a single function, `CGI_setup'. Decoding +of encoded characters is pushed off to a helper function, +`_CGI_decode'. The use of the leading underscore (`_') in the function +name is intended to indicate that it is an "internal" function, +although there is nothing to enforce this: + + function _CGI_decode(str, hexdigs, i, pre, code1, code2, + val, result) + { + hexdigs = "123456789abcdef" + + i = index(str, "%") + if (i == 0) # no work to do + return str + + do { + pre = substr(str, 1, i-1) # part before %xx + code1 = substr(str, i+1, 1) # first hex digit + code2 = substr(str, i+2, 1) # second hex digit + str = substr(str, i+3) # rest of string + + code1 = tolower(code1) + code2 = tolower(code2) + val = index(hexdigs, code1) * 16 \ + + index(hexdigs, code2) + + result = result pre sprintf("%c", val) + i = index(str, "%") + } while (i != 0) + if (length(str) > 0) + result = result str + return result + } + + This works by splitting the string apart around an encoded character. +The two digits are converted to lowercase characters and looked up in a +string of hex digits. Note that `0' is not in the string on purpose; +`index' returns zero when it's not found, automatically giving the +correct value! Once the hexadecimal value is converted from characters +in a string into a numerical value, `sprintf' converts the value back +into a real character. The following is a simple test harness for the +above functions: + + BEGIN { + CGI_setup("GET", + "http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \ + "&percent=a %25 sign", + "1.0") + for (i in MENU) + printf "MENU[\"%s\"] = %s\n", i, MENU[i] + for (i in PARAM) + printf "PARAM[\"%s\"] = %s\n", i, PARAM[i] + for (i in GETARG) + printf "GETARG[\"%s\"] = %s\n", i, GETARG[i] + } + + And this is the result when we run it: + + $ gawk -f testserv.awk + -| MENU["4"] = www.gnu.org + -| MENU["5"] = cgi-bin + -| MENU["6"] = foo + -| MENU["1"] = http + -| MENU["2"] = + -| MENU["3"] = + -| PARAM["1"] = p1=stuff + -| PARAM["2"] = p2=stuff&junk + -| PARAM["3"] = percent=a % sign + -| GETARG["p1"] = stuff + -| GETARG["percent"] = a % sign + -| GETARG["p2"] = stuff&junk + -| GETARG["Method"] = GET + -| GETARG["Version"] = 1.0 + -| GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff& + p2=stuff%26junk&percent=a %25 sign + + +File: gawkinet.info, Node: Simple Server, Next: Caveats, Prev: Interacting Service, Up: Using Networking + +2.10 A Simple Web Server +======================== + +In the preceding node, we built the core logic for event-driven GUIs. +In this node, we finally extend the core to a real application. No one +would actually write a commercial web server in `gawk', but it is +instructive to see that it is feasible in principle. + + The application is ELIZA, the famous program by Joseph Weizenbaum +that mimics the behavior of a professional psychotherapist when talking +to you. Weizenbaum would certainly object to this description, but +this is part of the legend around ELIZA. Take the site-independent +core logic and append the following code: + + function SetUpServer() { + SetUpEliza() + TopHeader = \ + "<HTML><title>An HTTP-based System with GAWK</title>\ + <HEAD><META HTTP-EQUIV=\"Content-Type\"\ + CONTENT=\"text/html; charset=iso-8859-1\"></HEAD>\ + <BODY BGCOLOR=\"#ffffff\" TEXT=\"#000000\"\ + LINK=\"#0000ff\" VLINK=\"#0000ff\"\ + ALINK=\"#0000ff\"> <A NAME=\"top\">" + TopDoc = "\ + <h2>Please choose one of the following actions:</h2>\ + <UL>\ + <LI>\ + <A HREF=" MyPrefix "/AboutServer>About this server</A>\ + </LI><LI>\ + <A HREF=" MyPrefix "/AboutELIZA>About Eliza</A></LI>\ + <LI>\ + <A HREF=" MyPrefix \ + "/StartELIZA>Start talking to Eliza</A></LI></UL>" + TopFooter = "</BODY></HTML>" + } + + `SetUpServer' is similar to the previous example, except for calling +another function, `SetUpEliza'. This approach can be used to implement +other kinds of servers. The only changes needed to do so are hidden in +the functions `SetUpServer' and `HandleGET'. Perhaps it might be +necessary to implement other HTTP methods. The `igawk' program that +comes with `gawk' may be useful for this process. + + When extending this example to a complete application, the first +thing to do is to implement the function `SetUpServer' to initialize +the HTML pages and some variables. These initializations determine the +way your HTML pages look (colors, titles, menu items, etc.). + + The function `HandleGET' is a nested case selection that decides +which page the user wants to see next. Each nesting level refers to a +menu level of the GUI. Each case implements a certain action of the +menu. On the deepest level of case selection, the handler essentially +knows what the user wants and stores the answer into the variable that +holds the HTML page contents: + + function HandleGET() { + # A real HTTP server would treat some parts of the URI as a file name. + # We take parts of the URI as menu choices and go on accordingly. + if(MENU[2] == "AboutServer") { + Document = "This is not a CGI script.\ + This is an httpd, an HTML file, and a CGI script all \ + in one GAWK script. It needs no separate www-server, \ + no installation, and no root privileges.\ + <p>To run it, do this:</p><ul>\ + <li> start this script with \"gawk -f httpserver.awk\",</li>\ + <li> and on the same host let your www browser open location\ + \"http://localhost:8080\"</li>\ + </ul>\<p>\ Details of HTTP come from:</p><ul>\ + <li>Hethmon: Illustrated Guide to HTTP</p>\ + <li>RFC 2068</li></ul><p>JK 14.9.1997</p>" + } else if (MENU[2] == "AboutELIZA") { + Document = "This is an implementation of the famous ELIZA\ + program by Joseph Weizenbaum. It is written in GAWK and\ + /bin/sh: expad: command not found + } else if (MENU[2] == "StartELIZA") { + gsub(/\+/, " ", GETARG["YouSay"]) + # Here we also have to substitute coded special characters + Document = "<form method=GET>" \ + "<h3>" ElizaSays(GETARG["YouSay"]) "</h3>\ + <p><input type=text name=YouSay value=\"\" size=60>\ + <br><input type=submit value=\"Tell her about it\"></p></form>" + } + } + + Now we are down to the heart of ELIZA, so you can see how it works. +Initially the user does not say anything; then ELIZA resets its money +counter and asks the user to tell what comes to mind open heartedly. +The subsequent answers are converted to uppercase characters and stored +for later comparison. ELIZA presents the bill when being confronted with +a sentence that contains the phrase "shut up." Otherwise, it looks for +keywords in the sentence, conjugates the rest of the sentence, remembers +the keyword for later use, and finally selects an answer from the set of +possible answers: + + function ElizaSays(YouSay) { + if (YouSay == "") { + cost = 0 + answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM" + } else { + q = toupper(YouSay) + gsub("'", "", q) + if(q == qold) { + answer = "PLEASE DONT REPEAT YOURSELF !" + } else { + if (index(q, "SHUT UP") > 0) { + answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\ + int(100*rand()+30+cost/100) + } else { + qold = q + w = "-" # no keyword recognized yet + for (i in k) { # search for keywords + if (index(q, i) > 0) { + w = i + break + } + } + if (w == "-") { # no keyword, take old subject + w = wold + subj = subjold + } else { # find subject + subj = substr(q, index(q, w) + length(w)+1) + wold = w + subjold = subj # remember keyword and subject + } + for (i in conj) + gsub(i, conj[i], q) # conjugation + # from all answers to this keyword, select one randomly + answer = r[indices[int(split(k[w], indices) * rand()) + 1]] + # insert subject into answer + gsub("_", subj, answer) + } + } + } + cost += length(answer) # for later payment : 1 cent per character + return answer + } + + In the long but simple function `SetUpEliza', you can see tables for +conjugation, keywords, and answers.(1) The associative array `k' +contains indices into the array of answers `r'. To choose an answer, +ELIZA just picks an index randomly: + + function SetUpEliza() { + srand() + wold = "-" + subjold = " " + + # table for conjugation + conj[" ARE " ] = " AM " + conj["WERE " ] = "WAS " + conj[" YOU " ] = " I " + conj["YOUR " ] = "MY " + conj[" IVE " ] =\ + conj[" I HAVE " ] = " YOU HAVE " + conj[" YOUVE " ] =\ + conj[" YOU HAVE "] = " I HAVE " + conj[" IM " ] =\ + conj[" I AM " ] = " YOU ARE " + conj[" YOURE " ] =\ + conj[" YOU ARE " ] = " I AM " + + # table of all answers + r[1] = "DONT YOU BELIEVE THAT I CAN _" + r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?" + ... + + # table for looking up answers that + # fit to a certain keyword + k["CAN YOU"] = "1 2 3" + k["CAN I"] = "4 5" + k["YOU ARE"] =\ + k["YOURE"] = "6 7 8 9" + ... + + } + + Some interesting remarks and details (including the original source +code of ELIZA) are found on Mark Humphrys' home page. Yahoo! also has +a page with a collection of ELIZA-like programs. Many of them are +written in Java, some of them disclosing the Java source code, and a +few even explain how to modify the Java source code. + + ---------- Footnotes ---------- + + (1) The version shown here is abbreviated. The full version comes +with the `gawk' distribution. + + +File: gawkinet.info, Node: Caveats, Next: Challenges, Prev: Simple Server, Up: Using Networking + +2.11 Network Programming Caveats +================================ + +By now it should be clear that debugging a networked application is more +complicated than debugging a single-process single-hosted application. +The behavior of a networked application sometimes looks noncausal +because it is not reproducible in a strong sense. Whether a network +application works or not sometimes depends on the following: + + * How crowded the underlying network is + + * If the party at the other end is running or not + + * The state of the party at the other end + + The most difficult problems for a beginner arise from the hidden +states of the underlying network. After closing a TCP connection, it's +often necessary to wait a short while before reopening the connection. +Even more difficult is the establishment of a connection that +previously ended with a "broken pipe." Those connections have to "time +out" for a minute or so before they can reopen. Check this with the +command `netstat -a', which provides a list of still "active" +connections. + + +File: gawkinet.info, Node: Challenges, Prev: Caveats, Up: Using Networking + +2.12 Where To Go From Here +========================== + +Now, you have learned enough to build your own application. You could, +for example, take part in the Loebner Contest to win $100,000. The +Loebner Prize is the first formal instantiation of a Turing Test. Hugh +Loebner agreed with The Cambridge Center for Behavioral Studies to +underwrite a contest designed to implement the Turing Test. Dr. +Loebner pledged a Grand Prize of $100,000 for the first computer whose +responses were indistinguishable from a human's. Each year an annual +prize of $2000 and a bronze medal is awarded to the _most_ human +computer. The winner of the annual contest is the best entry relative +to other entries that year, irrespective of how good it is in an +absolute sense. Here is an example of a conversation with the winning +program of 1997: + + (c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE] + [Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40] + PROGRAM[10:39:20]Hi, my name is Catherine, what's yours? + JUDGE02[10:39:36]My name is Nathan. + PROGRAM[10:39:37]Well, it's nice to meet you, Nathan. + PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian + PROGRAM[10:40:03]couple who came out at a White House party on Sunday? + JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it? + PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover + PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very + PROGRAM[10:41:21]embarrassed? + JUDGE02[10:41:37]You tell me. I didn't see it. + PROGRAM[10:41:38]Are you still a Friend of Bill Clinton? + JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture. + PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he + PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity, + PROGRAM[10:42:51]wouldnt you say--can it all be bad luck? + JUDGE02[10:43:20]I asked you if you knew anything about sculpture. + PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with + PROGRAM[10:43:36]everyone waiting to see how much his friends have said about + PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something + PROGRAM[10:44:01]dramatic actually happen? + JUDGE02[10:44:19]Do you know what sculpture is? + PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I + PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I + PROGRAM[10:44:51]must say. + JUDGE02[10:45:26]Have you ever been to the Salmagundi Club? + PROGRAM[10:45:29]Never. to go back to the original discussion Time to get + PROGRAM[10:45:43]off this one I think and onto something more down to earth! + JUDGE02[10:46:20]What is more down to earth than art? + PROGRAM[10:46:21]I don't know what -- to be honest. - + PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the + PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a + PROGRAM[10:47:03]man? " + JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are" + JUDGE02[10:48:10]from another play the name of which I cannot remember. + PROGRAM[10:48:12]What, if anything, do you enjoy about being a man? + JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender. + PROGRAM[10:49:02]Do you think of yourself as being attractive? + + This program insists on always speaking about the same story around +Bill Clinton. You see, even a program with a rather narrow mind can +behave so much like a human being that it can win this prize. It is +quite common to let these programs talk to each other via network +connections. But during the competition itself, the program and its +computer have to be present at the place the competition is held. We +all would love to see a `gawk' program win in such an event. Maybe it +is up to you to accomplish this? + + Some other ideas for useful networked applications: + * Read the file `doc/awkforai.txt' in the `gawk' distribution. It + was written by Ronald P. Loui (Associate Professor of Computer + Science, at Washington University in St. Louis, + <loui@ai.wustl.edu>) and summarizes why he teaches `gawk' to + students of Artificial Intelligence. Here are some passages from + the text: + + The GAWK manual can be consumed in a single lab session and + the language can be mastered by the next morning by the + average student. GAWK's automatic initialization, implicit + coercion, I/O support and lack of pointers forgive many of + the mistakes that young programmers are likely to make. + Those who have seen C but not mastered it are happy to see + that GAWK retains some of the same sensibilities while adding + what must be regarded as spoonsful of syntactic sugar. + ... + There are further simple answers. Probably the best is the + fact that increasingly, undergraduate AI programming is + involving the Web. Oren Etzioni (University of Washington, + Seattle) has for a while been arguing that the "softbot" is + replacing the mechanical engineers' robot as the most + glamorous AI testbed. If the artifact whose behavior needs + to be controlled in an intelligent way is the software agent, + then a language that is well-suited to controlling the + software environment is the appropriate language. That would + imply a scripting language. If the robot is KAREL, then the + right language is "turn left; turn right." If the robot is + Netscape, then the right language is something that can + generate `netscape -remote + 'openURL(http://cs.wustl.edu/~loui)'' with elan. + ... + AI programming requires high-level thinking. There have + always been a few gifted programmers who can write high-level + programs in assembly language. Most however need the ambient + abstraction to have a higher floor. + ... + Second, inference is merely the expansion of notation. No + matter whether the logic that underlies an AI program is + fuzzy, probabilistic, deontic, defeasible, or deductive, the + logic merely defines how strings can be transformed into + other strings. A language that provides the best support for + string processing in the end provides the best support for + logic, for the exploration of various logics, and for most + forms of symbolic processing that AI might choose to call + "reasoning" instead of "logic." The implication is that + PROLOG, which saves the AI programmer from having to write a + unifier, saves perhaps two dozen lines of GAWK code at the + expense of strongly biasing the logic and representational + expressiveness of any approach. + + Now that `gawk' itself can connect to the Internet, it should be + obvious that it is suitable for writing intelligent web agents. + + * `awk' is strong at pattern recognition and string processing. So, + it is well suited to the classic problem of language translation. + A first try could be a program that knows the 100 most frequent + English words and their counterparts in German or French. The + service could be implemented by regularly reading email with the + program above, replacing each word by its translation and sending + the translation back via SMTP. Users would send English email to + their translation service and get back a translated email message + in return. As soon as this works, more effort can be spent on a + real translation program. + + * Another dialogue-oriented application (on the verge of ridicule) + is the email "support service." Troubled customers write an email + to an automatic `gawk' service that reads the email. It looks for + keywords in the mail and assembles a reply email accordingly. By + carefully investigating the email header, and repeating these + keywords through the reply email, it is rather simple to give the + customer a feeling that someone cares. Ideally, such a service + would search a database of previous cases for solutions. If none + exists, the database could, for example, consist of all the + newsgroups, mailing lists and FAQs on the Internet. + + +File: gawkinet.info, Node: Some Applications and Techniques, Next: Links, Prev: Using Networking, Up: Top + +3 Some Applications and Techniques +********************************** + +In this major node, we look at a number of self-contained scripts, with +an emphasis on concise networking. Along the way, we work towards +creating building blocks that encapsulate often needed functions of the +networking world, show new techniques that broaden the scope of +problems that can be solved with `gawk', and explore leading edge +technology that may shape the future of networking. + + We often refer to the site-independent core of the server that we +built in *note A Simple Web Server: Simple Server. When building new +and nontrivial servers, we always copy this building block and append +new instances of the two functions `SetUpServer' and `HandleGET'. + + This makes a lot of sense, since this scheme of event-driven +execution provides `gawk' with an interface to the most widely accepted +standard for GUIs: the web browser. Now, `gawk' can rival even Tcl/Tk. + + Tcl and `gawk' have much in common. Both are simple scripting +languages that allow us to quickly solve problems with short programs. +But Tcl has Tk on top of it, and `gawk' had nothing comparable up to +now. While Tcl needs a large and ever-changing library (Tk, which was +bound to the X Window System until recently), `gawk' needs just the +networking interface and some kind of browser on the client's side. +Besides better portability, the most important advantage of this +approach (embracing well-established standards such HTTP and HTML) is +that _we do not need to change the language_. We let others do the work +of fighting over protocols and standards. We can use HTML, JavaScript, +VRML, or whatever else comes along to do our work. + +* Menu: + +* PANIC:: An Emergency Web Server. +* GETURL:: Retrieving Web Pages. +* REMCONF:: Remote Configuration Of Embedded Systems. +* URLCHK:: Look For Changed Web Pages. +* WEBGRAB:: Extract Links From A Page. +* STATIST:: Graphing A Statistical Distribution. +* MAZE:: Walking Through A Maze In Virtual Reality. +* MOBAGWHO:: A Simple Mobile Agent. +* STOXPRED:: Stock Market Prediction As A Service. +* PROTBASE:: Searching Through A Protein Database. + + +File: gawkinet.info, Node: PANIC, Next: GETURL, Prev: Some Applications and Techniques, Up: Some Applications and Techniques + +3.1 PANIC: An Emergency Web Server +================================== + +At first glance, the `"Hello, world"' example in *note A Primitive Web +Service: Primitive Service, seems useless. By adding just a few lines, +we can turn it into something useful. + + The PANIC program tells everyone who connects that the local site is +not working. When a web server breaks down, it makes a difference if +customers get a strange "network unreachable" message, or a short +message telling them that the server has a problem. In such an +emergency, the hard disk and everything on it (including the regular +web service) may be unavailable. Rebooting the web server off a +diskette makes sense in this setting. + + To use the PANIC program as an emergency web server, all you need +are the `gawk' executable and the program below on a diskette. By +default, it connects to port 8080. A different value may be supplied on +the command line: + + BEGIN { + RS = ORS = "\r\n" + if (MyPort == 0) MyPort = 8080 + HttpService = "/inet/tcp/" MyPort "/0/0" + Hello = "<HTML><HEAD><TITLE>Out Of Service</TITLE>" \ + "</HEAD><BODY><H1>" \ + "This site is temporarily out of service." \ + "</H1></BODY></HTML>" + Len = length(Hello) + length(ORS) + while ("awk" != "complex") { + print "HTTP/1.0 200 OK" |& HttpService + print "Content-Length: " Len ORS |& HttpService + print Hello |& HttpService + while ((HttpService |& getline) > 0) + continue; + close(HttpService) + } + } + + +File: gawkinet.info, Node: GETURL, Next: REMCONF, Prev: PANIC, Up: Some Applications and Techniques + +3.2 GETURL: Retrieving Web Pages +================================ + +GETURL is a versatile building block for shell scripts that need to +retrieve files from the Internet. It takes a web address as a +command-line parameter and tries to retrieve the contents of this +address. The contents are printed to standard output, while the header +is printed to `/dev/stderr'. A surrounding shell script could analyze +the contents and extract the text or the links. An ASCII browser could +be written around GETURL. But more interestingly, web robots are +straightforward to write on top of GETURL. On the Internet, you can find +several programs of the same name that do the same job. They are usually +much more complex internally and at least 10 times longer. + + At first, GETURL checks if it was called with exactly one web +address. Then, it checks if the user chose to use a special proxy +server whose name is handed over in a variable. By default, it is +assumed that the local machine serves as proxy. GETURL uses the `GET' +method by default to access the web page. By handing over the name of a +different method (such as `HEAD'), it is possible to choose a different +behavior. With the `HEAD' method, the user does not receive the body of +the page content, but does receive the header: + + BEGIN { + if (ARGC != 2) { + print "GETURL - retrieve Web page via HTTP 1.0" + print "IN:\n the URL as a command-line parameter" + print "PARAM(S):\n -v Proxy=MyProxy" + print "OUT:\n the page content on stdout" + print " the page header on stderr" + print "JK 16.05.1997" + print "ADR 13.08.2000" + exit + } + URL = ARGV[1]; ARGV[1] = "" + if (Proxy == "") Proxy = "127.0.0.1" + if (ProxyPort == 0) ProxyPort = 80 + if (Method == "") Method = "GET" + HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort + ORS = RS = "\r\n\r\n" + print Method " " URL " HTTP/1.0" |& HttpService + HttpService |& getline Header + print Header > "/dev/stderr" + while ((HttpService |& getline) > 0) + printf "%s", $0 + close(HttpService) + } + + This program can be changed as needed, but be careful with the last +lines. Make sure transmission of binary data is not corrupted by +additional line breaks. Even as it is now, the byte sequence +`"\r\n\r\n"' would disappear if it were contained in binary data. Don't +get caught in a trap when trying a quick fix on this one. + + +File: gawkinet.info, Node: REMCONF, Next: URLCHK, Prev: GETURL, Up: Some Applications and Techniques + +3.3 REMCONF: Remote Configuration of Embedded Systems +===================================================== + +Today, you often find powerful processors in embedded systems. +Dedicated network routers and controllers for all kinds of machinery +are examples of embedded systems. Processors like the Intel 80x86 or +the AMD Elan are able to run multitasking operating systems, such as +XINU or GNU/Linux in embedded PCs. These systems are small and usually +do not have a keyboard or a display. Therefore it is difficult to set +up their configuration. There are several widespread ways to set them +up: + + * DIP switches + + * Read Only Memories such as EPROMs + + * Serial lines or some kind of keyboard + + * Network connections via `telnet' or SNMP + + * HTTP connections with HTML GUIs + + In this node, we look at a solution that uses HTTP connections to +control variables of an embedded system that are stored in a file. +Since embedded systems have tight limits on resources like memory, it +is difficult to employ advanced techniques such as SNMP and HTTP +servers. `gawk' fits in quite nicely with its single executable which +needs just a short script to start working. The following program +stores the variables in a file, and a concurrent process in the +embedded system may read the file. The program uses the +site-independent part of the simple web server that we developed in +*note A Web Service with Interaction: Interacting Service. As +mentioned there, all we have to do is to write two new procedures +`SetUpServer' and `HandleGET': + + function SetUpServer() { + TopHeader = "<HTML><title>Remote Configuration</title>" + TopDoc = "<BODY>\ + <h2>Please choose one of the following actions:</h2>\ + <UL>\ + <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\ + <LI><A HREF=" MyPrefix "/ReadConfig>Read Configuration</A></LI>\ + <LI><A HREF=" MyPrefix "/CheckConfig>Check Configuration</A></LI>\ + <LI><A HREF=" MyPrefix "/ChangeConfig>Change Configuration</A></LI>\ + <LI><A HREF=" MyPrefix "/SaveConfig>Save Configuration</A></LI>\ + </UL>" + TopFooter = "</BODY></HTML>" + if (ConfigFile == "") ConfigFile = "config.asc" + } + + The function `SetUpServer' initializes the top level HTML texts as +usual. It also initializes the name of the file that contains the +configuration parameters and their values. In case the user supplies a +name from the command line, that name is used. The file is expected to +contain one parameter per line, with the name of the parameter in +column one and the value in column two. + + The function `HandleGET' reflects the structure of the menu tree as +usual. The first menu choice tells the user what this is all about. The +second choice reads the configuration file line by line and stores the +parameters and their values. Notice that the record separator for this +file is `"\n"', in contrast to the record separator for HTTP. The third +menu choice builds an HTML table to show the contents of the +configuration file just read. The fourth choice does the real work of +changing parameters, and the last one just saves the configuration into +a file: + + function HandleGET() { + if(MENU[2] == "AboutServer") { + Document = "This is a GUI for remote configuration of an\ + embedded system. It is is implemented as one GAWK script." + } else if (MENU[2] == "ReadConfig") { + RS = "\n" + while ((getline < ConfigFile) > 0) + config[$1] = $2; + close(ConfigFile) + RS = "\r\n" + Document = "Configuration has been read." + } else if (MENU[2] == "CheckConfig") { + Document = "<TABLE BORDER=1 CELLPADDING=5>" + for (i in config) + Document = Document "<TR><TD>" i "</TD>" \ + "<TD>" config[i] "</TD></TR>" + Document = Document "</TABLE>" + } else if (MENU[2] == "ChangeConfig") { + if ("Param" in GETARG) { # any parameter to set? + if (GETARG["Param"] in config) { # is parameter valid? + config[GETARG["Param"]] = GETARG["Value"] + Document = (GETARG["Param"] " = " GETARG["Value"] ".") + } else { + Document = "Parameter <b>" GETARG["Param"] "</b> is invalid." + } + } else { + Document = "<FORM method=GET><h4>Change one parameter</h4>\ + <TABLE BORDER CELLPADDING=5>\ + <TR><TD>Parameter</TD><TD>Value</TD></TR>\ + <TR><TD><input type=text name=Param value=\"\" size=20></TD>\ + <TD><input type=text name=Value value=\"\" size=40></TD>\ + </TR></TABLE><input type=submit value=\"Set\"></FORM>" + } + } else if (MENU[2] == "SaveConfig") { + for (i in config) + printf("%s %s\n", i, config[i]) > ConfigFile + close(ConfigFile) + Document = "Configuration has been saved." + } + } + + We could also view the configuration file as a database. From this +point of view, the previous program acts like a primitive database +server. Real SQL database systems also make a service available by +providing a TCP port that clients can connect to. But the application +level protocols they use are usually proprietary and also change from +time to time. This is also true for the protocol that MiniSQL uses. + + +File: gawkinet.info, Node: URLCHK, Next: WEBGRAB, Prev: REMCONF, Up: Some Applications and Techniques + +3.4 URLCHK: Look for Changed Web Pages +====================================== + +Most people who make heavy use of Internet resources have a large +bookmark file with pointers to interesting web sites. It is impossible +to regularly check by hand if any of these sites have changed. A program +is needed to automatically look at the headers of web pages and tell +which ones have changed. URLCHK does the comparison after using GETURL +with the `HEAD' method to retrieve the header. + + Like GETURL, this program first checks that it is called with exactly +one command-line parameter. URLCHK also takes the same command-line +variables `Proxy' and `ProxyPort' as GETURL, because these variables +are handed over to GETURL for each URL that gets checked. The one and +only parameter is the name of a file that contains one line for each +URL. In the first column, we find the URL, and the second and third +columns hold the length of the URL's body when checked for the two last +times. Now, we follow this plan: + + 1. Read the URLs from the file and remember their most recent lengths + + 2. Delete the contents of the file + + 3. For each URL, check its new length and write it into the file + + 4. If the most recent and the new length differ, tell the user + + It may seem a bit peculiar to read the URLs from a file together +with their two most recent lengths, but this approach has several +advantages. You can call the program again and again with the same +file. After running the program, you can regenerate the changed URLs by +extracting those lines that differ in their second and third columns: + + BEGIN { + if (ARGC != 2) { + print "URLCHK - check if URLs have changed" + print "IN:\n the file with URLs as a command-line parameter" + print " file contains URL, old length, new length" + print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080" + print "OUT:\n same as file with URLs" + print "JK 02.03.1998" + exit + } + URLfile = ARGV[1]; ARGV[1] = "" + if (Proxy != "") Proxy = " -v Proxy=" Proxy + if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort + while ((getline < URLfile) > 0) + Length[$1] = $3 + 0 + close(URLfile) # now, URLfile is read in and can be updated + GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk " + for (i in Length) { + GetThisHeader = GetHeader i " 2>&1" + while ((GetThisHeader | getline) > 0) + if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0 + close(GetThisHeader) + print i, Length[i], NewLength > URLfile + if (Length[i] != NewLength) # report only changed URLs + print i, Length[i], NewLength + } + close(URLfile) + } + + Another thing that may look strange is the way GETURL is called. +Before calling GETURL, we have to check if the proxy variables need to +be passed on. If so, we prepare strings that will become part of the +command line later. In `GetHeader', we store these strings together +with the longest part of the command line. Later, in the loop over the +URLs, `GetHeader' is appended with the URL and a redirection operator +to form the command that reads the URL's header over the Internet. +GETURL always produces the headers over `/dev/stderr'. That is the +reason why we need the redirection operator to have the header piped in. + + This program is not perfect because it assumes that changing URLs +results in changed lengths, which is not necessarily true. A more +advanced approach is to look at some other header line that holds time +information. But, as always when things get a bit more complicated, +this is left as an exercise to the reader. + + +File: gawkinet.info, Node: WEBGRAB, Next: STATIST, Prev: URLCHK, Up: Some Applications and Techniques + +3.5 WEBGRAB: Extract Links from a Page +====================================== + +Sometimes it is necessary to extract links from web pages. Browsers do +it, web robots do it, and sometimes even humans do it. Since we have a +tool like GETURL at hand, we can solve this problem with some help from +the Bourne shell: + + BEGIN { RS = "http://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" } + RT != "" { + command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \ + " > doc" NR ".html") + print command + } + + Notice that the regular expression for URLs is rather crude. A +precise regular expression is much more complex. But this one works +rather well. One problem is that it is unable to find internal links of +an HTML document. Another problem is that `ftp', `telnet', `news', +`mailto', and other kinds of links are missing in the regular +expression. However, it is straightforward to add them, if doing so is +necessary for other tasks. + + This program reads an HTML file and prints all the HTTP links that +it finds. It relies on `gawk''s ability to use regular expressions as +record separators. With `RS' set to a regular expression that matches +links, the second action is executed each time a non-empty link is +found. We can find the matching link itself in `RT'. + + The action could use the `system' function to let another GETURL +retrieve the page, but here we use a different approach. This simple +program prints shell commands that can be piped into `sh' for +execution. This way it is possible to first extract the links, wrap +shell commands around them, and pipe all the shell commands into a +file. After editing the file, execution of the file retrieves exactly +those files that we really need. In case we do not want to edit, we can +retrieve all the pages like this: + + gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh + + After this, you will find the contents of all referenced documents in +files named `doc*.html' even if they do not contain HTML code. The +most annoying thing is that we always have to pass the proxy to GETURL. +If you do not like to see the headers of the web pages appear on the +screen, you can redirect them to `/dev/null'. Watching the headers +appear can be quite interesting, because it reveals interesting details +such as which web server the companies use. Now, it is clear how the +clever marketing people use web robots to determine the market shares +of Microsoft and Netscape in the web server market. + + Port 80 of any web server is like a small hole in a repellent +firewall. After attaching a browser to port 80, we usually catch a +glimpse of the bright side of the server (its home page). With a tool +like GETURL at hand, we are able to discover some of the more concealed +or even "indecent" services (i.e., lacking conformity to standards of +quality). It can be exciting to see the fancy CGI scripts that lie +there, revealing the inner workings of the server, ready to be called: + + * With a command such as: + + gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/ + + some servers give you a directory listing of the CGI files. + Knowing the names, you can try to call some of them and watch for + useful results. Sometimes there are executables in such directories + (such as Perl interpreters) that you may call remotely. If there + are subdirectories with configuration data of the web server, this + can also be quite interesting to read. + + * The well-known Apache web server usually has its CGI files in the + directory `/cgi-bin'. There you can often find the scripts + `test-cgi' and `printenv'. Both tell you some things about the + current connection and the installation of the web server. Just + call: + + gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi + gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv + + * Sometimes it is even possible to retrieve system files like the web + server's log file--possibly containing customer data--or even the + file `/etc/passwd'. (We don't recommend this!) + + *Caution:* Although this may sound funny or simply irrelevant, we +are talking about severe security holes. Try to explore your own system +this way and make sure that none of the above reveals too much +information about your system. + + +File: gawkinet.info, Node: STATIST, Next: MAZE, Prev: WEBGRAB, Up: Some Applications and Techniques + +3.6 STATIST: Graphing a Statistical Distribution +================================================ + +In the HTTP server examples we've shown thus far, we never present an +image to the browser and its user. Presenting images is one task. +Generating images that reflect some user input and presenting these +dynamically generated images is another. In this node, we use GNUPlot +for generating `.png', `.ps', or `.gif' files.(1) + + The program we develop takes the statistical parameters of two +samples and computes the t-test statistics. As a result, we get the +probabilities that the means and the variances of both samples are the +same. In order to let the user check plausibility, the program presents +an image of the distributions. The statistical computation follows +`Numerical Recipes in C: The Art of Scientific Computing' by William H. +Press, Saul A. Teukolsky, William T. Vetterling, and Brian P. Flannery. +Since `gawk' does not have a built-in function for the computation of +the beta function, we use the `ibeta' function of GNUPlot. As a side +effect, we learn how to use GNUPlot as a sophisticated calculator. The +comparison of means is done as in `tutest', paragraph 14.2, page 613, +and the comparison of variances is done as in `ftest', page 611 in +`Numerical Recipes'. + + As usual, we take the site-independent code for servers and append +our own functions `SetUpServer' and `HandleGET': + + function SetUpServer() { + TopHeader = "<HTML><title>Statistics with GAWK</title>" + TopDoc = "<BODY>\ + <h2>Please choose one of the following actions:</h2>\ + <UL>\ + <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\ + <LI><A HREF=" MyPrefix "/EnterParameters>Enter Parameters</A></LI>\ + </UL>" + TopFooter = "</BODY></HTML>" + GnuPlot = "gnuplot 2>&1" + m1=m2=0; v1=v2=1; n1=n2=10 + } + + Here, you see the menu structure that the user sees. Later, we will +see how the program structure of the `HandleGET' function reflects the +menu structure. What is missing here is the link for the image we +generate. In an event-driven environment, request, generation, and +delivery of images are separated. + + Notice the way we initialize the `GnuPlot' command string for the +pipe. By default, GNUPlot outputs the generated image via standard +output, as well as the results of `print'(ed) calculations via standard +error. The redirection causes standard error to be mixed into standard +output, enabling us to read results of calculations with `getline'. By +initializing the statistical parameters with some meaningful defaults, +we make sure the user gets an image the first time he uses the program. + + Following is the rather long function `HandleGET', which implements +the contents of this service by reacting to the different kinds of +requests from the browser. Before you start playing with this script, +make sure that your browser supports JavaScript and that it also has +this option switched on. The script uses a short snippet of JavaScript +code for delayed opening of a window with an image. A more detailed +explanation follows: + + function HandleGET() { + if(MENU[2] == "AboutServer") { + Document = "This is a GUI for a statistical computation.\ + It compares means and variances of two distributions.