diff options
| author | Indrajith K L | 2022-12-03 17:00:20 +0530 |
|---|---|---|
| committer | Indrajith K L | 2022-12-03 17:00:20 +0530 |
| commit | f5c4671bfbad96bf346bd7e9a21fc4317b4959df (patch) | |
| tree | 2764fc62da58f2ba8da7ed341643fc359873142f /coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src | |
| download | cli-tools-windows-master.tar.gz cli-tools-windows-master.tar.bz2 cli-tools-windows-master.zip | |
Diffstat (limited to 'coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src')
35 files changed, 35144 insertions, 0 deletions
diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/ABOUT-NLS b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/ABOUT-NLS new file mode 100644 index 0000000..ec20977 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/ABOUT-NLS @@ -0,0 +1,1101 @@ +1 Notes on the Free Translation Project +*************************************** + +Free software is going international! The Free Translation Project is +a way to get maintainers of free software, translators, and users all +together, so that free software will gradually become able to speak many +languages. A few packages already provide translations for their +messages. + + If you found this `ABOUT-NLS' file inside a distribution, you may +assume that the distributed package does use GNU `gettext' internally, +itself available at your nearest GNU archive site. But you do _not_ +need to install GNU `gettext' prior to configuring, installing or using +this package with messages translated. + + Installers will find here some useful hints. These notes also +explain how users should proceed for getting the programs to use the +available translations. They tell how people wanting to contribute and +work on translations can contact the appropriate team. + + When reporting bugs in the `intl/' directory or bugs which may be +related to internationalization, you should tell about the version of +`gettext' which is used. The information can be found in the +`intl/VERSION' file, in internationalized packages. + +1.1 Quick configuration advice +============================== + +If you want to exploit the full power of internationalization, you +should configure it using + + ./configure --with-included-gettext + +to force usage of internationalizing routines provided within this +package, despite the existence of internationalizing capabilities in the +operating system where this package is being installed. So far, only +the `gettext' implementation in the GNU C library version 2 provides as +many features (such as locale alias, message inheritance, automatic +charset conversion or plural form handling) as the implementation here. +It is also not possible to offer this additional functionality on top +of a `catgets' implementation. Future versions of GNU `gettext' will +very likely convey even more functionality. So it might be a good idea +to change to GNU `gettext' as soon as possible. + + So you need _not_ provide this option if you are using GNU libc 2 or +you have installed a recent copy of the GNU gettext package with the +included `libintl'. + +1.2 INSTALL Matters +=================== + +Some packages are "localizable" when properly installed; the programs +they contain can be made to speak your own native language. Most such +packages use GNU `gettext'. Other packages have their own ways to +internationalization, predating GNU `gettext'. + + By default, this package will be installed to allow translation of +messages. It will automatically detect whether the system already +provides the GNU `gettext' functions. If not, the included GNU +`gettext' library will be used. This library is wholly contained +within this package, usually in the `intl/' subdirectory, so prior +installation of the GNU `gettext' package is _not_ required. +Installers may use special options at configuration time for changing +the default behaviour. The commands: + + ./configure --with-included-gettext + ./configure --disable-nls + +will, respectively, bypass any pre-existing `gettext' to use the +internationalizing routines provided within this package, or else, +_totally_ disable translation of messages. + + When you already have GNU `gettext' installed on your system and run +configure without an option for your new package, `configure' will +probably detect the previously built and installed `libintl.a' file and +will decide to use this. This might not be desirable. You should use +the more recent version of the GNU `gettext' library. I.e. if the file +`intl/VERSION' shows that the library which comes with this package is +more recent, you should use + + ./configure --with-included-gettext + +to prevent auto-detection. + + The configuration process will not test