\ + It is implemented as one GAWK script and uses GNUPLOT." + } else if (MENU[2] == "EnterParameters") { + Document = "" + if ("m1" in GETARG) { # are there parameters to compare? + Document = Document "<SCRIPT LANGUAGE=\"JavaScript\">\ + setTimeout(\"window.open(\\\"" MyPrefix "/Image" systime()\ + "\\\",\\\"dist\\\", \\\"status=no\\\");\", 1000); </SCRIPT>" + m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"] + m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"] + t = (m1-m2)/sqrt(v1/n1+v2/n2) + df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \ + + (v2/n2)*(v2/n2) /(n2-1)) + if (v1>v2) { + f = v1/v2 + df1 = n1 - 1 + df2 = n2 - 1 + } else { + f = v2/v1 + df1 = n2 - 1 + df2 = n1 - 1 + } + print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot + print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \ + df2/(df2+df1*f) ")" |& GnuPlot + print "print pt, pF" |& GnuPlot + RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF + print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot + print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot + print "set term png small color" |& GnuPlot + #print "set term postscript color" |& GnuPlot + #print "set term gif medium size 320,240" |& GnuPlot + print "set yrange[-0.3:]" |& GnuPlot + print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot + print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot + print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\ + mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot + print "quit" |& GnuPlot + GnuPlot |& getline Image + while ((GnuPlot |& getline) > 0) + Image = Image RS $0 + close(GnuPlot) + } + Document = Document "\ + <h3>Do these samples have the same Gaussian distribution?</h3>\ + <FORM METHOD=GET> <TABLE BORDER CELLPADDING=5>\ + <TR>\ + <TD>1. Mean </TD> + <TD><input type=text name=m1 value=" m1 " size=8></TD>\ + <TD>1. Variance</TD> + <TD><input type=text name=v1 value=" v1 " size=8></TD>\ + <TD>1. Count </TD> + <TD><input type=text name=n1 value=" n1 " size=8></TD>\ + </TR><TR>\ + <TD>2. Mean </TD> + <TD><input type=text name=m2 value=" m2 " size=8></TD>\ + <TD>2. Variance</TD> + <TD><input type=text name=v2 value=" v2 " size=8></TD>\ + <TD>2. Count </TD> + <TD><input type=text name=n2 value=" n2 " size=8></TD>\ + </TR> <input type=submit value=\"Compute\">\ + </TABLE></FORM><BR>" + } else if (MENU[2] ~ "Image") { + Reason = "OK" ORS "Content-type: image/png" + #Reason = "OK" ORS "Content-type: application/x-postscript" + #Reason = "OK" ORS "Content-type: image/gif" + Header = Footer = "" + Document = Image + } + } + + As usual, we give a short description of the service in the first +menu choice. The third menu choice shows us that generation and +presentation of an image are two separate actions. While the latter +takes place quite instantly in the third menu choice, the former takes +place in the much longer second choice. Image data passes from the +generating action to the presenting action via the variable `Image' +that contains a complete `.png' image, which is otherwise stored in a +file. If you prefer `.ps' or `.gif' images over the default `.png' +images, you may select these options by uncommenting the appropriate +lines. But remember to do so in two places: when telling GNUPlot which +kind of images to generate, and when transmitting the image at the end +of the program. + + Looking at the end of the program, the way we pass the +`Content-type' to the browser is a bit unusual. It is appended to the +`OK' of the first header line to make sure the type information becomes +part of the header. The other variables that get transmitted across +the network are made empty, because in this case we do not have an HTML +document to transmit, but rather raw image data to contain in the body. + + Most of the work is done in the second menu choice. It starts with a +strange JavaScript code snippet. When first implementing this server, +we used a short `"<IMG SRC=" MyPrefix "/Image>"' here. But then +browsers got smarter and tried to improve on speed by requesting the +image and the HTML code at the same time. When doing this, the browser +tries to build up a connection for the image request while the request +for the HTML text is not yet completed. The browser tries to connect to +the `gawk' server on port 8080 while port 8080 is still in use for +transmission of the HTML text. The connection for the image cannot be +built up, so the image appears as "broken" in the browser window. We +solved this problem by telling the browser to open a separate window +for the image, but only after a delay of 1000 milliseconds. By this +time, the server should be ready for serving the next request. + + But there is one more subtlety in the JavaScript code. Each time +the JavaScript code opens a window for the image, the name of the image +is appended with a timestamp (`systime'). Why this constant change of +name for the image? Initially, we always named the image `Image', but +then the Netscape browser noticed the name had _not_ changed since the +previous request and displayed the previous image (caching behavior). +The server core is implemented so that browsers are told _not_ to cache +anything. Obviously HTTP requests do not always work as expected. One +way to circumvent the cache of such overly smart browsers is to change +the name of the image with each request. These three lines of JavaScript +caused us a lot of trouble. + + The rest can be broken down into two phases. At first, we check if +there are statistical parameters. When the program is first started, +there usually are no parameters because it enters the page coming from +the top menu. Then, we only have to present the user a form that he +can use to change statistical parameters and submit them. Subsequently, +the submission of the form causes the execution of the first phase +because _now_ there _are_ parameters to handle. + + Now that we have parameters, we know there will be an image +available. Therefore we insert the JavaScript code here to initiate +the opening of the image in a separate window. Then, we prepare some +variables that will be passed to GNUPlot for calculation of the +probabilities. Prior to reading the results, we must temporarily change +`RS' because GNUPlot separates lines with newlines. After instructing +GNUPlot to generate a `.png' (or `.ps' or `.gif') image, we initiate +the insertion of some text, explaining the resulting probabilities. The +final `plot' command actually generates the image data. This raw binary +has to be read in carefully without adding, changing, or deleting a +single byte. Hence the unusual initialization of `Image' and completion +with a `while' loop. + + When using this server, it soon becomes clear that it is far from +being perfect. It mixes source code of six scripting languages or +protocols: + + * GNU `awk' implements a server for the protocol: + + * HTTP which transmits: + + * HTML text which contains a short piece of: + + * JavaScript code opening a separate window. + + * A Bourne shell script is used for piping commands into: + + * GNUPlot to generate the image to be opened. + + After all this work, the GNUPlot image opens in the JavaScript window +where it can be viewed by the user. + + It is probably better not to mix up so many different languages. +The result is not very readable. Furthermore, the statistical part of +the server does not take care of invalid input. Among others, using +negative variances will cause invalid results. + + ---------- Footnotes ---------- + + (1) Due to licensing problems, the default installation of GNUPlot +disables the generation of `.gif' files. If your installed version +does not accept `set term gif', just download and install the most +recent version of GNUPlot and the GD library +(http://www.boutell.com/gd/) by Thomas Boutell. Otherwise you still +have the chance to generate some ASCII-art style images with GNUPlot by +using `set term dumb'. (We tried it and it worked.) + + +File: gawkinet.info, Node: MAZE, Next: MOBAGWHO, Prev: STATIST, Up: Some Applications and Techniques + +3.7 MAZE: Walking Through a Maze In Virtual Reality +=================================================== + + In the long run, every program becomes rococo, and then rubble. + Alan Perlis + + By now, we know how to present arbitrary `Content-type's to a +browser. In this node, our server will present a 3D world to our +browser. The 3D world is described in a scene description language +(VRML, Virtual Reality Modeling Language) that allows us to travel +through a perspective view of a 2D maze with our browser. Browsers with +a VRML plugin enable exploration of this technology. We could do one of +those boring `Hello world' examples here, that are usually presented +when introducing novices to VRML. If you have never written any VRML +code, have a look at the VRML FAQ. Presenting a static VRML scene is a +bit trivial; in order to expose `gawk''s new capabilities, we will +present a dynamically generated VRML scene. The function `SetUpServer' +is very simple because it only sets the default HTML page and +initializes the random number generator. As usual, the surrounding +server lets you browse the maze. + + function SetUpServer() { + TopHeader = "<HTML><title>Walk through a maze</title>" + TopDoc = "\ + <h2>Please choose one of the following actions:</h2>\ + <UL>\ + <LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\ + <LI><A HREF=" MyPrefix "/VRMLtest>Watch a simple VRML scene</A>\ + </UL>" + TopFooter = "</HTML>" + srand() + } + + The function `HandleGET' is a bit longer because it first computes +the maze and afterwards generates the VRML code that is sent across the +network. As shown in the STATIST example (*note STATIST::), we set the +type of the content to VRML and then store the VRML representation of +the maze as the page content. We assume that the maze is stored in a 2D +array. Initially, the maze consists of walls only. Then, we add an +entry and an exit to the maze and let the rest of the work be done by +the function `MakeMaze'. Now, only the wall fields are left in the +maze. By iterating over the these fields, we generate one line of VRML +code for each wall field. + + function HandleGET() { + if (MENU[2] == "AboutServer") { + Document = "If your browser has a VRML 2 plugin,\ + this server shows you a simple VRML scene." + } else if (MENU[2] == "VRMLtest") { + XSIZE = YSIZE = 11 # initially, everything is wall + for (y = 0; y < YSIZE; y++) + for (x = 0; x < XSIZE; x++) + Maze[x, y] = "#" + delete Maze[0, 1] # entry is not wall + delete Maze[XSIZE-1, YSIZE-2] # exit is not wall + MakeMaze(1, 1) + Document = "\ + #VRML V2.0 utf8\n\ + Group {\n\ + children [\n\ + PointLight {\n\ + ambientIntensity 0.2\n\ + color 0.7 0.7 0.7\n\ + location 0.0 8.0 10.0\n\ + }\n\ + DEF B1 Background {\n\ + skyColor [0 0 0, 1.0 1.0 1.0 ]\n\ + skyAngle 1.6\n\ + groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\ + groundAngle [ 1.2 1.57 ]\n\ + }\n\ + DEF Wall Shape {\n\ + geometry Box {size 1 1 1}\n\ + appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\ + }\n\ + DEF Entry Viewpoint {\n\ + position 0.5 1.0 5.0\n\ + orientation 0.0 0.0 -1.0 0.52\n\ + }\n" + for (i in Maze) { + split(i, t, SUBSEP) + Document = Document " Transform { translation " + Document = Document t[1] " 0 -" t[2] " children USE Wall }\n" + } + Document = Document " ] # end of group for world\n}" + Reason = "OK" ORS "Content-type: model/vrml" + Header = Footer = "" + } + } + + Finally, we have a look at `MakeMaze', the function that generates +the `Maze' array. When entered, this function assumes that the array +has been initialized so that each element represents a wall element and +the maze is initially full of wall elements. Only the entrance and the +exit of the maze should have been left free. The parameters of the +function tell us which element must be marked as not being a wall. +After this, we take a look at the four neighbouring elements and +remember which we have already treated. Of all the neighbouring +elements, we take one at random and walk in that direction. Therefore, +the wall element in that direction has to be removed and then, we call +the function recursively for that element. The maze is only completed +if we iterate the above procedure for _all_ neighbouring elements (in +random order) and for our present element by recursively calling the +function for the present element. This last iteration could have been +done in a loop, but it is done much simpler recursively. + + Notice that elements with coordinates that are both odd are assumed +to be on our way through the maze and the generating process cannot +terminate as long as there is such an element not being `delete'd. All +other elements are potentially part of the wall. + + function MakeMaze(x, y) { + delete Maze[x, y] # here we are, we have no wall here + p = 0 # count unvisited fields in all directions + if (x-2 SUBSEP y in Maze) d[p++] = "-x" + if (x SUBSEP y-2 in Maze) d[p++] = "-y" + if (x+2 SUBSEP y in Maze) d[p++] = "+x" + if (x SUBSEP y+2 in Maze) d[p++] = "+y" + if (p>0) { # if there are univisited fields, go there + p = int(p*rand()) # choose one unvisited field at random + if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y) + } else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2) + } else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y) + } else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2) + } # we are back from recursion + MakeMaze(x, y); # try again while there are unvisited fields + } + } + + +File: gawkinet.info, Node: MOBAGWHO, Next: STOXPRED, Prev: MAZE, Up: Some Applications and Techniques + +3.8 MOBAGWHO: a Simple Mobile Agent +=================================== + + There are two ways of constructing a software design: One way is to + make it so simple that there are obviously no deficiencies, and the + other way is to make it so complicated that there are no obvious + deficiencies. + C. A. R. Hoare + + A "mobile agent" is a program that can be dispatched from a computer +and transported to a remote server for execution. This is called +"migration", which means that a process on another system is started +that is independent from its originator. Ideally, it wanders through a +network while working for its creator or owner. In places like the UMBC +Agent Web, people are quite confident that (mobile) agents are a +software engineering paradigm that enables us to significantly increase +the efficiency of our work. Mobile agents could become the mediators +between users and the networking world. For an unbiased view at this +technology, see the remarkable paper `Mobile Agents: Are they a good +idea?'.(1) + + When trying to migrate a process from one system to another, a +server process is needed on the receiving side. Depending on the kind +of server process, several ways of implementation come to mind. How +the process is implemented depends upon the kind of server process: + + * HTTP can be used as the protocol for delivery of the migrating + process. In this case, we use a common web server as the receiving + server process. A universal CGI script mediates between migrating + process and web server. Each server willing to accept migrating + agents makes this universal service available. HTTP supplies the + `POST' method to transfer some data to a file on the web server. + When a CGI script is called remotely with the `POST' method + instead of the usual `GET' method, data is transmitted from the + client process to the standard input of the server's CGI script. + So, to implement a mobile agent, we must not only write the agent + program to start on the client side, but also the CGI script to + receive the agent on the server side. + + * The `PUT' method can also be used for migration. HTTP does not + require a CGI script for migration via `PUT'. However, with common + web servers there is no advantage to this solution, because web + servers such as Apache require explicit activation of a special + `PUT' script. + + * `Agent Tcl' pursues a different course; it relies on a dedicated + server process with a dedicated protocol specialized for receiving + mobile agents. + + Our agent example abuses a common web server as a migration tool. +So, it needs a universal CGI script on the receiving side (the web +server). The receiving script is activated with a `POST' request when +placed into a location like `/httpd/cgi-bin/PostAgent.sh'. Make sure +that the server system uses a version of `gawk' that supports network +access (Version 3.1 or later; verify with `gawk --version'). + + #!/bin/sh + MobAg=/tmp/MobileAgent.$$ + # direct script to mobile agent file + cat > $MobAg + # execute agent concurrently + gawk -f $MobAg $MobAg > /dev/null & + # HTTP header, terminator and body + gawk 'BEGIN { print "\r\nAgent started" }' + rm $MobAg # delete script file of agent + + By making its process id (`$$') part of the unique file name, the +script avoids conflicts between concurrent instances of the script. +First, all lines from standard input (the mobile agent's source code) +are copied into this unique file. Then, the agent is started as a +concurrent process and a short message reporting this fact is sent to +the submitting client. Finally, the script file of the mobile agent is +removed because it is no longer needed. Although it is a short script, +there are several noteworthy points: + +Security + _There is none_. In fact, the CGI script should never be made + available on a server that is part of the Internet because everyone + would be allowed to execute arbitrary commands with it. This + behavior is acceptable only when performing rapid prototyping. + +Self-Reference + Each migrating instance of an agent is started in a way that + enables it to read its own source code from standard input and use + the code for subsequent migrations. This is necessary because it + needs to treat the agent's code as data to transmit. `gawk' is not + the ideal language for such a job. Lisp and Tcl are more suitable + because they do not make a distinction between program code and + data. + +Independence + After migration, the agent is not linked to its former home in any + way. By reporting `Agent started', it waves "Goodbye" to its + origin. The originator may choose to terminate or not. + + The originating agent itself is started just like any other +command-line script, and reports the results on standard output. By +letting the name of the original host migrate with the agent, the agent +that migrates to a host far away from its origin can report the result +back home. Having arrived at the end of the journey, the agent +establishes a connection and reports the results. This is the reason +for determining the name of the host with `uname -n' and storing it in +`MyOrigin' for later use. We may also set variables with the `-v' +option from the command line. This interactivity is only of importance +in the context of starting a mobile agent; therefore this `BEGIN' +pattern and its action do not take part in migration: + + BEGIN { + if (ARGC != 2) { + print "MOBAG - a simple mobile agent" + print "CALL:\n gawk -f mobag.awk mobag.awk" + print "IN:\n the name of this script as a command-line parameter" + print "PARAM:\n -v MyOrigin=myhost.com" + print "OUT:\n the result on stdout" + print "JK 29.03.1998 01.04.1998" + exit + } + if (MyOrigin == "") { + "uname -n" | getline MyOrigin + close("uname -n") + } + } + + Since `gawk' cannot manipulate and transmit parts of the program +directly, the source code is read and stored in strings. Therefore, +the program scans itself for the beginning and the ending of functions. +Each line in between is appended to the code string until the end of +the function has been reached. A special case is this part of the +program itself. It is not a function. Placing a similar framework +around it causes it to be treated like a function. Notice that this +mechanism works for all the functions of the source code, but it cannot +guarantee that the order of the functions is preserved during migration: + + #ReadMySelf + /^function / { FUNC = $2 } + /^END/ || /^#ReadMySelf/ { FUNC = $1 } + FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 } + (FUNC != "") && (/^}/ || /^#EndOfMySelf/) \ + { FUNC = "" } + #EndOfMySelf + + The web server code in *note A Web Service with Interaction: +Interacting Service, was first developed as a site-independent core. +Likewise, the `gawk'-based mobile agent starts with an +agent-independent core, to which can be appended application-dependent +functions. What follows is the only application-independent function +needed for the mobile agent: + + function migrate(Destination, MobCode, Label) { + MOBVAR["Label"] = Label + MOBVAR["Destination"] = Destination + RS = ORS = "\r\n" + HttpService = "/inet/tcp/0/" Destination + for (i in MOBFUN) + MobCode = (MobCode "\n" MOBFUN[i]) + MobCode = MobCode "\n\nBEGIN {" + for (i in MOBVAR) + MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"") + MobCode = MobCode "\n}\n" + print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService + print "Content-length:", length(MobCode) ORS |& HttpService + printf "%s", MobCode |& HttpService + while ((HttpService |& getline) > 0) + print $0 + close(HttpService) + } + + The `migrate' function prepares the aforementioned strings +containing the program code and transmits them to a server. A +consequence of this modular approach is that the `migrate' function +takes some parameters that aren't needed in this application, but that +will be in future ones. Its mandatory parameter `Destination' holds the +name (or IP address) of the server that the agent wants as a host for +its code. The optional parameter `MobCode' may contain some `gawk' code +that is inserted during migration in front of all other code. The +optional parameter `Label' may contain a string that tells the agent +what to do in program execution after arrival at its new home site. One +of the serious obstacles in implementing a framework for mobile agents +is that it does not suffice to migrate the code. It is also necessary +to migrate the state of execution of the agent. In contrast to `Agent +Tcl', this program does not try to migrate the complete set of +variables. The following conventions are used: + + * Each variable in an agent program is local to the current host and + does _not_ migrate. + + * The array `MOBFUN' shown above is an exception. It is handled by + the function `migrate' and does migrate with the application. + + * The other exception is the array `MOBVAR'. Each variable that + takes part in migration has to be an element of this array. + `migrate' also takes care of this. + + Now it's clear what happens to the `Label' parameter of the function +`migrate'. It is copied into `MOBVAR["Label"]' and travels alongside +the other data. Since travelling takes place via HTTP, records must be +separated with `"\r\n"' in `RS' and `ORS' as usual. The code assembly +for migration takes place in three steps: + + * Iterate over `MOBFUN' to collect all functions verbatim. + + * Prepare a `BEGIN' pattern and put assignments to mobile variables + into the action part. + + * Transmission itself resembles GETURL: the header with the request + and the `Content-length' is followed by the body. In case there is + any reply over the network, it is read completely and echoed to + standard output to avoid irritating the server. + + The application-independent framework is now almost complete. What +follows is the `END' pattern that is executed when the mobile agent has +finished reading its own code. First, it checks whether it is already +running on a remote host or not. In case initialization has not yet +taken place, it starts `MyInit'. Otherwise (later, on a remote host), it +starts `MyJob': + + END { + if (ARGC != 2) exit # stop when called with wrong parameters + if (MyOrigin != "") # is this the originating host? + MyInit() # if so, initialize the application + else # we are on a host with migrated data + MyJob() # so we do our job + } + + All that's left to extend the framework into a complete application +is to write two application-specific functions: `MyInit' and `MyJob'. +Keep in mind that the former is executed once on the originating host, +while the latter is executed after each migration: + + function MyInit() { + MOBVAR["MyOrigin"] = MyOrigin + MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80" + split(MOBVAR["Machines"], Machines) # which host is the first? + migrate(Machines[1], "", "") # go to the first host + while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result + print $0 # print result + close("/inet/tcp/8080/0/0") + } + + As mentioned earlier, this agent takes the name of its origin +(`MyOrigin') with it. Then, it takes the name of its first destination +and goes there for further work. Notice that this name has the port +number of the web server appended to the name of the server, because +the function `migrate' needs it this way to create the `HttpService' +variable. Finally, it waits for the result to arrive. The `MyJob' +function runs on the remote host: + + function MyJob() { + # forget this host + sub(MOBVAR["Destination"], "", MOBVAR["Machines"]) + MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":" + while (("who" | getline) > 0) # who is logged in? + MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0 + close("who") + if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit? + split(MOBVAR["Machines"], Machines) # which host is next? + migrate(Machines[1], "", "") # go there + } else { # no more machines + gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin + print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080" + close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080") + } + } + + After migrating, the first thing to do in `MyJob' is to delete the +name of the current host from the list of hosts to visit. Now, it is +time to start the real work by appending the host's name to the result +string, and reading line by line who is logged in on this host. A very +annoying circumstance is the fact that the elements of `MOBVAR' cannot +hold the newline character (`"\n"'). If they did, migration of this +string did not work because the string didn't obey the syntax rule for +a string in `gawk'. `SUBSEP' is used as a temporary replacement. If +the list of hosts to visit holds at least one more entry, the agent +migrates to that place to go on working there. Otherwise, we replace +the `SUBSEP's with a newline character in the resulting string, and +report it to the originating host, whose name is stored in +`MOBVAR["MyOrigin"]'. + + ---------- Footnotes ---------- + + (1) `http://www.research.ibm.com/massive/mobag.ps' + + +File: gawkinet.info, Node: STOXPRED, Next: PROTBASE, Prev: MOBAGWHO, Up: Some Applications and Techniques + +3.9 STOXPRED: Stock Market Prediction As A Service +================================================== + + Far out in the uncharted backwaters of the unfashionable end of + the Western Spiral arm of the Galaxy lies a small unregarded + yellow sun. + + Orbiting this at a distance of roughly ninety-two million miles is + an utterly insignificant little blue-green planet whose + ape-descendent life forms are so amazingly primitive that they + still think digital watches are a pretty neat idea. + + This planet has -- or rather had -- a problem, which was this: + most of the people living on it were unhappy for pretty much of + the time. Many solutions were suggested for this problem, but + most of these were largely concerned with the movements of small + green pieces of paper, which is odd because it wasn't the small + green pieces of paper that were unhappy. + Douglas Adams, `The Hitch Hiker's Guide to the Galaxy' + + Valuable services on the Internet are usually _not_ implemented as +mobile agents. There are much simpler ways of implementing services. +All Unix systems provide, for example, the `cron' service. Unix system +users can write a list of tasks to be done each day, each week, twice a +day, or just once. The list is entered into a file named `crontab'. +For example, to distribute a newsletter on a daily basis this way, use +`cron' for calling a script each day early in the morning. + + # run at 8 am on weekdays, distribute the newsletter + 0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1 + + The script first looks for interesting information on the Internet, +assembles it in a nice form and sends the results via email to the +customers. + + The following is an example of a primitive newsletter on stock +market prediction. It is a report which first tries to predict the +change of each share in the Dow Jones Industrial Index for the +particular day. Then it mentions some especially promising shares as +well as some shares which look remarkably bad on that day. The report +ends with the usual disclaimer which tells every child _not_ to try +this at home and hurt anybody. + + Good morning Uncle Scrooge, + + This is your daily stock market report for Monday, October 16, 2000. + Here are the predictions for today: + + AA neutral + GE up + JNJ down + MSFT neutral + ... + UTX up + DD down + IBM up + MO down + WMT up + DIS up + INTC up + MRK down + XOM down + EK down + IP down + + The most promising shares for today are these: + + INTC http://biz.yahoo.com/n/i/intc.html + + The stock shares to avoid today are these: + + EK http://biz.yahoo.com/n/e/ek.html + IP http://biz.yahoo.com/n/i/ip.html + DD http://biz.yahoo.com/n/d/dd.html + ... + + The script as a whole is rather long. In order to ease the pain of +studying other people's source code, we have broken the script up into +meaningful parts which are invoked one after the other. The basic +structure of the script is as follows: + + BEGIN { + Init() + ReadQuotes() + CleanUp() + Prediction() + Report() + SendMail() + } + + The earlier parts store data into variables and arrays which are +subsequently used by later parts of the script. The `Init' function +first checks if the script is invoked correctly (without any +parameters). If not, it informs the user of the correct usage. What +follows are preparations for the retrieval of the historical quote +data. The names of the 30 stock shares are stored in an array `name' +along with the current date in `day', `month', and `year'. + + All users who are separated from the Internet by a firewall and have +to direct their Internet accesses to a proxy must supply the name of +the proxy to this script with the `-v Proxy=NAME' option. For most +users, the default proxy and port number should suffice. + + function Init() { + if (ARGC != 1) { + print "STOXPRED - daily stock share prediction" + print "IN:\n no parameters, nothing on stdin" + print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80" + print "OUT:\n commented predictions as email" + print "JK 09.10.2000" + exit + } + # Remember ticker symbols from Dow Jones Industrial Index + StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \ + SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \ + MRK XOM EK IP", name); + # Remember the current date as the end of the time series + day = strftime("%d") + month = strftime("%m") + year = strftime("%Y") + if (Proxy == "") Proxy = "chart.yahoo.com" + if (ProxyPort == 0) ProxyPort = 80 + YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort + } + + There are two really interesting parts in the script. One is the +function which reads the historical stock quotes from an Internet +server. The other is the one that does the actual prediction. In the +following function we see how the quotes are read from the Yahoo +server. The data which comes from the server is in CSV format +(comma-separated values): + + Date,Open,High,Low,Close,Volume + 9-Oct-00,22.75,22.75,21.375,22.375,7888500 + 6-Oct-00,23.8125,24.9375,21.5625,22,10701100 + 5-Oct-00,24.4375,24.625,23.125,23.50,5810300 + + Lines contain values of the same time instant, whereas columns are +separated by commas and contain the kind of data that is described in +the header (first) line. At first, `gawk' is instructed to separate +columns by commas (`FS = ","'). In the loop that follows, a connection +to the Yahoo server is first opened, then a download takes place, and +finally the connection is closed. All this happens once for each ticker +symbol. In the body of this loop, an Internet address is built up as a +string according to the rules of the Yahoo server. The starting and +ending date are chosen to be exactly the same, but one year apart in +the past. All the action is initiated within the `printf' command which +transmits the request for data to the Yahoo server. + + In the inner loop, the server's data is first read and then scanned +line by line. Only lines which have six columns and the name of a month +in the first column contain relevant data. This data is stored in the +two-dimensional array `quote'; one dimension being time, the other +being the ticker symbol. During retrieval of the first stock's data, +the calendar names of the time instances are stored in the array `day' +because we need them later. + + function ReadQuotes() { + # Retrieve historical data for each ticker symbol + FS = "," + for (stock = 1; stock <= StockCount; stock++) { + URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \ + "&a=" month "&b=" day "&c=" year-1 \ + "&d=" month "&e=" day "&f=" year \ + "g=d&q=q&y=0&z=" name[stock] "&x=.csv" + printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData + while ((YahooData |& getline) > 0) { + if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) { + if (stock == 1) + days[++daycount] = $1; + quote[$1, stock] = $5 + } + } + close(YahooData) + } + FS = " " + } + + Now that we _have_ the data, it can be checked once again to make +sure that no individual stock is missing or invalid, and that all the +stock quotes are aligned correctly. Furthermore, we renumber the time +instances. The most recent day gets day number 1 and all other days get +consecutive numbers. All quotes are rounded toward the nearest whole +number in US Dollars. + + function CleanUp() { + # clean up time series; eliminate incomplete data sets + for (d = 1; d <= daycount; d++) { + for (stock = 1; stock <= StockCount; stock++) + if (! ((days[d], stock) in quote)) + stock = StockCount + 10 + if (stock > StockCount + 1) + continue + datacount++ + for (stock = 1; stock <= StockCount; stock++) + data[datacount, stock] = int(0.5 + quote[days[d], stock]) + } + delete quote + delete days + } + + Now we have arrived at the second really interesting part of the +whole affair. What we present here is a very primitive prediction +algorithm: _If a stock fell yesterday, assume it will also fall today; +if it rose yesterday, assume it will rise today_. (Feel free to +replace this algorithm with a smarter one.) If a stock changed in the +same direction on two consecutive days, this is an indication which +should be highlighted. Two-day advances are stored in `hot' and +two-day declines in `avoid'. + + The rest of the function is a sanity check. It counts the number of +correct predictions in relation to the total number of predictions one +could have made in the year before. + + function Prediction() { + # Predict each ticker symbol by prolonging yesterday's trend + for (stock = 1; stock <= StockCount; stock++) { + if (data[1, stock] > data[2, stock]) { + predict[stock] = "up" + } else if (data[1, stock] < data[2, stock]) { + predict[stock] = "down" + } else { + predict[stock] = "neutral" + } + if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock])) + hot[stock] = 1 + if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock])) + avoid[stock] = 1 + } + # Do a plausibility check: how many predictions proved correct? + for (s = 1; s <= StockCount; s++) { + for (d = 1; d <= datacount-2; d++) { + if (data[d+1, s] > data[d+2, s]) { + UpCount++ + } else if (data[d+1, s] < data[d+2, s]) { + DownCount++ + } else { + NeutralCount++ + } + if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) || + ((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) || + ((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s]))) + CorrectCount++ + } + } + } + + At this point the hard work has been done: the array `predict' +contains the predictions for all the ticker symbols. It is up to the +function `Report' to find some nice words to introduce the desired +information. + + function Report() { + # Generate report + report = "\nThis is your daily " + report = report "stock market report for "strftime("%A, %B %d, %Y")".\n" + report = report "Here are the predictions for today:\n\n" + for (stock = 1; stock <= StockCount; stock++) + report = report "\t" name[stock] "\t" predict[stock] "\n" + for (stock in hot) { + if (HotCount++ == 0) + report = report "\nThe most promising shares for today are these:\n\n" + report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ + tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" + } + for (stock in avoid) { + if (AvoidCount++ == 0) + report = report "\nThe stock shares to avoid today are these:\n\n" + report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ + tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" + } + report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0 + report = report " losers. When using this kind\nof prediction scheme for" + report = report " the 12 months which lie behind us,\nwe get " UpCount + report = report " 'ups' and " DownCount " 'downs' and " NeutralCount + report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount + report = report " predictions " CorrectCount " proved correct next day.\n" + report = report "A success rate of "\ + int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n" + report = report "Random choice would have produced a 33% success rate.\n" + report = report "Disclaimer: Like every other prediction of the stock\n" + report = report "market, this report is, of course, complete nonsense.\n" + report = report "If you are stupid enough to believe these predictions\n" + report = report "you should visit a doctor who can treat your ailment." + } + + The function `SendMail' goes through the list of customers and opens +a pipe to the `mail' command for each of them. Each one receives an +email message with a proper subject heading and is addressed with his +full name. + + function SendMail() { + # send report to customers + customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge" + customer["more@utopia.org" ] = "Sir Thomas More" + customer["spinoza@denhaag.nl" ] = "Baruch de Spinoza" + customer["marx@highgate.uk" ] = "Karl Marx" + customer["keynes@the.long.run" ] = "John Maynard Keynes" + customer["bierce@devil.hell.org" ] = "Ambrose Bierce" + customer["laplace@paris.fr" ] = "Pierre Simon de Laplace" + for (c in customer) { + MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c + print "Good morning " customer[c] "," | MailPipe + print report "\n.\n" | MailPipe + close(MailPipe) + } + } + + Be patient when running the script by hand. Retrieving the data for +all the ticker symbols and sending the emails may take several minutes +to complete, depending upon network traffic and the speed of the +available Internet link. The quality of the prediction algorithm is +likely to be disappointing. Try to find a better one. Should you find +one with a success rate of more than 50%, please tell us about it! It +is only for the sake of curiosity, of course. `:-)' + + +File: gawkinet.info, Node: PROTBASE, Prev: STOXPRED, Up: Some Applications and Techniques + +3.10 PROTBASE: Searching Through A Protein Database +=================================================== + + Hoare's Law of Large Problems: Inside every large problem is a + small problem struggling to get out. + + Yahoo's database of stock market data is just one among the many +large databases on the Internet. Another one is located at NCBI +(National Center for Biotechnology Information). Established in 1988 as +a national resource for molecular biology information, NCBI creates +public databases, conducts research in computational biology, develops +software tools for analyzing genome data, and disseminates biomedical +information. In this section, we look at one of NCBI's public services, +which is called BLAST (Basic Local Alignment Search Tool). + + You probably know that the information necessary for reproducing +living cells is encoded in the genetic material of the cells. The +genetic material is a very long chain of four base nucleotides. It is +the order of appearance (the sequence) of nucleotides which contains +the information about the substance to be produced. Scientists in +biotechnology often find a specific fragment, determine the nucleotide +sequence, and need to know where the sequence at hand comes from. This +is where the large databases enter the game. At NCBI, databases store +the knowledge about which sequences have ever been found and where they +have been found. When the scientist sends his sequence to the BLAST +service, the server looks for regions of genetic material in its +database which look the most similar to the delivered nucleotide +sequence. After a search time of some seconds or minutes the server +sends an answer to the scientist. In order to make access simple, NCBI +chose to offer their database service through popular Internet +protocols. There are four basic ways to use the so-called BLAST +services: + + * The easiest way to use BLAST is through the web. Users may simply + point their browsers at the NCBI home page and link to the BLAST + pages. NCBI provides a stable URL that may be used to perform + BLAST searches without interactive use of a web browser. This is + what we will do later in this section. A demonstration client and + a `README' file demonstrate how to access this URL. + + * Currently, `blastcl3' is the standard network BLAST client. You + can download `blastcl3' from the anonymous FTP location. + + * BLAST 2.0 can be run locally as a full executable and can be used + to run BLAST searches against private local databases, or + downloaded copies of the NCBI databases. BLAST 2.0 executables may + be found on the NCBI anonymous FTP server. + + * The NCBI BLAST Email server is the best option for people without + convenient access to the web. A similarity search can be performed + by sending a properly formatted mail message containing the + nucleotide or protein query sequence to <blast@ncbi.nlm.nih.gov>. + The query sequence is compared against the specified database + using the BLAST algorithm and the results are returned in an email + message. For more information on formulating email BLAST searches, + you can send a message consisting of the word "HELP" to the same + address, <blast@ncbi.nlm.nih.gov>. + + Our starting point is the demonstration client mentioned in the +first option. The `README' file that comes along with the client +explains the whole process in a nutshell. In the rest of this section, +we first show what such requests look like. Then we show how to use +`gawk' to implement a client in about 10 lines of code. Finally, we +show how to interpret the result returned from the service. + + Sequences are expected to be represented in the standard IUB/IUPAC +amino acid and nucleic acid codes, with these exceptions: lower-case +letters are accepted and are mapped into upper-case; a single hyphen or +dash can be used to represent a gap of indeterminate length; and in +amino acid sequences, `U' and `*' are acceptable letters (see below). +Before submitting a request, any numerical digits in the query sequence +should either be removed or replaced by appropriate letter codes (e.g., +`N' for unknown nucleic acid residue or `X' for unknown amino acid +residue). The nucleic acid codes supported are: + + A --> adenosine M --> A C (amino) + C --> cytidine S --> G C (strong) + G --> guanine W --> A T (weak) + T --> thymidine B --> G T C + U --> uridine D --> G A T + R --> G A (purine) H --> A C T + Y --> T C (pyrimidine) V --> G C A + K --> G T (keto) N --> A G C T (any) + - gap of indeterminate length + + Now you know the alphabet of nucleotide sequences. The last two lines +of the following example query show you such a sequence, which is +obviously made up only of elements of the alphabet just described. +Store this example query into a file named `protbase.request'. You are +now ready to send it to the server with the demonstration client. + + PROGRAM blastn + DATALIB month + EXPECT 0.75 + BEGIN + >GAWK310 the gawking gene GNU AWK + tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat + caccaccatggacagcaaa + + The actual search request begins with the mandatory parameter +`PROGRAM' in the first column followed by the value `blastn' (the name +of the program) for searching nucleic acids. The next line contains +the mandatory search parameter `DATALIB' with the value `month' for the +newest nucleic acid sequences. The third line contains an optional +`EXPECT' parameter and the value desired for it. The fourth line +contains the mandatory `BEGIN' directive, followed by the query +sequence in FASTA/Pearson format. Each line of information must be +less than 80 characters in length. + + The "month" database contains all new or revised sequences released +in the last 30 days and is useful for searching against new sequences. +There are five different blast programs, `blastn' being the one that +compares a nucleotide query sequence against a nucleotide sequence +database. + + The last server directive that must appear in every request is the +`BEGIN' directive. The query sequence should immediately follow the +`BEGIN' directive and must appear in FASTA/Pearson format. A sequence +in FASTA/Pearson format begins with a single-line description. The +description line, which is required, is distinguished from the lines of +sequence data that follow it by having a greater-than (`>') symbol in +the first column. For the purposes of the BLAST server, the text of +the description is arbitrary. + + If you prefer to use a client written in `gawk', just store the +following 10 lines of code into a file named `protbase.awk' and use +this client instead. Invoke it with `gawk -f protbase.awk +protbase.request'. Then wait a minute and watch the result coming in. +In order to replicate the demonstration client's behaviour as closely +as possible, this client does not use a proxy server. We could also +have extended the client program in *note Retrieving Web Pages: GETURL, +to implement the client request from `protbase.awk' as a special case. + + { request = request "\n" $0 } + + END { + BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80" + printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService + printf "Content-Length: " length(request) "\n\n" |& BLASTService + printf request |& BLASTService + while ((BLASTService |& getline) > 0) + print $0 + close(BLASTService) + } + + The demonstration client from NCBI is 214 lines long (written in C) +and it is not immediately obvious what it does. Our client is so short +that it _is_ obvious what it does. First it loops over all lines of the +query and stores the whole query into a variable. Then the script +establishes an Internet connection to the NCBI server and transmits the +query by framing it with a proper HTTP request. Finally it receives and +prints the complete result coming from the server. + + Now, let us look at the result. It begins with an HTTP header, which +you can ignore. Then there are some comments about the query having been +filtered to avoid spuriously high scores. After this, there is a +reference to the paper that describes the software being used for +searching the data base. After a repetition of the original query's +description we find the list of significant alignments: + + Sequences producing significant alignments: (bits) Value + + gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20 + gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20 + emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20 + emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20 + emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20 + emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20 + gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20 + + This means that the query sequence was found in seven human +chromosomes. But the value 0.20 (20%) means that the probability of an +accidental match is rather high (20%) in all cases and should be taken +into account. You may wonder what the first column means. It is a key +to the specific database in which this occurrence was found. The +unique sequence identifiers reported in the search results can be used +as sequence retrieval keys via the NCBI server. The syntax of sequence +header lines used by the NCBI BLAST server depends on the database from +which each sequence was obtained. The table below lists the +identifiers for the databases from which the sequences were derived. + + Database Name Identifier Syntax + ============================ ======================== + GenBank gb|accession|locus + EMBL Data Library emb|accession|locus + DDBJ, DNA Database of Japan dbj|accession|locus + NBRF PIR pir||entry + Protein Research Foundation prf||name + SWISS-PROT sp|accession|entry name + Brookhaven Protein Data Bank pdb|entry|chain + Kabat's Sequences of Immuno... gnl|kabat|identifier + Patents pat|country|number + GenInfo Backbone Id bbs|number + + For example, an identifier might be `gb|AC021182.14|AC021182', where +the `gb' tag indicates that the identifier refers to a GenBank sequence, +`AC021182.14' is its GenBank ACCESSION, and `AC021182' is the GenBank +LOCUS. The identifier contains no spaces, so that a space indicates +the end of the identifier. + + Let us continue in the result listing. Each of the seven alignments +mentioned above is subsequently described in detail. We will have a +closer look at the first of them. + + >gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4 + unordered pieces + Length = 176383 + + Score = 38.2 bits (19), Expect = 0.20 + Identities = 19/19 (100%) + Strand = Plus / Plus + + Query: 35 tggtgaagtgtgtttcttg 53 + ||||||||||||||||||| + Sbjct: 69786 tggtgaagtgtgtttcttg 69804 + + This alignment was located on the human chromosome 7. The fragment +on which part of the query was found had a total length of 176383. Only +19 of the nucleotides matched and the matching sequence ran from +character 35 to 53 in the query sequence and from 69786 to 69804 in the +fragment on chromosome 7. If you are still reading at this point, you +are probably interested in finding out more about Computational Biology +and you might appreciate the following hints. + + 1. There is a book called `Introduction to Computational Biology' by + Michael S. Waterman, which is worth reading if you are seriously + interested. You can find a good book review on the Internet. + + 2. While Waterman's book can explain to you the algorithms employed + internally in the database search engines, most practitioners + prefer to approach the subject differently. The applied side of + Computational Biology is called Bioinformatics, and emphasizes the + tools available for day-to-day work as well as how to actually + _use_ them. One of the very few affordable books on Bioinformatics + is `Developing Bioinformatics Computer Skills'. + + 3. The sequences _gawk_ and _gnuawk_ are in widespread use in the + genetic material of virtually every earthly living being. Let us + take this as a clear indication that the divine creator has + intended `gawk' to prevail over other scripting languages such as + `perl', `tcl', or `python' which are not even proper sequences. + (:-) + + +File: gawkinet.info, Node: Links, Next: GNU Free Documentation License, Prev: Some Applications and Techniques, Up: Top + +4 Related Links +*************** + +This section lists the URLs for various items discussed in this major +node. They are presented in the order in which they appear. + +`Internet Programming with Python' + `http://www.fsbassociates.com/books/python.htm' + +`Advanced Perl Programming' + `http://www.oreilly.com/catalog/advperl' + +`Web Client Programming with Perl' + `http://www.oreilly.com/catalog/webclient' + +Richard Stevens's home page and book + `http://www.kohala.com/~rstevens' + +The SPAK home page + `http://www.userfriendly.net/linux/RPM/contrib/libc6/i386/spak-0.6b-1.i386.html' + +Volume III of `Internetworking with TCP/IP', by Comer and Stevens + `http://www.cs.purdue.edu/homes/dec/tcpip3s.cont.html' + +XBM Graphics File Format + `http://www.wotsit.org/download.asp?f=xbm' + +GNUPlot + `http://www.cs.dartmouth.edu/gnuplot_info.html' + +Mark Humphrys' Eliza page + `http://www.compapp.dcu.ie/~humphrys/eliza.html' + +Yahoo! Eliza Information + `http://dir.yahoo.com/Recreation/Games/Computer_Games/Internet_Games/Web_Games/Artificial_Intelligence' + +Java versions of Eliza + `http://www.tjhsst.edu/Psych/ch1/eliza.html' + +Java versions of Eliza with source code + `http://home.adelphia.net/~lifeisgood/eliza/eliza.htm' + +Eliza Programs with Explanations + `http://chayden.net/chayden/eliza/Eliza.shtml' + +Loebner Contest + `http://acm.org/~loebner/loebner-prize.htmlx' + +Tck/Tk Information + `http://www.scriptics.com/' + +Intel 80x86 Processors + `http://developer.intel.com/design/platform/embedpc/what_is.htm' + +AMD Elan Processors + `http://www.amd.com/products/epd/processors/4.32bitcont/32bitcont/index.html' + +XINU + `http://willow.canberra.edu.au/~chrisc/xinu.html' + +GNU/Linux + `http://uclinux.lineo.com/' + +Embedded PCs + `http://dir.yahoo.com/Business_and_Economy/Business_to_Business/Computers/Hardware/Embedded_Control/' + +MiniSQL + `http://www.hughes.com.au/library/' + +Market Share Surveys + `http://www.netcraft.com/survey' + +`Numerical Recipes in C: The Art of Scientific Computing' + `http://www.nr.com' + +VRML + `http://www.vrml.org' + +The VRML FAQ + `http://www.vrml.org/technicalinfo/specifications/specifications.htm#FAQ' + +The UMBC Agent Web + `http://www.cs.umbc.edu/agents' + +Apache Web Server + `http://www.apache.org' + +National Center for Biotechnology Information (NCBI) + `http://www.ncbi.nlm.nih.gov' + +Basic Local Alignment Search Tool (BLAST) + `http://www.ncbi.nlm.nih.gov/BLAST/blast_overview.html' + +NCBI Home Page + `http://www.ncbi.nlm.nih.gov' + +BLAST Pages + `http://www.ncbi.nlm.nih.gov/BLAST' + +BLAST Demonstration Client + `ftp://ncbi.nlm.nih.gov/blast/blasturl/' + +BLAST anonymous FTP location + `ftp://ncbi.nlm.nih.gov/blast/network/netblast/' + +BLAST 2.0 Executables + `ftp://ncbi.nlm.nih.gov/blast/executables/' + +IUB/IUPAC Amino Acid and Nucleic Acid Codes + `http://www.uthscsa.edu/geninfo/blastmail.html#item6' + +FASTA/Pearson Format + `http://www.ncbi.nlm.nih.gov/BLAST/fasta.html' + +Fasta/Pearson Sequence in Java + `http://www.kazusa.or.jp/java/codon_table_java/' + +Book Review of `Introduction to Computational Biology' + `http://www.acm.org/crossroads/xrds5-1/introcb.html' + +`Developing Bioinformatics Computer Skills' + `http://www.oreilly.com/catalog/bioskills/' + + + +File: gawkinet.info, Node: GNU Free Documentation License, Next: Index, Prev: Links, Up: Top + +GNU Free Documentation License +****************************** + + Version 1.2, November 2002 + + Copyright (C) 2000,2001,2002 Free Software Foundation, Inc. + 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA + + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + 0. PREAMBLE + + The purpose of this License is to make a manual, textbook, or other + functional and useful document "free" in the sense of freedom: to + assure everyone the effective freedom to copy and redistribute it, + with or without modifying it, either commercially or + noncommercially. Secondarily, this License preserves for the + author and publisher a way to get credit for their work, while not + being considered responsible for modifications made by others. + + This License is a kind of "copyleft", which means that derivative + works of the document must themselves be free in the same sense. + It complements the GNU General Public License, which is a copyleft + license designed for free software. + + We have designed this License in order to use it for manuals for + free software, because free software needs free documentation: a + free program should come with manuals providing the same freedoms + that the software does. But this License is not limited to + software manuals; it can be used for any textual work, regardless + of subject matter or whether it is published as a printed book. + We recommend this License principally for works whose purpose is + instruction or reference. + + 1. APPLICABILITY AND DEFINITIONS + + This License applies to any manual or other work, in any medium, + that contains a notice placed by the copyright holder saying it + can be distributed under the terms of this License. Such a notice + grants a world-wide, royalty-free license, unlimited in duration, + to use that work under the conditions stated herein. The + "Document", below, refers to any such manual or work. Any member + of the public is a licensee, and is addressed as "you". You + accept the license if you copy, modify or distribute the work in a + way requiring permission under copyright law. + + A "Modified Version" of the Document means any work containing the + Document or a portion of it, either copied verbatim, or with + modifications and/or translated into another language. + + A "Secondary Section" is a named appendix or a front-matter section + of the Document that deals exclusively with the relationship of the + publishers or authors of the Document to the Document's overall + subject (or to related matters) and contains nothing that could + fall directly within that overall subject. (Thus, if the Document + is in part a textbook of mathematics, a Secondary Section may not + explain any mathematics.) The relationship could be a matter of + historical connection with the subject or with related matters, or + of legal, commercial, philosophical, ethical or political position + regarding them. + + The "Invariant Sections" are certain Secondary Sections whose + titles are designated, as being those of Invariant Sections, in + the notice that says that the Document is released under this + License. If a section does not fit the above definition of + Secondary then it is not allowed to be designated as Invariant. + The Document may contain zero Invariant Sections. If the Document + does not identify any Invariant Sections then there are none. + + The "Cover Texts" are certain short passages of text that are + listed, as Front-Cover Texts or Back-Cover Texts, in the notice + that says that the Document is released under this License. A + Front-Cover Text may be at most 5 words, and a Back-Cover Text may + be at most 25 words. + + A "Transparent" copy of the Document means a machine-readable copy, + represented in a format whose specification is available to the + general public, that is suitable for revising the document + straightforwardly with generic text editors or (for images + composed of pixels) generic paint programs or (for drawings) some + widely available drawing editor, and that is suitable for input to + text formatters or for automatic translation to a variety of + formats suitable for input to text formatters. A copy made in an + otherwise Transparent file format whose markup, or absence of + markup, has been arranged to thwart or discourage subsequent + modification by readers is not Transparent. An image format is + not Transparent if used for any substantial amount of text. A + copy that is not "Transparent" is called "Opaque". + + Examples of suitable formats for Transparent copies include plain + ASCII without markup, Texinfo input format, LaTeX input format, + SGML or XML using a publicly available DTD, and + standard-conforming simple HTML, PostScript or PDF designed for + human modification. Examples of transparent image formats include + PNG, XCF and JPG. Opaque formats include proprietary formats that + can be read and edited only by proprietary word processors, SGML or + XML for which the DTD and/or processing tools are not generally + available, and the machine-generated HTML, PostScript or PDF + produced by some word processors for output purposes only. + + The "Title Page" means, for a printed book, the title page itself, + plus such following pages as are needed to hold, legibly, the + material this License requires to appear in the title page. For + works in formats which do not have any title page as such, "Title + Page" means the text near the most prominent appearance of the + work's title, preceding the beginning of the body of the text. + + A section "Entitled XYZ" means a named subunit of the Document + whose title either is precisely XYZ or contains XYZ in parentheses + following text that translates XYZ in another language. (Here XYZ + stands for a specific section name mentioned below, such as + "Acknowledgements", "Dedications", "Endorsements", or "History".) + To "Preserve the Title" of such a section when you modify the + Document means that it remains a section "Entitled XYZ" according + to this definition. + + The Document may include Warranty Disclaimers next to the notice + which states that this License applies to the Document. These + Warranty Disclaimers are considered to be included by reference in + this License, but only as regards disclaiming warranties: any other + implication that these Warranty Disclaimers may have is void and + has no effect on the meaning of this License. + + 2. VERBATIM COPYING + + You may