for the `catgets' function +and therefore it will not be used. The reason is that even an +emulation of `gettext' on top of `catgets' could not provide all the +extensions of the GNU `gettext' library. + + Internationalized packages usually have many `po/LL.po' files, where +LL gives an ISO 639 two-letter code identifying the language. Unless +translations have been forbidden at `configure' time by using the +`--disable-nls' switch, all available translations are installed +together with the package. However, the environment variable `LINGUAS' +may be set, prior to configuration, to limit the installed set. +`LINGUAS' should then contain a space separated list of two-letter +codes, stating which languages are allowed. + +1.3 Using This Package +====================== + +As a user, if your language has been installed for this package, you +only have to set the `LANG' environment variable to the appropriate +`LL_CC' combination. Here `LL' is an ISO 639 two-letter language code, +and `CC' is an ISO 3166 two-letter country code. For example, let's +suppose that you speak German and live in Germany. At the shell +prompt, merely execute `setenv LANG de_DE' (in `csh'), +`export LANG; LANG=de_DE' (in `sh') or `export LANG=de_DE' (in `bash'). +This can be done from your `.login' or `.profile' file, once and for +all. + + You might think that the country code specification is redundant. +But in fact, some languages have dialects in different countries. For +example, `de_AT' is used for Austria, and `pt_BR' for Brazil. The +country code serves to distinguish the dialects. + + The locale naming convention of `LL_CC', with `LL' denoting the +language and `CC' denoting the country, is the one use on systems based +on GNU libc. On other systems, some variations of this scheme are +used, such as `LL' or `LL_CC.ENCODING'. You can get the list of +locales supported by your system for your language by running the +command `locale -a | grep '^LL''. + + Not all programs have translations for all languages. By default, an +English message is shown in place of a nonexistent translation. If you +understand other languages, you can set up a priority list of languages. +This is done through a different environment variable, called +`LANGUAGE'. GNU `gettext' gives preference to `LANGUAGE' over `LANG' +for the purpose of message handling, but you still need to have `LANG' +set to the primary language; this is required by other parts of the +system libraries. For example, some Swedish users who would rather +read translations in German than English for when Swedish is not +available, set `LANGUAGE' to `sv:de' while leaving `LANG' to `sv_SE'. + + Special advice for Norwegian users: The language code for Norwegian +bokma*l changed from `no' to `nb' recently (in 2003). During the +transition period, while some message catalogs for this language are +installed under `nb' and some older ones under `no', it's recommended +for Norwegian users to set `LANGUAGE' to `nb:no' so that both newer and +older translations are used. + + In the `LANGUAGE' environment variable, but not in the `LANG' +environment variable, `LL_CC' combinations can be abbreviated as `LL' +to denote the language's main dialect. For example, `de' is equivalent +to `de_DE' (German as spoken in Germany), and `pt' to `pt_PT' +(Portuguese as spoken in Portugal) in this context. + +1.4 Translating Teams +===================== + +For the Free Translation Project to be a success, we need interested +people who like their own language and write it well, and who are also +able to synergize with other translators speaking the same language. +Each translation team has its own mailing list. The up-to-date list of +teams can be found at the Free Translation Project's homepage, +`http://www.iro.umontreal.ca/contrib/po/HTML/', in the "National teams" +area. + + If you'd like to volunteer to _work_ at translating messages, you +should become a member of the translating team for your own language. +The subscribing address is _not_ the same as the list itself, it has +`-request' appended. For example, speakers of Swedish can send a +message to `sv-request@li.org', having this message body: + + subscribe + + Keep in mind that team members are expected to participate +_actively_ in translations, or at solving translational difficulties, +rather than merely lurking around. If your team does not exist yet and +you want to start one, or if you are unsure about what to do or how to +get started, please write to `translation@iro.umontreal.ca' to reach the +coordinator for all translator teams. + + The English team is special. It works at improving and uniformizing +the terminology in use. Proven linguistic skills are praised more