copy and distribute the Document in any medium, either + commercially or noncommercially, provided that this License, the + copyright notices, and the license notice saying this License + applies to the Document are reproduced in all copies, and that you + add no other conditions whatsoever to those of this License. You + may not use technical measures to obstruct or control the reading + or further copying of the copies you make or distribute. However, + you may accept compensation in exchange for copies. If you + distribute a large enough number of copies you must also follow + the conditions in section 3. + + You may also lend copies, under the same conditions stated above, + and you may publicly display copies. + + 3. COPYING IN QUANTITY + + If you publish printed copies (or copies in media that commonly + have printed covers) of the Document, numbering more than 100, and + the Document's license notice requires Cover Texts, you must + enclose the copies in covers that carry, clearly and legibly, all + these Cover Texts: Front-Cover Texts on the front cover, and + Back-Cover Texts on the back cover. Both covers must also clearly + and legibly identify you as the publisher of these copies. The + front cover must present the full title with all words of the + title equally prominent and visible. You may add other material + on the covers in addition. Copying with changes limited to the + covers, as long as they preserve the title of the Document and + satisfy these conditions, can be treated as verbatim copying in + other respects. + + If the required texts for either cover are too voluminous to fit + legibly, you should put the first ones listed (as many as fit + reasonably) on the actual cover, and continue the rest onto + adjacent pages. + + If you publish or distribute Opaque copies of the Document + numbering more than 100, you must either include a + machine-readable Transparent copy along with each Opaque copy, or + state in or with each Opaque copy a computer-network location from + which the general network-using public has access to download + using public-standard network protocols a complete Transparent + copy of the Document, free of added material. If you use the + latter option, you must take reasonably prudent steps, when you + begin distribution of Opaque copies in quantity, to ensure that + this Transparent copy will remain thus accessible at the stated + location until at least one year after the last time you + distribute an Opaque copy (directly or through your agents or + retailers) of that edition to the public. + + It is requested, but not required, that you contact the authors of + the Document well before redistributing any large number of + copies, to give them a chance to provide you with an updated + version of the Document. + + 4. MODIFICATIONS + + You may copy and distribute a Modified Version of the Document + under the conditions of sections 2 and 3 above, provided that you + release the Modified Version under precisely this License, with + the Modified Version filling the role of the Document, thus + licensing distribution and modification of the Modified Version to + whoever possesses a copy of it. In addition, you must do these + things in the Modified Version: + + A. Use in the Title Page (and on the covers, if any) a title + distinct from that of the Document, and from those of + previous versions (which should, if there were any, be listed + in the History section of the Document). You may use the + same title as a previous version if the original publisher of + that version gives permission. + + B. List on the Title Page, as authors, one or more persons or + entities responsible for authorship of the modifications in + the Modified Version, together with at least five of the + principal authors of the Document (all of its principal + authors, if it has fewer than five), unless they release you + from this requirement. + + C. State on the Title page the name of the publisher of the + Modified Version, as the publisher. + + D. Preserve all the copyright notices of the Document. + + E. Add an appropriate copyright notice for your modifications + adjacent to the other copyright notices. + + F. Include, immediately after the copyright notices, a license + notice giving the public permission to use the Modified + Version under the terms of this License, in the form shown in + the Addendum below. + + G. Preserve in that license notice the full lists of Invariant + Sections and required Cover Texts given in the Document's + license notice. + + H. Include an unaltered copy of this License. + + I. Preserve the section Entitled "History", Preserve its Title, + and add to it an item stating at least the title, year, new + authors, and publisher of the Modified Version as given on + the Title Page. If there is no section Entitled "History" in + the Document, create one stating the title, year, authors, + and publisher of the Document as given on its Title Page, + then add an item describing the Modified Version as stated in + the previous sentence. + + J. Preserve the network location, if any, given in the Document + for public access to a Transparent copy of the Document, and + likewise the network locations given in the Document for + previous versions it was based on. These may be placed in + the "History" section. You may omit a network location for a + work that was published at least four years before the + Document itself, or if the original publisher of the version + it refers to gives permission. + + K. For any section Entitled "Acknowledgements" or "Dedications", + Preserve the Title of the section, and preserve in the + section all the substance and tone of each of the contributor + acknowledgements and/or dedications given therein. + + L. Preserve all the Invariant Sections of the Document, + unaltered in their text and in their titles. Section numbers + or the equivalent are not considered part of the section + titles. + + M. Delete any section Entitled "Endorsements". Such a section + may not be included in the Modified Version. + + N. Do not retitle any existing section to be Entitled + "Endorsements" or to conflict in title with any Invariant + Section. + + O. Preserve any Warranty Disclaimers. + + If the Modified Version includes new front-matter sections or + appendices that qualify as Secondary Sections and contain no + material copied from the Document, you may at your option + designate some or all of these sections as invariant. To do this, + add their titles to the list of Invariant Sections in the Modified + Version's license notice. These titles must be distinct from any + other section titles. + + You may add a section Entitled "Endorsements", provided it contains + nothing but endorsements of your Modified Version by various + parties--for example, statements of peer review or that the text + has been approved by an organization as the authoritative + definition of a standard. + + You may add a passage of up to five words as a Front-Cover Text, + and a passage of up to 25 words as a Back-Cover Text, to the end + of the list of Cover Texts in the Modified Version. Only one + passage of Front-Cover Text and one of Back-Cover Text may be + added by (or through arrangements made by) any one entity. If the + Document already includes a cover text for the same cover, + previously added by you or by arrangement made by the same entity + you are acting on behalf of, you may not add another; but you may + replace the old one, on explicit permission from the previous + publisher that added the old one. + + The author(s) and publisher(s) of the Document do not by this + License give permission to use their names for publicity for or to + assert or imply endorsement of any Modified Version. + + 5. COMBINING DOCUMENTS + + You may combine the Document with other documents released under + this License, under the terms defined in section 4 above for + modified versions, provided that you include in the combination + all of the Invariant Sections of all of the original documents, + unmodified, and list them all as Invariant Sections of your + combined work in its license notice, and that you preserve all + their Warranty Disclaimers. + + The combined work need only contain one copy of this License, and + multiple identical Invariant Sections may be replaced with a single + copy. If there are multiple Invariant Sections with the same name + but different contents, make the title of each such section unique + by adding at the end of it, in parentheses, the name of the + original author or publisher of that section if known, or else a + unique number. Make the same adjustment to the section titles in + the list of Invariant Sections in the license notice of the + combined work. + + In the combination, you must combine any sections Entitled + "History" in the various original documents, forming one section + Entitled "History"; likewise combine any sections Entitled + "Acknowledgements", and any sections Entitled "Dedications". You + must delete all sections Entitled "Endorsements." + + 6. COLLECTIONS OF DOCUMENTS + + You may make a collection consisting of the Document and other + documents released under this License, and replace the individual + copies of this License in the various documents with a single copy + that is included in the collection, provided that you follow the + rules of this License for verbatim copying of each of the + documents in all other respects. + + You may extract a single document from such a collection, and + distribute it individually under this License, provided you insert + a copy of this License into the extracted document, and follow + this License in all other respects regarding verbatim copying of + that document. + + 7. AGGREGATION WITH INDEPENDENT WORKS + + A compilation of the Document or its derivatives with other + separate and independent documents or works, in or on a volume of + a storage or distribution medium, is called an "aggregate" if the + copyright resulting from the compilation is not used to limit the + legal rights of the compilation's users beyond what the individual + works permit. When the Document is included an aggregate, this + License does not apply to the other works in the aggregate which + are not themselves derivative works of the Document. + + If the Cover Text requirement of section 3 is applicable to these + copies of the Document, then if the Document is less than one half + of the entire aggregate, the Document's Cover Texts may be placed + on covers that bracket the Document within the aggregate, or the + electronic equivalent of covers if the Document is in electronic + form. Otherwise they must appear on printed covers that bracket + the whole aggregate. + + 8. TRANSLATION + + Translation is considered a kind of modification, so you may + distribute translations of the Document under the terms of section + 4. Replacing Invariant Sections with translations requires special + permission from their copyright holders, but you may include + translations of some or all Invariant Sections in addition to the + original versions of these Invariant Sections. You may include a + translation of this License, and all the license notices in the + Document, and any Warranty Disclaimers, provided that you also + include the original English version of this License and the + original versions of those notices and disclaimers. In case of a + disagreement between the translation and the original version of + this License or a notice or disclaimer, the original version will + prevail. + + If a section in the Document is Entitled "Acknowledgements", + "Dedications", or "History", the requirement (section 4) to + Preserve its Title (section 1) will typically require changing the + actual title. + + 9. TERMINATION + + You may not copy, modify, sublicense, or distribute the Document + except as expressly provided for under this License. Any other + attempt to copy, modify, sublicense or distribute the Document is + void, and will automatically terminate your rights under this + License. However, parties who have received copies, or rights, + from you under this License will not have their licenses + terminated so long as such parties remain in full compliance. + + 10. FUTURE REVISIONS OF THIS LICENSE + + The Free Software Foundation may publish new, revised versions of + the GNU Free Documentation License from time to time. Such new + versions will be similar in spirit to the present version, but may + differ in detail to address new problems or concerns. See + `http://www.gnu.org/copyleft/'. + + Each version of the License is given a distinguishing version + number. If the Document specifies that a particular numbered + version of this License "or any later version" applies to it, you + have the option of following the terms and conditions either of + that specified version or of any later version that has been + published (not as a draft) by the Free Software Foundation. If + the Document does not specify a version number of this License, + you may choose any version ever published (not as a draft) by the + Free Software Foundation. + +ADDENDUM: How to use this License for your documents +==================================================== + +To use this License in a document you have written, include a copy of +the License in the document and put the following copyright and license +notices just after the title page: + + Copyright (C) YEAR YOUR NAME. + Permission is granted to copy, distribute and/or modify this document + under the terms of the GNU Free Documentation License, Version 1.2 + or any later version published by the Free Software Foundation; + with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts. + A copy of the license is included in the section entitled ``GNU + Free Documentation License''. + + If you have Invariant Sections, Front-Cover Texts and Back-Cover +Texts, replace the "with...Texts." line with this: + + with the Invariant Sections being LIST THEIR TITLES, with + the Front-Cover Texts being LIST, and with the Back-Cover Texts + being LIST. + + If you have Invariant Sections without Cover Texts, or some other +combination of the three, merge those two alternatives to suit the +situation. + + If your document contains nontrivial examples of program code, we +recommend releasing these examples in parallel under your choice of +free software license, such as the GNU General Public License, to +permit their use in free software. + + +File: gawkinet.info, Node: Index, Prev: GNU Free Documentation License, Up: Top + +Index +***** + + +* Menu: + +* /inet/ files (gawk): Gawk Special Files. (line 34) +* /inet/raw special files (gawk): File /inet/raw. (line 6) +* /inet/tcp special files (gawk): File /inet/tcp. (line 6) +* /inet/udp special files (gawk): File /inet/udp. (line 6) +* advanced features, network connections: Troubleshooting. (line 6) +* agent <1>: MOBAGWHO. (line 6) +* agent: Challenges. (line 76) +* AI: Challenges. (line 76) +* apache <1>: MOBAGWHO. (line 42) +* apache: WEBGRAB. (line 72) +* Bioinformatics: PROTBASE. (line 227) +* BLAST, Basic Local Alignment Search Tool: PROTBASE. (line 6) +* blocking: Making Connections. (line 35) +* Boutell, Thomas: STATIST. (line 6) +* CGI (Common Gateway Interface): MOBAGWHO. (line 42) +* CGI (Common Gateway Interface), dynamic web pages and: Web page. + (line 46) +* CGI (Common Gateway Interface), library: CGI Lib. (line 11) +* clients: Making Connections. (line 21) +* Clinton, Bill: Challenges. (line 59) +* Common Gateway Interface, See CGI: Web page. (line 46) +* Computational Biology: PROTBASE. (line 227) +* contest: Challenges. (line 6) +* cron utility: STOXPRED. (line 23) +* CSV format: STOXPRED. (line 128) +* dark corner, RAW protocol: File /inet/raw. (line 13) +* Dow Jones Industrial Index: STOXPRED. (line 44) +* ELIZA program: Simple Server. (line 11) +* email: Email. (line 11) +* FASTA/Pearson format: PROTBASE. (line 102) +* FDL (Free Documentation License): GNU Free Documentation License. + (line 6) +* filenames, for network access: Gawk Special Files. (line 29) +* files, /inet/ (gawk): Gawk Special Files. (line 34) +* files, /inet/raw (gawk): File /inet/raw. (line 6) +* files, /inet/tcp (gawk): File /inet/tcp. (line 6) +* files, /inet/udp (gawk): File /inet/udp. (line 6) +* finger utility: Setting Up. (line 22) +* Free Documentation License (FDL): GNU Free Documentation License. + (line 6) +* FTP (File Transfer Protocol): Basic Protocols. (line 29) +* gawk, networking: Using Networking. (line 6) +* gawk, networking, connections <1>: TCP Connecting. (line 6) +* gawk, networking, connections: Special File Fields. (line 49) +* gawk, networking, filenames: Gawk Special Files. (line 29) +* gawk, networking, See Also email: Email. (line 6) +* gawk, networking, service, establishing: Setting Up. (line 6) +* gawk, networking, troubleshooting: Caveats. (line 6) +* gawk, web and, See web service: Interacting Service. (line 6) +* getline command: TCP Connecting. (line 11) +* GETURL program: GETURL. (line 6) +* GIF image format <1>: STATIST. (line 6) +* GIF image format: Web page. (line 46) +* GNU Free Documentation License: GNU Free Documentation License. + (line 6) +* GNU/Linux <1>: REMCONF. (line 6) +* GNU/Linux <2>: Interacting. (line 27) +* GNU/Linux: Troubleshooting. (line 54) +* GNUPlot utility <1>: STATIST. (line 6) +* GNUPlot utility: Interacting Service. (line 189) +* Hoare, C.A.R. <1>: PROTBASE. (line 6) +* Hoare, C.A.R.: MOBAGWHO. (line 6) +* hostname field: Special File Fields. (line 29) +* HTML (Hypertext Markup Language): Web page. (line 30) +* HTTP (Hypertext Transfer Protocol) <1>: Web page. (line 6) +* HTTP (Hypertext Transfer Protocol): Basic Protocols. (line 29) +* HTTP (Hypertext Transfer Protocol), record separators and: Web page. + (line 30) +* HTTP server, core logic: Interacting Service. (line 6) +* Humphrys, Mark: Simple Server. (line 179) +* Hypertext Markup Language (HTML): Web page. (line 30) +* Hypertext Transfer Protocol, See HTTP: Web page. (line 6) +* image format: STATIST. (line 6) +* images, in web pages: Interacting Service. (line 189) +* images, retrieving over networks: Web page. (line 46) +* input/output, two-way, See Also gawk, networking: Gawk Special Files. + (line 19) +* Internet, See networks: Interacting. (line 48) +* JavaScript: STATIST. (line 56) +* Linux <1>: REMCONF. (line 6) +* Linux <2>: Interacting. (line 27) +* Linux: Troubleshooting. (line 54) +* Lisp: MOBAGWHO. (line 98) +* localport field: Gawk Special Files. (line 34) +* Loebner, Hugh: Challenges. (line 6) +* Loui, Ronald: Challenges. (line 76) +* MAZE: MAZE. (line 6) +* Microsoft Windows: WEBGRAB. (line 43) +* Microsoft Windows, networking: Troubleshooting. (line 54) +* Microsoft Windows, networking, ports: Setting Up. (line 37) +* MiniSQL: REMCONF. (line 111) +* MOBAGWHO program: MOBAGWHO. (line 6) +* NCBI, National Center for Biotechnology Information: PROTBASE. + (line 6) +* networks, gawk and: Using Networking. (line 6) +* networks, gawk and, connections <1>: TCP Connecting. (line 6) +* networks, gawk and, connections: Special File Fields. (line 49) +* networks, gawk and, filenames: Gawk Special Files. (line 29) +* networks, gawk and, See Also email: Email. (line 6) +* networks, gawk and, service, establishing: Setting Up. (line 6) +* networks, gawk and, troubleshooting: Caveats. (line 6) +* networks, ports, reserved: Setting Up. (line 37) +* networks, ports, specifying: Special File Fields. (line 18) +* networks, See Also web pages: PANIC. (line 6) +* Numerical Recipes: STATIST. (line 24) +* ORS variable, HTTP and: Web page. (line 30) +* ORS variable, POP and: Email. (line 36) +* PANIC program: PANIC. (line 6) +* Perl: Using Networking. (line 14) +* Perl, gawk networking and: Using Networking. (line 24) +* Perlis, Alan: MAZE. (line 6) +* pipes, networking and: TCP Connecting. (line 30) +* PNG image format <1>: STATIST. (line 6) +* PNG image format: Web page. (line 46) +* POP (Post Office Protocol): Email. (line 6) +* Post Office Protocol (POP): Email. (line 6) +* PostScript: STATIST. (line 138) +* PROLOG: Challenges. (line 76) +* PROTBASE: PROTBASE. (line 6) +* protocol field: Special File Fields. (line 11) +* PS image format: STATIST. (line 6) +* Python: Using Networking. (line 14) +* Python, gawk networking and: Using Networking. (line 24) +* RAW protocol: File /inet/raw. (line 6) +* record separators, HTTP and: Web page. (line 30) +* record separators, POP and: Email. (line 36) +* REMCONF program: REMCONF. (line 6) +* remoteport field: Gawk Special Files. (line 34) +* robot <1>: WEBGRAB. (line 6) +* robot: Challenges. (line 85) +* RS variable, HTTP and: Web page. (line 30) +* RS variable, POP and: Email. (line 36) +* servers <1>: Setting Up. (line 22) +* servers: Making Connections. (line 14) +* servers, as hosts: Special File Fields. (line 29) +* servers, HTTP: Interacting Service. (line 6) +* servers, web: Simple Server. (line 6) +* Simple Mail Transfer Protocol (SMTP): Email. (line 6) +* SMTP (Simple Mail Transfer Protocol) <1>: Email. (line 6) +* SMTP (Simple Mail Transfer Protocol): Basic Protocols. (line 29) +* SPAK utility: File /inet/raw. (line 21) +* STATIST program: STATIST. (line 6) +* STOXPRED program: STOXPRED. (line 6) +* synchronous communications: Making Connections. (line 35) +* Tcl/Tk: Using Networking. (line 14) +* Tcl/Tk, gawk and <1>: Some Applications and Techniques. + (line 22) +* Tcl/Tk, gawk and: Using Networking. (line 24) +* TCP (Transmission Control Protocol) <1>: File /inet/tcp. (line 6) +* TCP (Transmission Control Protocol): Using Networking. (line 29) +* TCP (Transmission Control Protocol), connection, establishing: TCP Connecting. + (line 6) +* TCP (Transmission Control Protocol), UDP and: Interacting. (line 48) +* TCP/IP, protocols, selecting: Special File Fields. (line 11) +* TCP/IP, sockets and: Gawk Special Files. (line 19) +* Transmission Control Protocol, See TCP: Using Networking. (line 29) +* troubleshooting, gawk, networks: Caveats. (line 6) +* troubleshooting, networks, connections: Troubleshooting. (line 6) +* troubleshooting, networks, timeouts: Caveats. (line 18) +* UDP (User Datagram Protocol): File /inet/udp. (line 6) +* UDP (User Datagram Protocol), TCP and: Interacting. (line 48) +* Unix, network ports and: Setting Up. (line 37) +* URLCHK program: URLCHK. (line 6) +* User Datagram Protocol, See UDP: File /inet/udp. (line 6) +* vertical bar (|), |& operator (I/O): TCP Connecting. (line 25) +* VRML: MAZE. (line 6) +* web browsers, See web service: Interacting Service. (line 6) +* web pages: Web page. (line 6) +* web pages, images in: Interacting Service. (line 189) +* web pages, retrieving: GETURL. (line 6) +* web servers: Simple Server. (line 6) +* web service <1>: PANIC. (line 6) +* web service: Primitive Service. (line 6) +* WEBGRAB program: WEBGRAB. (line 6) +* Weizenbaum, Joseph: Simple Server. (line 11) +* XBM image format: Interacting Service. (line 189) +* Yahoo! <1>: STOXPRED. (line 6) +* Yahoo!: REMCONF. (line 6) +* | (vertical bar), |& operator (I/O): TCP Connecting. (line 25) + + + +Tag Table: +Node: Top2007 +Node: Preface5697 +Node: Introduction7072 +Node: Stream Communications8098 +Node: Datagram Communications9271 +Node: The TCP/IP Protocols10902 +Ref: The TCP/IP Protocols-Footnote-111586 +Node: Basic Protocols11743 +Node: Ports13065 +Node: Making Connections14470 +Ref: Making Connections-Footnote-117051 +Ref: Making Connections-Footnote-217098 +Node: Using Networking17279 +Node: Gawk Special Files19633 +Node: Special File Fields21637 +Ref: table-inet-components25387 +Node: Comparing Protocols27299 +Node: File /inet/tcp27888 +Node: File /inet/udp28914 +Node: File /inet/raw30035 +Ref: File /inet/raw-Footnote-133068 +Node: TCP Connecting33148 +Node: Troubleshooting35486 +Ref: Troubleshooting-Footnote-138537 +Node: Interacting39081 +Node: Setting Up41811 +Node: Email45305 +Node: Web page47631 +Ref: Web page-Footnote-150436 +Node: Primitive Service50633 +Node: Interacting Service53367 +Ref: Interacting Service-Footnote-162496 +Node: CGI Lib62528 +Node: Simple Server69489 +Ref: Simple Server-Footnote-177219 +Node: Caveats77320 +Node: Challenges78463 +Node: Some Applications and Techniques87130 +Node: PANIC89587 +Node: GETURL91305 +Node: REMCONF93928 +Node: URLCHK99404 +Node: WEBGRAB103239 +Node: STATIST107689 +Ref: STATIST-Footnote-1119397 +Node: MAZE119842 +Node: MOBAGWHO126030 +Ref: MOBAGWHO-Footnote-1139974 +Node: STOXPRED140029 +Node: PROTBASE154284 +Node: Links167366 +Node: GNU Free Documentation License170800 +Node: Index193204 + +End Tag Table diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/missing_d/README b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/missing_d/README new file mode 100644 index 0000000..735889d --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/missing_d/README @@ -0,0 +1,14 @@ +Fri Aug 25 13:23:06 IDT 2006 +============================ + +The files memmove.c, mktime.c, snprintf.c, strerror.c, strftime.c, +strncasecmp.c, and system.c are copyright by the Free Software +Foundation. They are licensed under the GPL or the LGPL. See the +COPYING.LIB file in this directory and the COPYING file in the parent +directory for licensing information. + +All other files are public domain. + +Arnold Robbins +arnold@skeeve.com + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/test/README b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/test/README new file mode 100644 index 0000000..2343be2 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/test/README @@ -0,0 +1,18 @@ +Mon Jan 22 13:08:58 EST 1996 + +This directory contains the tests for gawk. The tests use the +following conventions. + +Given some aspect of gawk named `foo', there will be one or more +of the following files: + +foo.awk --- actual code for the test if not inline in the Makefile +foo.in --- the data for the test, if it needs data +foo.ok --- the expected results +_foo --- the actual results; generated at run time + +The _foo file will be left around if a test fails, allowing you to +compare actual and expected results, in case they differ. + +If they do differ (other than strftime.ok and _strftime!), send in a +bug report. See the manual for the bug report procedure. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/unsupported/atari/README.1st b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/unsupported/atari/README.1st new file mode 100644 index 0000000..a158cda --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/unsupported/atari/README.1st @@ -0,0 +1,5 @@ +Tue Nov 7 14:19:41 2000 + +The atari port is no longer supported. If you have an atari, +you are welcome to try and use the port here, but we no longer have +the hardware to test gawk on. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6/check.log b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6/check.log new file mode 100644 index 0000000..1baa05e --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6/check.log @@ -0,0 +1,1296 @@ +Making check in . +make[1]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6' wordt binnengegaan +make 'CFLAGS=-Wall -Wpointer-arith -pedantic -O3 -fms-extensions -mms-bitfields -fno-exceptions -fomit-frame-pointer -march=i386 -ffast-math -Wstrict-prototypes ' 'LDFLAGS=-Wl,-s -Wl,--force-exe-suffix -Wl,--enable-auto-import -Wl,--enable-runtime-pseudo-reloc -Wl,--allow-multiple-definition -Wl,--enable-stdcall-fixup -LD:/Progra~1/GnuWin32/lib -Wl,--major-image-version=3 -Wl,--minor-image-version=1 ' check-local +make[2]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6' wordt binnengegaan +make[2]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6' wordt verlaten +make[1]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6' wordt verlaten +Making check in awklib +make[1]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6/awklib' wordt binnengegaan +make[1]: Er is niets te doen voor 'check'. +make[1]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6/awklib' wordt verlaten +Making check in doc +make[1]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6/doc' wordt binnengegaan +make[1]: Er is niets te doen voor 'check'. +make[1]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6/doc' wordt verlaten +Making check in po +make[1]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6/po' wordt binnengegaan +make[1]: Er is niets te doen voor 'check'. +make[1]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6/po' wordt verlaten +Making check in test +make[1]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6/test' wordt binnengegaan + +Any output from "diff.exe --text" is bad news, although some differences +in floating point values are probably benign -- in particular, +some systems may omit a leading zero and the floating point +precision may lead to slightly different output in a few cases. + +Locale environment: + LC_ALL="C" LANG="C" + +======== Starting basic tests ======== +addcomma +1c1,15 +< 0 0.00 +--- +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ ¼¼¼ ½½½ ¾¾¾ +> (hard_LC_COLLATE) +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ ¼¼¼ ½½½ ¾¾¾ +> (hard_LC_COLLATE) +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ ¼¼¼ ½½½ ¾¾¾ +> (hard_LC_COLLATE) +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ ¼¼¼ ½½½ ¾¾¾ +> (hard_LC_COLLATE) +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ ¼¼¼ ½½½ ¾¾¾ +> (hard_LC_COLLATE) +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ ¼¼¼ ½½½ ¾¾¾ +> (hard_LC_COLLATE) +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ ¼¼¼ ½½½ ¾¾¾ +> (hard_LC_COLLATE) +> ,,, ... 0 0.00 +make[1]: [addcomma] Fout 1 (genegeerd) +anchgsub +1c1 +< This is a test, this is only a test. +--- +> This is a test, this is only a test. +make[1]: [anchgsub] Fout 1 (genegeerd) +argarray +arrayparm +arrayref +arrymem1 +arrayprm2 +arrayprm3 +arryref2 +arryref3 +arryref4 +arryref5 +arynasty +arynocls +aryprm1 +aryprm2 +aryprm3 +aryprm4 +aryprm5 +aryprm6 +aryprm7 +aryprm8 +arysubnm +asgext +awkpath +back89 +backgsub +childin +clobber +clsflnam +compare +compare2 +concat1 +concat2 +concat3 +concat4 +convfmt +datanonl +1c1 +< bleble@foo1.bh.pl deny +--- +> 000 111 222 333 444 555 666 777 888 999 AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ƒƒƒ ŠšŠ ŒœŒ ŽžŽ ššŠ œœŒ žžŽ ŸÿŸ ªªª ²²² ³³³ µµµ ¹¹¹ ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ 000 111 222 333 444 555 666 777 888 999 AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ƒƒƒ ŠšŠ ŒœŒ ŽžŽ ššŠ œœŒ žžŽ ŸÿŸ ªªª ²²² ³³³ µµµ ¹¹¹ ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ 000 111 222 333 444 555 666 777 888 999 AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ƒƒƒ ŠšŠ ŒœŒ ŽžŽ ššŠ œœŒ žžŽ ŸÿŸ ªªª ²²² ³³³ µµµ ¹¹¹ ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ 000 111 222 333 444 555 666 777 888 999 AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ƒƒƒ ŠšŠ ŒœŒ ŽžŽ ššŠ œœŒ žžŽ ŸÿŸ ªªª ²²² ³³³ µµµ ¹¹¹ ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ 000 111 222 333 444 555 666 777 888 999 AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ƒƒƒ ŠšŠ ŒœŒ ŽžŽ ššŠ œœŒ žžŽ ŸÿŸ ªªª ²²² ³³³ µµµ ¹¹¹ ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ 000 111 222 333 444 555 666 777 888 999 AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ƒƒƒ ŠšŠ ŒœŒ ŽžŽ ššŠ œœŒ žžŽ ŸÿŸ ªªª ²²² ³³³ µµµ ¹¹¹ ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ bleble@foo1.bh.pl deny +make[1]: [datanonl] Fout 1 (genegeerd) +defref +0a1 +> gawk: warning: `BINMODE' is a gawk extension
+make[1]: [defref] Fout 1 (genegeerd) +delarprm +delarpm2 +delfunc +dynlj +eofsplit +exitval1 +exitval2 +1c1,2 +< foo +--- +> read wordt niet herkend als een interne
+> of externe opdracht, programma of batchbestand.
+make[1]: [exitval2] Fout 1 (genegeerd) +fldchg +fldchgnf +fmtspcl +1,9c1,15 +< gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:10: warning: sqrt: called with negative argument -1
+< gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value NaN is out of range for `%x' format
+< gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value NaN is out of range for `%d' format
+< gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value NaN is out of range for `%x' format
+< gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value NaN is out of range for `%d' format
+< gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value Infinity is out of range for `%x' format
+< gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value Infinity is out of range for `%d' format
+< gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value Infinity is out of range for `%x' format
+< gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value Infinity is out of range for `%d' format
+--- +> gawk: warning: `BINMODE' is a gawk extension
+> gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:10: warning: sqrt: called with negative argument -1 +> sprintf(%x,NaN) = 8000000000000000 (!= NaN) +> sprintf(%d,NaN) = -NaN (!= NaN) +> sprintf(%x,NaN) = 8000000000000000 (!= NaN) +> sprintf(%d,NaN) = -NaN (!= NaN) +> gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value 1.#INF is out of range for `%x' format +> gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value 1.#INF is out of range for `%d' format +> sprintf(%f,Infinity) = Infinity (!= -Infinity) +> sprintf(%s,Infinity) = Infinity (!= -Infinity) +> sprintf(%g,Infinity) = Infinity (!= -Infinity) +> gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value -1.#INF is out of range for `%x' format +> sprintf(%x,Infinity) = Infinity (!= -Infinity) +> gawk: ../../gawk-3.1.6-src/test/fmtspcl.awk:6: warning: [s]printf: value -1.#INF is out of range for `%d' format +> sprintf(%d,Infinity) = Infinity (!= -Infinity) +make[1]: [fmtspcl] Fout 1 (genegeerd) +fmttest +fnamedat +fnarray +fnarray2 +2a3 +> errcount: 1 +make[1]: [fnarray2] Fout 1 (genegeerd) +fnarydel +fnaryscl +fnasgnm +fnmisc +2a3 +> errcount: 2 +make[1]: [fnmisc] Fout 1 (genegeerd) +fnparydl +fordel +forsimp +fsbs +1c1 +< 1 2 +--- +> \\\ \\\ \\\ 1 2 +make[1]: [fsbs] Fout 1 (genegeerd) +fsspcoln +1c1 +< b +--- +> ::: ::: ::: b +make[1]: [fsspcoln] Fout 1 (genegeerd) +fsrs +1c1,10 +< a b +--- +> +> +> +> +> +> +> +> +> +> a b +make[1]: [fsrs] Fout 1 (genegeerd) +fstabplus +funsemnl +funsmnam +funstack +0a1,21 +> SsS ssS TtT ttT RrR rrR IiI iiI NnN nnN GgG ggG PpP ppP RrR rrR EeE eeE AaA aaA MmM mmM BbB bbB LlL llL EeE eeE AaA aaA RrR rrR TtT ttT IiI iiI CcC ccC LlL llL EeE eeE {{{ === === """ ??? ??? {{{ === """ ^^^ ^^^ ^^^ ^^^ ^^^ ^^^ ^^^ ^^^ ^^^ ^^^ AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ ¼¼¼ ½½½ ¾¾¾ +> (hard_LC_COLLATE) +> ((( ))) ::: ,,, ;;; ... /// --- >>> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ ¼¼¼ ½½½ ¾¾¾ +> (hard_LC_COLLATE) +> >>> $$$ $$$ $$$ $$$ $$$ $$$ $$$ AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> +\ Geen witregel na einde bestand +make[1]: [funstack] Fout 1 (genegeerd) +getline +getline2 +getline3 +getlnbuf +getnr2tb +getnr2tm +gsubasgn +4a5 +> errcount: 2 +make[1]: [gsubasgn] Fout 1 (genegeerd) +gsubtest +gsubtst2 +gsubtst3 +gsubtst4 +gsubtst5 +1c1,3 +< ThisIsaTitleMyTitle +--- +> """ ### $$$ %%% &&& ((( ))) *** ,,, ... /// +> (hard_LC_COLLATE) +> \\\ ::: ;;; [[[ ]]] @@@ ??? ... ,,, $$$ ThisIsaTitleMyTitle +make[1]: [gsubtst5] Fout 1 (genegeerd) +hex +hsprint +2c2 +< %0|00045|00055|0002d|0012.68|001.27e+01|0000012.68| +--- +> %0|00045|00055|0002d| 12.68| 1.27e+01| 12.68| +4c4 +< %#0|00045|00055|0x02d|0012.68|001.27e+01|0000012.68| +--- +> %#0|00045|00055|0x02d| 12.68| 1.27e+01| 12.68| +6c6 +< % 0| 0045|00055|0002d| 012.68| 01.27e+01| 000012.68| +--- +> % 0| 0045|00055|0002d| 12.68| 1.27e+01| 12.68| +8c8 +< % #0| 0045|00055|0x02d| 012.68| 01.27e+01| 000012.68| +--- +> % #0| 0045|00055|0x02d| 12.68| 1.27e+01| 12.68| +10c10 +< %+0|+0045|00055|0002d|+012.68|+01.27e+01|+000012.68| +--- +> %+0|+0045|00055|0002d| +12.68| +1.27e+01| +12.68| +12c12 +< %+#0|+0045|00055|0x02d|+012.68|+01.27e+01|+000012.68| +--- +> %+#0|+0045|00055|0x02d| +12.68| +1.27e+01| +12.68| +14c14 +< %+ 0|+0045|00055|0002d|+012.68|+01.27e+01|+000012.68| +--- +> %+ 0|+0045|00055|0002d| +12.68| +1.27e+01| +12.68| +16c16 +< %+ #0|+0045|00055|0x02d|+012.68|+01.27e+01|+000012.68| +--- +> %+ #0|+0045|00055|0x02d| +12.68| +1.27e+01| +12.68| +35c35 +< %0|00zap|0000*|-000003|-003.46|-03.46e+00|-00003.457| +--- +> %0|00zap|0000*| -3| -3.46| -3.46e+00| -3.457| +37c37 +< %#0|00zap|0000*|-00003.|-003.46|-03.46e+00|-00003.457| +--- +> %#0|00zap|0000*| -3.| -3.46| -3.46e+00| -3.457| +39c39 +< % 0|00zap|0000*|-000003|-003.46|-03.46e+00|-00003.457| +--- +> % 0|00zap|0000*| -3| -3.46| -3.46e+00| -3.457| +41c41 +< % #0|00zap|0000*|-00003.|-003.46|-03.46e+00|-00003.457| +--- +> % #0|00zap|0000*| -3.| -3.46| -3.46e+00| -3.457| +43c43 +< %+0|00zap|0000*|-000003|-003.46|-03.46e+00|-00003.457| +--- +> %+0|00zap|0000*| -3| -3.46| -3.46e+00| -3.457| +45c45 +< %+#0|00zap|0000*|-00003.|-003.46|-03.46e+00|-00003.457| +--- +> %+#0|00zap|0000*| -3.| -3.46| -3.46e+00| -3.457| +47c47 +< %+ 0|00zap|0000*|-000003|-003.46|-03.46e+00|-00003.457| +--- +> %+ 0|00zap|0000*| -3| -3.46| -3.46e+00| -3.457| +49c49 +< %+ #0|00zap|0000*|-00003.|-003.46|-03.46e+00|-00003.457| +--- +> %+ #0|00zap|0000*| -3.| -3.46| -3.46e+00| -3.457| +make[1]: [hsprint] Fout 1 (genegeerd) +inputred +intest +intformat +intprec +iobug1 +leaddig +leadnl +1c1,10 +< Name is: Jane Doe +--- +> +> +> +> +> +> +> +> +> +> Name is: Jane Doe +make[1]: [leadnl] Fout 1 (genegeerd) +litoct +gawk: warning: `BINMODE' is a gawk extension
+1c1 +< no match +--- +> no match
+make[1]: [litoct] Fout 1 (genegeerd) +longsub +longwrds +1,21c1,4 +< 20 long words +< compatibility +< concatenated +< consistency +< definitions +< description +< distributing +< fistatements +< gawk-options +< gnu-specific +< identically +< implementation +< implementations +< information +< non-portable +< pattern-action +< pre-defined +< program-file +< program-text +< programming +< restrictions +--- +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> LC_ALL wordt niet herkend als een interne
+> of externe opdracht, programma of batchbestand.
+make[1]: [longwrds] Fout 1 (genegeerd) +manglprm +math +membug1 +messages +minusstr +mmap8k +mtchi18n +nasty +1,2c1,5 +< aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +< X +--- +> gawk: nasty.awk:79: fatal error: internal error +>
+> This application has requested the Runtime to terminate it in an unusual way. +> Please contact the application's support team for more information.
+> EXIT CODE: 3 +make[1]: [nasty] Fout 1 (genegeerd) +nasty2 +1,2c1,5 +< a = aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa, f() = X +< 123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123123 +--- +> gawk: nasty2.awk:20: fatal error: internal error +>
+> This application has requested the Runtime to terminate it in an unusual way. +> Please contact the application's support team for more information.
+> EXIT CODE: 3 +make[1]: [nasty2] Fout 1 (genegeerd) +negexp +nested +nfldstr +nfneg +nfset +nlfldsep +nlinstr +1c1,10 +< ok +--- +> +> +> +> +> +> +> +> +> +> ok +make[1]: [nlinstr] Fout 1 (genegeerd) +nlstrina +noeffect +0a1 +> gawk: warning: `BINMODE' is a gawk extension
+make[1]: [noeffect] Fout 1 (genegeerd) +nofile +nofmtch +0a1 +> gawk: warning: `BINMODE' is a gawk extension
+make[1]: [nofmtch] Fout 1 (genegeerd) +noloop1 +0a1 +> ''' +\ Geen witregel na einde bestand +make[1]: [noloop1] Fout 1 (genegeerd) +noloop2 +0a1 +> ''' +\ Geen witregel na einde bestand +make[1]: [noloop2] Fout 1 (genegeerd) +nonl +make[1]: [nonl] Fout 2 (genegeerd) +0a1 +> gawk: warning: `BINMODE' is a gawk extension
+1a3 +> gawk: nonl.awk:1: fatal: cannot open file `/dev/null' for reading (No such file or directory) +make[1]: [nonl] Fout 1 (genegeerd) +noparms +4a5 +> errcount: 3 +make[1]: [noparms] Fout 1 (genegeerd) +nors +nulrsend +1c1,10 +< 1 +--- +> +> +> +> +> +> +> +> +> +> 1 +2a12,21 +> +> +> +> +> +> +> +> +> +> +\ Geen witregel na einde bestand +make[1]: [nulrsend] Fout 1 (genegeerd) +numindex +numsubstr +octsub +ofmt +0a1,2 +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ ¼¼¼ ½½½ ¾¾¾ +> (hard_LC_COLLATE) +make[1]: [ofmt] Fout 1 (genegeerd) +ofmtbig +0a1,4 +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ ¼¼¼ ½½½ ¾¾¾ +> (hard_LC_COLLATE) +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +make[1]: [ofmtbig] Fout 1 (genegeerd) +ofmtfidl +ofmts +onlynl +0a1,10 +> +> +> +> +> +> +> +> +> +> +\ Geen witregel na einde bestand +make[1]: [onlynl] Fout 1 (genegeerd) +opasnidx +opasnslf +ovrflow1 +paramdup +2a3 +> errcount: 1 +make[1]: [paramdup] Fout 1 (genegeerd) +paramtyp +parse1 +parsefld +parseme +pcntplus +prdupval +prec +printf0 +1c1,2 +< X +--- +> gawk: warning: `BINMODE' is a gawk extension
+> X
+make[1]: [printf0] Fout 1 (genegeerd) +printf1 +prmarscl +prmreuse +prt1eval +1c1,5 +< 1 +--- +> gawk: prt1eval.awk:4: fatal error: internal error +>
+> This application has requested the Runtime to terminate it in an unusual way. +> Please contact the application's support team for more information.
+> EXIT CODE: 3 +make[1]: [prt1eval] Fout 1 (genegeerd) +prtoeval +2c2,6 +< partial line: 'A STRING' +--- +> gawk: prtoeval.awk:1: fatal error: internal error +>
+> This application has requested the Runtime to terminate it in an unusual way. +> Please contact the application's support team for more information.
+> EXIT CODE: 3 +make[1]: [prtoeval] Fout 1 (genegeerd) +psx96sub +rand +rebt8b1 +1c1 +< [an]*n bANas ANd ANases iAN cAN +--- +> aaA nnN aaA nnN úúÚ aaA úúÚ aaA nnN aaA úúÚ aaA nnN úúÚ aaA nnN aaA úúÚ aaA nnN úúÚ aaA nnN aaA úúÚ aaA nnN úúÚ [an]*n bANas ANd ANases iAN cAN +make[1]: [rebt8b1] Fout 1 (genegeerd) +rebt8b2 +1,18c1,18 +< [an\000]*n bANas ANd ANases iAN cAN +< match +< [an\001]*n bANas ANd ANases iAN cAN +< match +< [an\002]*n bANas ANd ANases iAN cAN +< match +< [an\003]*n bANas ANd ANases iAN cAN +< match +< [an\004]*n bANas ANd ANases iAN cAN +< match +< [an\005]*n bANas ANd ANases iAN cAN +< match +< [an\006]*n bANas ANd ANases iAN cAN +< match +< [an\007]*n bANas ANd ANases iAN cAN +< match +< [an\010]*n bANas ANd ANases iAN cAN +< match +--- +> aaA nnN +> aaA nnN +> aaA nnN [an\001]*n bANas ANd ANases iAN cAN +> aaA nnN match +> aaA nnN [an\002]*n bANas ANd ANases iAN cAN +> aaA nnN match +> aaA nnN [an\003]*n bANas ANd ANases iAN cAN +> aaA nnN match +> aaA nnN [an\004]*n bANas ANd ANases iAN cAN +> aaA nnN match +> aaA nnN [an\005]*n bANas ANd ANases iAN cAN +> aaA nnN match +> aaA nnN [an\006]*n bANas ANd ANases iAN cAN +> aaA nnN match +> aaA nnN [an\007]*n bANas ANd ANases iAN cAN +> aaA nnN match +> aaA nnN [an\010]*n bANas ANd ANases iAN cAN +> aaA nnN match +make[1]: [rebt8b2] Fout 1 (genegeerd) +redfilnm +regeq +reindops +0a1,2 +> 222 333 444 555 666 777 888 999 ²²² ³³³ +> (hard_LC_COLLATE) +make[1]: [reindops] Fout 1 (genegeerd) +reparse +resplit +rs +1c1,10 +< a b +--- +> +> +> +> +> +> +> +> +> +> a b +make[1]: [rs] Fout 1 (genegeerd) +rsnul1nl +1c1,10 +< This is... +--- +> +> +> +> +> +> +> +> +> +> This is... +make[1]: [rsnul1nl] Fout 1 (genegeerd) +rsnulbig +1c1,5 +< 16386 +--- +> aaA +> +> +> abcdefgh123456 +> 16395 +make[1]: [rsnulbig] Fout 1 (genegeerd) +rsnulbig2 +1c1,5 +< 2 +--- +> aaA +> +> +> abc +> 11 +make[1]: [rsnulbig2] Fout 1 (genegeerd) +rstest1 +1c1,19 +< 3 +--- +> +> +> +> +> +> +> +> +> +> ::: +> +> +> ::: +> +> +> ::: +> +> +> 3 +make[1]: [rstest1] Fout 1 (genegeerd) +rstest2 +1c1,19 +< a +--- +> +> +> +> +> +> +> +> +> +> \\\ +> +> +> \\\ +> +> +> \\\ +> +> +> a +make[1]: [rstest2] Fout 1 (genegeerd) +rstest3 +0a1,10 +> +> +> +> +> +> +> +> +> +> +\ Geen witregel na einde bestand +make[1]: [rstest3] Fout 1 (genegeerd) +rstest4 +1c1,10 +< y = <a> +--- +> +> +> +> +> +> +> +> +> +> y = <"a> +make[1]: [rstest4] Fout 1 (genegeerd) +rstest5 +1,3c1,12 +< foo +< baz +< bar +--- +> +> +> +> +> +> +> +> +> +> 'foo +> 'foo +> 'bar +make[1]: [rstest5] Fout 1 (genegeerd) +rswhite +1c1,10 +< < a b +--- +> +> +> +> +> +> +> +> +> +> < a b +make[1]: [rswhite] Fout 1 (genegeerd) +scalar +sclforin +sclifin +sortempty +splitargv +splitarr +splitdef +splitvar +splitwht +sprintfc +strcat1 +strtod +strnum1 +subamp +0a1,2 +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +make[1]: [subamp] Fout 1 (genegeerd) +subi18n +1c1 +< "directory" version="1.0" +--- +> === """ "directory" version="1.0" +make[1]: [subi18n] Fout 1 (genegeerd) +subsepnm +subslash +substr +swaplns +synerr1 +2a3 +> errcount: 1 +make[1]: [synerr1] Fout 1 (genegeerd) +synerr2 +2a3 +> errcount: 1 +make[1]: [synerr2] Fout 1 (genegeerd) +tradanch +gawk: warning: `BINMODE' is a gawk extension
+tweakfld +uninit2 +0a1 +> gawk: warning: `BINMODE' is a gawk extension
+make[1]: [uninit2] Fout 1 (genegeerd) +uninit3 +0a1 +> gawk: warning: `BINMODE' is a gawk extension
+make[1]: [uninit3] Fout 1 (genegeerd) +uninit4 +0a1 +> gawk: warning: `BINMODE' is a gawk extension
+make[1]: [uninit4] Fout 1 (genegeerd) +uninitialized +0a1 +> gawk: warning: `BINMODE' is a gawk extension
+make[1]: [uninitialized] Fout 1 (genegeerd) +unterm +wideidx +wideidx2 +widesub +1c1 +< "directory" version="1.0" +--- +> === """ "directory" version="1.0" +make[1]: [widesub] Fout 1 (genegeerd) +widesub2 +widesub3 +widesub4 +wjposer1 +1c1,10 +< %IH:exertion +--- +> +> +> +> +> +> +> +> +> +> %IH:exertion +make[1]: [wjposer1] Fout 1 (genegeerd) +zeroe0 +zeroflag +zero2 +======== Done with basic tests ======== +======== Starting Unix tests ======== +fflush +getlnhd +1,2c1 +< select * from user +< where Name = 'O\'Donell' +--- +> << niet verwacht op dit moment.
+make[1]: [getlnhd] Fout 1 (genegeerd) +localenl +1,5c1,105 +< LC_ALL=C passed +< LC_ALL=UNKNOWN passed +< LC_ALL=POSIX passed +< LC_ALL=en_US.ISO-8859-1 passed +< LC_ALL=en_US.UTF-8 passed +--- +> 222 +> +> +> 333 +> +> +> 444 +> +> +> 555 666 +> +> +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> 888 +> +> +> 999 +> +> +> LC_ALL=C passed +> 222 +> +> +> 333 +> +> +> 444 +> +> +> 555 666 +> +> +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> 888 +> +> +> 999 +> +> +> LC_ALL=UNKNOWN passed +> 222 +> +> +> 333 +> +> +> 444 +> +> +> 555 666 +> +> +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> 888 +> +> +> 999 +> +> +> LC_ALL=POSIX passed +> 222 +> +> +> 333 +> +> +> 444 +> +> +> 555 666 +> +> +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> 888 +> +> +> 999 +> +> +> LC_ALL=en_US.ISO-8859-1 passed +> 222 +> +> +> 333 +> +> +> 444 +> +> +> 555 666 +> +> +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> 888 +> +> +> 999 +> +> +> LC_ALL=en_US.UTF-8 passed +make[1]: [localenl] Fout 1 (genegeerd) +pid +1,2c1,2 +< PID ok +< PPID ok +--- +> Bad pid 4076, wanted 2852 +> Bad ppid 0, wanted 248 +make[1]: [pid] Fout 1 (genegeerd) +pipeio1 +pipeio2 +2c2 +< January .... +--- +> January .... +4c4 +< S M Tu W Th F S +--- +> S M Tu W Th F S +6c6 +< . . . . +--- +> . . . . +8c8 +< . . . . . .. .. +--- +> . . . . . .. .. +10c10 +< .. .. .. .. .. .. .. +--- +> .. .. .. .. .. .. .. +12c12 +< .. .. .. .. .. .. .. +--- +> .. .. .. .. .. .. .. +14c14 +< .. .. .. .. .. .. +--- +> .. .. .. .. .. .. +make[1]: [pipeio2] Fout 1 (genegeerd) +poundbang +space +strftlng +======== Done with Unix tests ======== +======== Starting gawk extension tests ======== +argtest +asort +asorti +backw +badargs +binmode1 +clos1way +1,26c1,2 +< got a +< got b +< got c +< got d +< got e +< got f +< got g +< got h +< got i +< got j +< got k +< got l +< got m +< got n +< got o +< got p +< got q +< got r +< got s +< got t +< got u +< got v +< got w +< got x +< got y +< got z +--- +> gawk: clos1way.awk:7: fatal: `|&' not supported +> EXIT CODE: 2 +make[1]: [clos1way] Fout 1 (genegeerd) +devfd +1,2c1,2 +< file on fd 4 +< file on fd 5 +--- +> gawk: cmd. line:1: fatal: can't stat fd 4 (Bad file descriptor) +> EXIT CODE: 2 +make[1]: [devfd] Fout 1 (genegeerd) +devfd1 +1,40c1,2 +< this is file f1, line 1 +< this is file f2, line 1 +< this is file f1, line 2 +< this is file f2, line 2 +< this is file f1, line 3 +< this is file f2, line 3 +< this is file f1, line 4 +< this is file f2, line 4 +< this is file f1, line 5 +< this is file f2, line 5 +< this is file f1, line 6 +< this is file f2, line 6 +< this is file f1, line 7 +< this is file f2, line 7 +< this is file f1, line 8 +< this is file f2, line 8 +< this is file f1, line 9 +< this is file f2, line 9 +< this is file f1, line 10 +< this is file f2, line 10 +< this is file f1, line 11 +< this is file f2, line 11 +< this is file f1, line 12 +< this is file f2, line 12 +< this is file f1, line 13 +< this is file f2, line 13 +< this is file f1, line 14 +< this is file f2, line 14 +< this is file f1, line 15 +< this is file f2, line 15 +< this is file f1, line 16 +< this is file f2, line 16 +< this is file f1, line 17 +< this is file f2, line 17 +< this is file f1, line 18 +< this is file f2, line 18 +< this is file f1, line 19 +< this is file f2, line 19 +< this is file f1, line 20 +< this is file f2, line 20 +--- +> gawk: ../../gawk-3.1.6-src/test/devfd1.awk:5: fatal: can't stat fd 4 (Bad file descriptor) +> EXIT CODE: 2 +make[1]: [devfd1] Fout 1 (genegeerd) +devfd2 +1,40c1,2 +< this is file f1, line 1 +< this is file f1, line 2 +< this is file f1, line 3 +< this is file f1, line 4 +< this is file f1, line 5 +< this is file f1, line 6 +< this is file f1, line 7 +< this is file f1, line 8 +< this is file f1, line 9 +< this is file f1, line 10 +< this is file f1, line 11 +< this is file f1, line 12 +< this is file f1, line 13 +< this is file f1, line 14 +< this is file f1, line 15 +< this is file f1, line 16 +< this is file f1, line 17 +< this is file f1, line 18 +< this is file f1, line 19 +< this is file f1, line 20 +< this is file f2, line 1 +< this is file f2, line 2 +< this is file f2, line 3 +< this is file f2, line 4 +< this is file f2, line 5 +< this is file f2, line 6 +< this is file f2, line 7 +< this is file f2, line 8 +< this is file f2, line 9 +< this is file f2, line 10 +< this is file f2, line 11 +< this is file f2, line 12 +< this is file f2, line 13 +< this is file f2, line 14 +< this is file f2, line 15 +< this is file f2, line 16 +< this is file f2, line 17 +< this is file f2, line 18 +< this is file f2, line 19 +< this is file f2, line 20 +--- +> gawk: cmd. line:1: fatal: can't stat fd 4 (Bad file descriptor) +> EXIT CODE: 2 +make[1]: [devfd2] Fout 1 (genegeerd) +double1 +double2 +fieldwdth +fsfwfs +fwtest +fwtest2 +gensub +gensub2 +gnuops2 +gnuops3 +gnureops +icasefs +1c1 +< aCa +--- +> ccC ccC ccC aCa +5,6c5,6 +< aCa +< aCa +--- +> xxX yyY aCa +> xxX yyY aCa +make[1]: [icasefs] Fout 1 (genegeerd) +icasers +1c1,10 +< 1111 +--- +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ ŠšŠ ŒœŒ ŽžŽ ŸÿŸ ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ +> +> +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ ŠšŠ ŒœŒ ŽžŽ ŸÿŸ ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ +> +> +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ ŠšŠ ŒœŒ ŽžŽ ŸÿŸ ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ +> +> +> 1111 +make[1]: [icasers] Fout 1 (genegeerd) +igncdym +1c1 +< 0 bar:This is foo +--- +> bbB aaA rrR 0 bar:This is foo +3c3 +< 9 bar:This is bar +--- +> bbB aaA rrR 9 bar:This is bar +make[1]: [igncdym] Fout 1 (genegeerd) +igncfs +0a1,6 +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ +> (hard_LC_COLLATE) +> AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ªªª ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ +> (hard_LC_COLLATE) +make[1]: [igncfs] Fout 1 (genegeerd) +ignrcase +1c1 +< xz +--- +> yyY xz +make[1]: [ignrcase] Fout 1 (genegeerd) +ignrcas2 +1c1 +< OK +--- +> 000 111 222 333 444 555 666 777 888 999 AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ƒƒƒ ŠšŠ ŒœŒ ŽžŽ ššŠ œœŒ žžŽ ŸÿŸ ªªª ²²² ³³³ µµµ ¹¹¹ ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ 000 111 222 333 444 555 666 777 888 999 AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ƒƒƒ ŠšŠ ŒœŒ ŽžŽ ššŠ œœŒ žžŽ ŸÿŸ ªªª ²²² ³³³ µµµ ¹¹¹ ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ 000 111 222 333 444 555 666 777 888 999 AaA BbB CcC DdD EeE FfF GgG HhH IiI JjJ KkK LlL MmM NnN OoO PpP QqQ RrR SsS TtT UuU VvV WwW XxX YyY ZzZ aaA bbB ccC ddD eeE ffF ggG hhH iiI jjJ kkK llL mmM nnN ooO ppP qqQ rrR ssS ttT uuU vvV wwW xxX yyY zzZ ƒƒƒ ŠšŠ ŒœŒ ŽžŽ ššŠ œœŒ žžŽ ŸÿŸ ªªª ²²² ³³³ µµµ ¹¹¹ ººº ÀàÀ ÁáÁ Ââ Ããà ÄäÄ ÅåÅ ÆæÆ ÇçÇ ÈèÈ ÉéÉ ÊêÊ ËëË ÌìÌ ÍíÍ ÎîÎ ÏïÏ ÐðÐ ÑñÑ ÒòÒ ÓóÓ ÔôÔ ÕõÕ ÖöÖ ØøØ ÙùÙ ÚúÚ ÛûÛ ÜüÜ ÝýÝ ÞþÞ ßßß ààÀ ááÁ ââ ããà ääÄ ååÅ ææÆ ççÇ èèÈ ééÉ êêÊ ëëË ììÌ ííÍ îîÎ ïïÏ ððÐ ññÑ òòÒ óóÓ ôôÔ õõÕ ööÖ øøØ ùùÙ úúÚ ûûÛ üüÜ ýýÝ þþÞ ÿÿŸ OK +make[1]: [ignrcas2] Fout 1 (genegeerd) +lint +lintold +16c16 +< done +--- +> aaA bbB done +make[1]: [lintold] Fout 1 (genegeerd) +match1 +match2 +manyfiles +nondec +nondec2 +posix +procinfs +printfbad1 +regx8bit +rebuf +1c1 +< 1 0 +--- +> ttT iiI ddD wwW vvV 1 0 +make[1]: [rebuf] Fout 1 (genegeerd) +reint +reint2 +1c1,4 +< 1 2 3 +--- +> 000 111 222 333 444 555 666 777 888 999 ²²² ³³³ ¹¹¹ +> +> +>
1 2 3 +make[1]: [reint2] Fout 1 (genegeerd) +rsstart1 +1c1 +< 2 +--- +> AaA 2 +make[1]: [rsstart1] Fout 1 (genegeerd) +rsstart2 +1c1 +< 2 +--- +> AaA xxX 2 +make[1]: [rsstart2] Fout 1 (genegeerd) +rsstart3 +1c1 +< 2 +--- +> AaA xxX 2 +make[1]: [rsstart3] Fout 1 (genegeerd) +rstest6 +1c1 +< ABCD +--- +> XxX YyY ZzZ ABCD +make[1]: [rstest6] Fout 1 (genegeerd) +shadow +0a1 +> gawk: warning: `BINMODE' is a gawk extension
+make[1]: [shadow] Fout 1 (genegeerd) +sort1 +strtonum +This test could fail on slow machines or on a minute boundary, +so if it does, double check the actual results: +strftime +whiny +======== Done with gawk extension tests ======== +make[2]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6/test' wordt binnengegaan +80 TESTS FAILED +make[2]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6/test' wordt verlaten +make[1]: Map '/cygdrive/j/Lang/gawk/3.1.6/gawk-3.1.6/test' wordt verlaten |