than +programming skills, here. + +1.5 Available Packages +====================== + +Languages are not equally supported in all packages. The following +matrix shows the current state of internationalization, as of October +2006. The matrix shows, in regard of each package, for which languages +PO files have been submitted to translation coordination, with a +translation percentage of at least 50%. + + Ready PO files af am ar az be bg bs ca cs cy da de el en en_GB eo + +----------------------------------------------------+ + GNUnet | [] | + a2ps | [] [] [] [] [] | + aegis | () | + ant-phone | () | + anubis | [] | + ap-utils | | + aspell | [] [] [] [] [] | + bash | [] [] [] | + batchelor | [] | + bfd | | + bibshelf | [] | + binutils | [] | + bison | [] [] | + bison-runtime | | + bluez-pin | [] [] [] [] [] | + cflow | [] | + clisp | [] [] | + console-tools | [] [] | + coreutils | [] [] [] | + cpio | | + cpplib | [] [] [] | + cryptonit | [] | + darkstat | [] () [] | + dialog | [] [] [] [] [] [] | + diffutils | [] [] [] [] [] [] | + doodle | [] | + e2fsprogs | [] [] | + enscript | [] [] [] [] | + error | [] [] [] [] | + fetchmail | [] [] () [] | + fileutils | [] [] | + findutils | [] [] [] | + flex | [] [] [] | + fslint | [] | + gas | | + gawk | [] [] [] | + gbiff | [] | + gcal | [] | + gcc | [] | + gettext-examples | [] [] [] [] [] | + gettext-runtime | [] [] [] [] [] | + gettext-tools | [] [] | + gimp-print | [] [] [] [] | + gip | [] | + gliv | [] | + glunarclock | [] | + gmult | [] [] | + gnubiff | () | + gnucash | () () [] | + gnucash-glossary | [] () | + gnuedu | | + gnulib | [] [] [] [] [] [] | + gnunet-gtk | | + gnutls | | + gpe-aerial | [] [] | + gpe-beam | [] [] | + gpe-calendar | | + gpe-clock | [] [] | + gpe-conf | [] [] | + gpe-contacts | | + gpe-edit | [] | + gpe-filemanager | | + gpe-go | [] | + gpe-login | [] [] | + gpe-ownerinfo | [] [] | + gpe-package | | + gpe-sketchbook | [] [] | + gpe-su | [] [] | + gpe-taskmanager | [] [] | + gpe-timesheet | [] | + gpe-today | [] [] | + gpe-todo | | + gphoto2 | [] [] [] [] | + gprof | [] [] | + gpsdrive | () () | + gramadoir | [] [] | + grep | [] [] [] [] [] [] | + gretl | | + gsasl | | + gss | | + gst-plugins | [] [] [] [] | + gst-plugins-base | [] [] [] | + gst-plugins-good | [] [] [] [] [] [] [] | + gstreamer | [] [] [] [] [] [] [] | + gtick | () | + gtkam | [] [] [] | + gtkorphan | [] [] | + gtkspell | [] [] [] [] | + gutenprint | [] | + hello | [] [] [] [] [] | + id-utils | [] [] | + impost | | + indent | [] [] [] | + iso_3166 | [] [] | + iso_3166_2 | | + iso_4217 | [] | + iso_639 | [] [] | + jpilot | [] | + jtag | | + jwhois | | + kbd | [] [] [] [] | + keytouch | | + keytouch-editor | | + keytouch-keyboa... | | + latrine | () | + ld | [] | + leafpad | [] [] [] [] [] | + libc | [] [] [] [] [] | + libexif | [] | + libextractor | [] | + libgpewidget | [] [] [] | + libgpg-error | [] | + libgphoto2 | [] [] | + libgphoto2_port | [] [] | + libgsasl | | + libiconv | [] [] | + libidn | [] [] | + lifelines | [] () | + lilypond | [] | + lingoteach | | + lynx | [] [] [] [] | + m4 | [] [] [] [] | + mailutils | [] | + make | [] [] | + man-db | [] () [] [] | + minicom | [] [] [] | + mysecretdiary | [] [] | + nano | [] [] [] | + nano_1_0 | [] () [] [] | + opcodes | [] | + parted | | + pilot-qof | [] | + psmisc | [] | + pwdutils | | + python | | + qof | | + radius | [] | + recode | [] [] [] [] [] [] | + rpm | [] [] | + screem | | + scrollkeeper | [] [] [] [] [] [] [] [] | + sed | [] [] [] | + sh-utils | [] [] | + shared-mime-info | [] [] [] [] | + sharutils | [] [] [] [] [] [] | + shishi | | + silky | | + skencil | [] () | + sketch | [] () | + solfege | | + soundtracker | [] [] | + sp | [] | + stardict | [] | + system-tools-ba... | [] [] [] [] [] [] [] [] [] | + tar | [] | + texinfo | [] [] [] | + textutils | [] [] [] | + tin | () () | + tp-robot | [] | + tuxpaint | [] [] [] [] [] | + unicode-han-tra... | | + unicode-transla... | | + util-linux | [] [] [] [] | + vorbis-tools | [] [] [] [] | + wastesedge | () | + wdiff | [] [] [] [] | + wget | [] [] | + xchat | [] [] [] [] [] [] | + xkeyboard-config | | + xpad | [] [] | + +----------------------------------------------------+ + af am ar az be bg bs ca cs cy da de el en en_GB eo + 10 0 1 2 9 22 1 42 41 2 60 95 16 1 17 16 + + es et eu fa fi fr ga gl gu he hi hr hu id is it + +--------------------------------------------------+ + GNUnet | | + a2ps | [] [] [] () | + aegis | | + ant-phone | [] | + anubis | [] | + ap-utils | [] [] | + aspell | [] [] [] | + bash | [] [] [] | + batchelor | [] [] | + bfd | [] | + bibshelf | [] [] [] | + binutils | [] [] [] | + bison | [] [] [] [] [] [] | + bison-runtime | [] [] [] [] [] | + bluez-pin | [] [] [] [] [] | + cflow | [] | + clisp | [] [] | + console-tools | | + coreutils | [] [] [] [] [] [] | + cpio | [] [] [] | + cpplib | [] [] | + cryptonit | [] | + darkstat | [] () [] [] [] | + dialog | [] [] [] [] [] [] [] [] | + diffutils | [] [] [] [] [] [] [] [] [] | + doodle | [] [] | + e2fsprogs | [] [] [] | + enscript | [] [] [] | + error | [] [] [] [] [] | + fetchmail | [] | + fileutils | [] [] [] [] [] [] | + findutils | [] [] [] [] | + flex | [] [] [] | + fslint | [] | + gas | [] [] | + gawk | [] [] [] [] | + gbiff | [] | + gcal | [] [] | + gcc | [] | + gettext-examples | [] [] [] [] [] [] | + gettext-runtime | [] [] [] [] [] [] | + gettext-tools | [] [] [] | + gimp-print | [] [] | + gip | [] [] [] | + gliv | () | + glunarclock | [] [] [] | + gmult | [] [] [] | + gnubiff | () () | + gnucash | () () () | + gnucash-glossary | [] [] | + gnuedu | [] | + gnulib | [] [] [] [] [] [] [] [] | + gnunet-gtk | | + gnutls | | + gpe-aerial | [] [] | + gpe-beam | [] [] | + gpe-calendar | | + gpe-clock | [] [] [] [] | + gpe-conf | [] | + gpe-contacts | [] [] | + gpe-edit | [] [] [] [] | + gpe-filemanager | [] | + gpe-go | [] [] [] | + gpe-login | [] [] [] | + gpe-ownerinfo | [] [] [] [] [] | + gpe-package | [] | + gpe-sketchbook | [] [] | + gpe-su | [] [] [] [] | + gpe-taskmanager | [] [] [] | + gpe-timesheet | [] [] [] [] | + gpe-today | [] [] [] [] | + gpe-todo | [] | + gphoto2 | [] [] [] [] [] | + gprof | [] [] [] [] | + gpsdrive | () () [] () | + gramadoir | [] [] | + grep | [] [] [] [] [] [] [] [] [] [] [] [] | + gretl | [] [] [] | + gsasl | [] [] | + gss | [] | + gst-plugins | [] [] [] | + gst-plugins-base | [] [] | + gst-plugins-good | [] [] [] | + gstreamer | [] [] [] | + gtick | [] | + gtkam | [] [] [] [] | + gtkorphan | [] [] | + gtkspell | [] [] [] [] [] [] | + gutenprint | [] | + hello | [] [] [] [] [] [] [] [] [] [] [] [] [] | + id-utils | [] [] [] [] [] | + impost | [] [] | + indent | [] [] [] [] [] [] [] [] [] [] | + iso_3166 | [] [] [] | + iso_3166_2 | [] | + iso_4217 | [] [] [] [] | + iso_639 | [] [] [] [] [] | + jpilot | [] [] | + jtag | [] | + jwhois | [] [] [] [] [] | + kbd | [] [] | + keytouch | [] | + keytouch-editor | [] | + keytouch-keyboa... | [] | + latrine | [] [] [] | + ld | [] [] | + leafpad | [] [] [] [] [] [] | + libc | [] [] [] [] [] | + libexif | [] | + libextractor | [] | + libgpewidget | [] [] [] [] [] | + libgpg-error | | + libgphoto2 | [] [] [] | + libgphoto2_port | [] [] | + libgsasl | [] [] | + libiconv | [] [] | + libidn | [] [] | + lifelines | () | + lilypond | [] | + lingoteach | [] [] [] | + lynx | [] [] [] | + m4 | [] [] [] [] | + mailutils | [] [] | + make | [] [] [] [] [] [] [] [] | + man-db | () | + minicom | [] [] [] [] | + mysecretdiary | [] [] [] | + nano | [] [] [] [] [] [] | + nano_1_0 | [] [] [] [] [] | + opcodes | [] [] [] [] | + parted | [] [] [] [] | + pilot-qof | | + psmisc | [] [] [] | + pwdutils | | + python | | + qof | [] | + radius | [] [] | + recode | [] [] [] [] [] [] [] [] | + rpm | [] [] | + screem | | + scrollkeeper | [] [] [] | + sed | [] [] [] [] [] | + sh-utils | [] [] [] [] [] [] [] | + shared-mime-info | [] [] [] [] [] [] | + sharutils | [] [] [] [] [] [] [] [] | + shishi | | + silky | [] | + skencil | [] [] | + sketch | [] [] | + solfege | [] | + soundtracker | [] [] [] | + sp | [] | + stardict | [] | + system-tools-ba... | [] [] [] [] [] [] [] [] | + tar | [] [] [] [] [] [] [] | + texinfo | [] [] | + textutils | [] [] [] [] [] | + tin | [] () | + tp-robot | [] [] [] [] | + tuxpaint | [] [] | + unicode-han-tra... | | + unicode-transla... | [] [] | + util-linux | [] [] [] [] [] [] [] | + vorbis-tools | [] [] | + wastesedge | () | + wdiff | [] [] [] [] [] [] [] [] | + wget | [] [] [] [] [] [] [] [] | + xchat | [] [] [] [] [] [] [] [] | + xkeyboard-config | [] [] [] [] | + xpad | [] [] [] | + +--------------------------------------------------+ + es et eu fa fi fr ga gl gu he hi hr hu id is it + 88 22 14 2 40 115 61 14 1 8 1 6 59 31 0 52 + + ja ko ku ky lg lt lv mk mn ms mt nb ne nl nn no + +-------------------------------------------------+ + GNUnet | | + a2ps | () [] [] () | + aegis | () | + ant-phone | [] | + anubis | [] [] [] | + ap-utils | [] | + aspell | [] [] | + bash | [] | + batchelor | [] [] | + bfd | | + bibshelf | [] | + binutils | | + bison | [] [] [] | + bison-runtime | [] [] [] | + bluez-pin | [] [] [] | + cflow | | + clisp | [] | + console-tools | | + coreutils | [] | + cpio | | + cpplib | [] | + cryptonit | [] | + darkstat | [] [] | + dialog | [] [] | + diffutils | [] [] [] | + doodle | | + e2fsprogs | [] | + enscript | [] | + error | [] | + fetchmail | [] [] | + fileutils | [] [] | + findutils | [] | + flex | [] [] | + fslint | [] [] | + gas | | + gawk | [] [] | + gbiff | [] | + gcal | | + gcc | | + gettext-examples | [] [] | + gettext-runtime | [] [] [] | + gettext-tools | [] [] | + gimp-print | [] [] | + gip | [] [] | + gliv | [] | + glunarclock | [] [] | + gmult | [] [] | + gnubiff | | + gnucash | () () | + gnucash-glossary | [] | + gnuedu | | + gnulib | [] [] [] [] | + gnunet-gtk | | + gnutls | | + gpe-aerial | [] | + gpe-beam | [] | + gpe-calendar | [] | + gpe-clock | [] [] [] | + gpe-conf | [] [] | + gpe-contacts | [] | + gpe-edit | [] [] [] | + gpe-filemanager | [] [] | + gpe-go | [] [] [] | + gpe-login | [] [] [] | + gpe-ownerinfo | [] [] | + gpe-package | [] [] | + gpe-sketchbook | [] [] | + gpe-su | [] [] [] | + gpe-taskmanager | [] [] [] [] | + gpe-timesheet | [] | + gpe-today | [] [] | + gpe-todo | [] | + gphoto2 | [] [] | + gprof | | + gpsdrive | () () () | + gramadoir | () | + grep | [] [] [] [] | + gretl | | + gsasl | [] | + gss | | + gst-plugins | [] | + gst-plugins-base | | + gst-plugins-good | [] | + gstreamer | [] | + gtick | | + gtkam | [] | + gtkorphan | [] | + gtkspell | [] [] | + gutenprint | | + hello | [] [] [] [] [] [] | + id-utils | [] | + impost | | + indent | [] [] | + iso_3166 | [] | + iso_3166_2 | [] | + iso_4217 | [] [] [] | + iso_639 | [] [] | + jpilot | () () () | + jtag | | + jwhois | [] | + kbd | [] | + keytouch | [] | + keytouch-editor | | + keytouch-keyboa... | | + latrine | [] | + ld | | + leafpad | [] [] | + libc | [] [] [] [] [] | + libexif | | + libextractor | | + libgpewidget | [] | + libgpg-error | | + libgphoto2 | [] | + libgphoto2_port | [] | + libgsasl | [] | + libiconv | | + libidn | [] [] | + lifelines | [] | + lilypond | | + lingoteach | [] | + lynx | [] [] | + m4 | [] [] | + mailutils | | + make | [] [] [] | + man-db | () | + minicom | [] | + mysecretdiary | [] | + nano | [] [] [] | + nano_1_0 | [] [] [] | + opcodes | [] | + parted | [] [] | + pilot-qof | | + psmisc | [] [] [] | + pwdutils | | + python | | + qof | | + radius | | + recode | [] | + rpm | [] [] | + screem | [] | + scrollkeeper | [] [] [] [] | + sed | [] [] | + sh-utils | [] [] | + shared-mime-info | [] [] [] [] [] | + sharutils | [] [] | + shishi | | + silky | [] | + skencil | | + sketch | | + solfege | | + soundtracker | | + sp | () | + stardict | [] [] | + system-tools-ba... | [] [] [] [] | + tar | [] [] [] | + texinfo | [] [] [] | + textutils | [] [] [] | + tin | | + tp-robot | [] | + tuxpaint | [] | + unicode-han-tra... | | + unicode-transla... | | + util-linux | [] [] | + vorbis-tools | [] | + wastesedge | [] | + wdiff | [] [] | + wget | [] [] | + xchat | [] [] [] [] | + xkeyboard-config | [] | + xpad | [] [] [] | + +-------------------------------------------------+ + ja ko ku ky lg lt lv mk mn ms mt nb ne nl nn no + 52 24 2 2 1 3 0 2 3 21 0 15 1 97 5 1 + + nso or pa pl pt pt_BR rm ro ru rw sk sl sq sr sv ta + +------------------------------------------------------+ + GNUnet | | + a2ps | () [] [] [] [] [] [] | + aegis | () () | + ant-phone | [] [] | + anubis | [] [] [] | + ap-utils | () | + aspell | [] [] | + bash | [] [] [] | + batchelor | [] [] | + bfd | | + bibshelf | [] | + binutils | [] [] | + bison | [] [] [] [] [] | + bison-runtime | [] [] [] [] | + bluez-pin | [] [] [] [] [] [] [] [] [] | + cflow | [] | + clisp | [] | + console-tools | [] | + coreutils | [] [] [] [] | + cpio | [] [] [] | + cpplib | [] | + cryptonit | [] [] | + darkstat | [] [] [] [] [] [] | + dialog | [] [] [] [] [] [] [] [] [] | + diffutils | [] [] [] [] [] [] | + doodle | [] [] | + e2fsprogs | [] [] | + enscript | [] [] [] [] [] | + error | [] [] [] [] | + fetchmail | [] [] [] | + fileutils | [] [] [] [] [] | + findutils | [] [] [] [] [] [] | + flex | [] [] [] [] [] | + fslint | [] [] [] [] | + gas | | + gawk | [] [] [] [] | + gbiff | [] | + gcal | [] | + gcc | [] | + gettext-examples | [] [] [] [] [] [] [] [] | + gettext-runtime | [] [] [] [] [] [] [] [] | + gettext-tools | [] [] [] [] [] [] [] | + gimp-print | [] [] | + gip | [] [] [] [] | + gliv | [] [] [] [] | + glunarclock | [] [] [] [] [] [] | + gmult | [] [] [] [] | + gnubiff | () | + gnucash | () [] | + gnucash-glossary | [] [] [] | + gnuedu | | + gnulib | [] [] [] [] [] | + gnunet-gtk | [] | + gnutls | [] [] | + gpe-aerial | [] [] [] [] [] [] [] | + gpe-beam | [] [] [] [] [] [] [] | + gpe-calendar | [] | + gpe-clock | [] [] [] [] [] [] [] [] | + gpe-conf | [] [] [] [] [] [] [] | + gpe-contacts | [] [] [] [] [] | + gpe-edit | [] [] [] [] [] [] [] [] | + gpe-filemanager | [] [] | + gpe-go | [] [] [] [] [] [] | + gpe-login | [] [] [] [] [] [] [] [] | + gpe-ownerinfo | [] [] [] [] [] [] [] [] | + gpe-package | [] [] | + gpe-sketchbook | [] [] [] [] [] [] [] [] | + gpe-su | [] [] [] [] [] [] [] [] | + gpe-taskmanager | [] [] [] [] [] [] [] [] | + gpe-timesheet | [] [] [] [] [] [] [] [] | + gpe-today | [] [] [] [] [] [] [] [] | + gpe-todo | [] [] [] [] | + gphoto2 | [] [] [] [] [] | + gprof | [] [] [] | + gpsdrive | [] [] [] | + gramadoir | [] [] | + grep | [] [] [] [] [] [] [] [] | + gretl | [] | + gsasl | [] [] [] | + gss | [] [] [] | + gst-plugins | [] [] [] [] | + gst-plugins-base | [] | + gst-plugins-good | [] [] [] [] | + gstreamer | [] [] [] | + gtick | [] | + gtkam | [] [] [] [] | + gtkorphan | [] | + gtkspell | [] [] [] [] [] [] [] [] | + gutenprint | [] | + hello | [] [] [] [] [] [] [] [] | + id-utils | [] [] [] [] | + impost | [] | + indent | [] [] [] [] [] [] | + iso_3166 | [] [] [] [] [] [] | + iso_3166_2 | | + iso_4217 | [] [] [] [] | + iso_639 | [] [] [] [] | + jpilot | | + jtag | [] | + jwhois | [] [] [] [] | + kbd | [] [] [] | + keytouch | [] | + keytouch-editor | [] | + keytouch-keyboa... | [] | + latrine | [] [] | + ld | [] | + leafpad | [] [] [] [] [] [] | + libc | [] [] [] [] [] | + libexif | [] | + libextractor | [] [] | + libgpewidget | [] [] [] [] [] [] [] | + libgpg-error | [] [] | + libgphoto2 | [] | + libgphoto2_port | [] [] [] | + libgsasl | [] [] [] [] | + libiconv | [] [] | + libidn | [] [] () | + lifelines | [] [] | + lilypond | | + lingoteach | [] | + lynx | [] [] [] | + m4 | [] [] [] [] [] | + mailutils | [] [] [] [] | + make | [] [] [] [] | + man-db | [] [] | + minicom | [] [] [] [] [] | + mysecretdiary | [] [] [] [] | + nano | [] [] [] | + nano_1_0 | [] [] [] [] | + opcodes | [] [] | + parted | [] | + pilot-qof | [] | + psmisc | [] [] | + pwdutils | [] [] | + python | | + qof | [] [] | + radius | [] [] | + recode | [] [] [] [] [] [] [] | + rpm | [] [] [] [] | + screem | | + scrollkeeper | [] [] [] [] [] [] [] | + sed | [] [] [] [] [] [] [] [] [] | + sh-utils | [] [] [] | + shared-mime-info | [] [] [] [] [] | + sharutils | [] [] [] [] | + shishi | [] | + silky | [] | + skencil | [] [] [] | + sketch | [] [] [] | + solfege | [] | + soundtracker | [] [] | + sp | | + stardict | [] [] [] | + system-tools-ba... | [] [] [] [] [] [] [] [] [] | + tar | [] [] [] [] [] | + texinfo | [] [] [] [] | + textutils | [] [] [] | + tin | () | + tp-robot | [] | + tuxpaint | [] [] [] [] [] | + unicode-han-tra... | | + unicode-transla... | | + util-linux | [] [] [] [] | + vorbis-tools | [] [] | + wastesedge | | + wdiff | [] [] [] [] [] [] | + wget | [] [] [] [] | + xchat | [] [] [] [] [] [] [] | + xkeyboard-config | [] [] | + xpad | [] [] [] | + +------------------------------------------------------+ + nso or pa pl pt pt_BR rm ro ru rw sk sl sq sr sv ta + 0 2 3 58 30 54 5 73 72 4 40 46 11 50 128 2 + + tg th tk tr uk ven vi wa xh zh_CN zh_HK zh_TW zu + +---------------------------------------------------+ + GNUnet | [] | 2 + a2ps | [] [] [] | 19 + aegis | | 0 + ant-phone | [] [] | 6 + anubis | [] [] [] | 11 + ap-utils | () [] | 4 + aspell | [] [] [] | 15 + bash | [] | 11 + batchelor | [] [] | 9 + bfd | | 1 + bibshelf | [] | 7 + binutils | [] [] [] | 9 + bison | [] [] [] | 19 + bison-runtime | [] [] [] | 15 + bluez-pin | [] [] [] [] [] [] | 28 + cflow | [] [] | 5 + clisp | | 6 + console-tools | [] [] | 5 + coreutils | [] [] | 16 + cpio | [] [] [] | 9 + cpplib | [] [] [] [] | 11 + cryptonit | | 5 + darkstat | [] () () | 15 + dialog | [] [] [] [] [] | 30 + diffutils | [] [] [] [] | 28 + doodle | [] | 6 + e2fsprogs | [] [] | 10 + enscript | [] [] [] | 16 + error | [] [] [] [] | 18 + fetchmail | [] [] | 12 + fileutils | [] [] [] | 18 + findutils | [] [] [] | 17 + flex | [] [] | 15 + fslint | [] | 9 + gas | [] | 3 + gawk | [] [] | 15 + gbiff | [] | 5 + gcal | [] | 5 + gcc | [] [] [] | 6 + gettext-examples | [] [] [] [] [] [] | 27 + gettext-runtime | [] [] [] [] [] [] | 28 + gettext-tools | [] [] [] [] [] | 19 + gimp-print | [] [] | 12 + gip | [] [] | 12 + gliv | [] [] | 8 + glunarclock | [] [] [] | 15 + gmult | [] [] [] [] | 15 + gnubiff | [] | 1 + gnucash | () | 2 + gnucash-glossary | [] [] | 9 + gnuedu | [] | 2 + gnulib | [] [] [] [] [] | 28 + gnunet-gtk | | 1 + gnutls | | 2 + gpe-aerial | [] [] | 14 + gpe-beam | [] [] | 14 + gpe-calendar | [] | 3 + gpe-clock | [] [] [] [] | 21 + gpe-conf | [] [] | 14 + gpe-contacts | [] [] | 10 + gpe-edit | [] [] [] [] | 20 + gpe-filemanager | [] | 6 + gpe-go | [] [] | 15 + gpe-login | [] [] [] [] [] | 21 + gpe-ownerinfo | [] [] [] [] | 21 + gpe-package | [] | 6 + gpe-sketchbook | [] [] | 16 + gpe-su | [] [] [] | 20 + gpe-taskmanager | [] [] [] | 20 + gpe-timesheet | [] [] [] [] | 18 + gpe-today | [] [] [] [] [] | 21 + gpe-todo | [] | 7 + gphoto2 | [] [] [] [] | 20 + gprof | [] [] | 11 + gpsdrive | | 4 + gramadoir | [] | 7 + grep | [] [] [] [] | 34 + gretl | | 4 + gsasl | [] [] | 8 + gss | [] | 5 + gst-plugins | [] [] [] | 15 + gst-plugins-base | [] [] [] | 9 + gst-plugins-good | [] [] [] [] [] | 20 + gstreamer | [] [] [] | 17 + gtick | [] | 3 + gtkam | [] | 13 + gtkorphan | [] | 7 + gtkspell | [] [] [] [] [] [] | 26 + gutenprint | | 3 + hello | [] [] [] [] [] | 37 + id-utils | [] [] | 14 + impost | [] | 4 + indent | [] [] [] [] | 25 + iso_3166 | [] [] [] [] | 16 + iso_3166_2 | | 2 + iso_4217 | [] [] | 14 + iso_639 | [] | 14 + jpilot | [] [] [] [] | 7 + jtag | [] | 3 + jwhois | [] [] [] | 13 + kbd | [] [] | 12 + keytouch | [] | 4 + keytouch-editor | | 2 + keytouch-keyboa... | [] | 3 + latrine | [] [] | 8 + ld | [] [] [] [] | 8 + leafpad | [] [] [] [] | 23 + libc | [] [] [] | 23 + libexif | [] | 4 + libextractor | [] | 5 + libgpewidget | [] [] [] | 19 + libgpg-error | [] | 4 + libgphoto2 | [] | 8 + libgphoto2_port | [] [] [] | 11 + libgsasl | [] | 8 + libiconv | [] | 7 + libidn | [] [] | 10 + lifelines | | 4 + lilypond | | 2 + lingoteach | [] | 6 + lynx | [] [] [] | 15 + m4 | [] [] [] | 18 + mailutils | [] | 8 + make | [] [] [] | 20 + man-db | [] | 6 + minicom | [] | 14 + mysecretdiary | [] [] | 12 + nano | [] [] | 17 + nano_1_0 | [] [] [] | 18 + opcodes | [] [] | 10 + parted | [] [] [] | 10 + pilot-qof | [] | 3 + psmisc | [] | 10 + pwdutils | [] | 3 + python | | 0 + qof | [] | 4 + radius | [] | 6 + recode | [] [] [] | 25 + rpm | [] [] [] [] | 14 + screem | [] | 2 + scrollkeeper | [] [] [] [] | 26 + sed | [] [] [] | 22 + sh-utils | [] | 15 + shared-mime-info | [] [] [] [] | 24 + sharutils | [] [] [] | 23 + shishi | | 1 + silky | [] | 4 + skencil | [] | 7 + sketch | | 6 + solfege | | 2 + soundtracker | [] [] | 9 + sp | [] | 3 + stardict | [] [] [] [] | 11 + system-tools-ba... | [] [] [] [] [] [] [] | 37 + tar | [] [] [] [] | 20 + texinfo | [] [] [] | 15 + textutils | [] [] [] | 17 + tin | | 1 + tp-robot | [] [] [] | 10 + tuxpaint | [] [] [] | 16 + unicode-han-tra... | | 0 + unicode-transla... | | 2 + util-linux | [] [] [] | 20 + vorbis-tools | [] [] | 11 + wastesedge | | 1 + wdiff | [] [] | 22 + wget | [] [] [] | 19 + xchat | [] [] [] [] | 29 + xkeyboard-config | [] [] [] [] | 11 + xpad | [] [] [] | 14 + +---------------------------------------------------+ + 77 teams tg th tk tr uk ven vi wa xh zh_CN zh_HK zh_TW zu + 170 domains 0 1 1 77 39 0 136 10 1 48 5 54 0 2028 + + Some counters in the preceding matrix are higher than the number of +visible blocks let us expect. This is because a few extra PO files are +used for implementing regional variants of languages, or language +dialects. + + For a PO file in the matrix above to be effective, the package to +which it applies should also have been internationalized and +distributed as such by its maintainer. There might be an observable +lag between the mere existence a PO file and its wide availability in a +distribution. + + If October 2006 seems to be old, you may fetch a more recent copy of +this `ABOUT-NLS' file on most GNU archive sites. The most up-to-date +matrix with full percentage details can be found at +`http://www.iro.umontreal.ca/contrib/po/HTML/matrix.html'. + +1.6 Using `gettext' in new packages +=================================== + +If you are writing a freely available program and want to +internationalize it you are welcome to use GNU `gettext' in your +package. Of course you have to respect the GNU Library General Public +License which covers the use of the GNU `gettext' library. This means +in particular that even non-free programs can use `libintl' as a shared +library, whereas only free software can use `libintl' as a static +library or use modified versions of `libintl'. + + Once the sources are changed appropriately and the setup can handle +the use of `gettext' the only thing missing are the translations. The +Free Translation Project is also available for packages which are not +developed inside the GNU project. Therefore the information given above +applies also for every other Free Software Project. Contact +`translation@iro.umontreal.ca' to make the `.pot' files available to +the translation teams. + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/AUTHORS b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/AUTHORS new file mode 100644 index 0000000..fa9e7fe --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/AUTHORS @@ -0,0 +1,13 @@ + Copyright (C) 2006, 2007 Free Software Foundation, Inc. + + Copying and distribution of this file, with or without modification, + are permitted in any medium without royalty provided the copyright + notice and this notice are preserved. + +Gawk was written by Paul Rubin, and finished by Paul Finlason and +Richard Stallman. + +David Trueman and Arnold Robbins took it over, with David doing most +of the work to make it compatible with new awk. + +Circa 1994, Arnold Robbins took over maintenance. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/COPYING b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/COPYING new file mode 100644 index 0000000..94a9ed0 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/COPYING @@ -0,0 +1,674 @@ + GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. <http://fsf.org/> + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for +software and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. We, the Free Software Foundation, use the +GNU General Public License for most of our software; it applies also to +any other work released this way by its authors. You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you have +certain responsibilities if you distribute copies of the software, or if +you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the manufacturer +can do so. This is fundamentally incompatible with the aim of +protecting users' freedom to change the software. The systematic +pattern of such abuse occurs in the area of products for individuals to +use, which is precisely where it is most unacceptable. Therefore, we +have designed this version of the GPL to prohibit the practice for those +products. If such problems arise substantially in other domains, we +stand ready to extend this provision to those domains in future versions +of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + <one line to give the program's name and a brief idea of what it does.> + Copyright (C) <year> <name of author> + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see <http://www.gnu.org/licenses/>. + +Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + <program> Copyright (C) <year> <name of author> + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, your program's commands +might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU GPL, see +<http://www.gnu.org/licenses/>. + + The GNU General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, you +may consider it more useful to permit linking proprietary applications with +the library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. But first, please read +<http://www.gnu.org/philosophy/why-not-lgpl.html>. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/INSTALL b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/INSTALL new file mode 100644 index 0000000..5458714 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/INSTALL @@ -0,0 +1,234 @@ +Installation Instructions +************************* + +Copyright (C) 1994, 1995, 1996, 1999, 2000, 2001, 2002, 2004, 2005, +2006 Free Software Foundation, Inc. + +This file is free documentation; the Free Software Foundation gives +unlimited permission to copy, distribute and modify it. + +Basic Installation +================== + +Briefly, the shell commands `./configure; make; make install' should +configure, build, and install this package. The following +more-detailed instructions are generic; see the `README' file for +instructions specific to this package. + + The `configure' shell script attempts to guess correct values for +various system-dependent variables used during compilation. It uses +those values to create a `Makefile' in each directory of the package. +It may also create one or more `.h' files containing system-dependent +definitions. Finally, it creates a shell script `config.status' that +you can run in the future to recreate the current configuration, and a +file `config.log' containing compiler output (useful mainly for +debugging `configure'). + + It can also use an optional file (typically called `config.cache' +and enabled with `--cache-file=config.cache' or simply `-C') that saves +the results of its tests to speed up reconfiguring. Caching is +disabled by default to prevent problems with accidental use of stale +cache files. + + If you need to do unusual things to compile the package, please try +to figure out how `configure' could check whether to do them, and mail +diffs or instructions to the address given in the `README' so they can +be considered for the next release. If you are using the cache, and at +some point `config.cache' contains results you don't want to keep, you +may remove or edit it. + + The file `configure.ac' (or `configure.in') is used to create +`configure' by a program called `autoconf'. You need `configure.ac' if +you want to change it or regenerate `configure' using a newer version +of `autoconf'. + +The simplest way to compile this package is: + + 1. `cd' to the directory containing the package's source code and type + `./configure' to configure the package for your system. + + Running `configure' might take a while. While running, it prints + some messages telling which features it is checking for. + + 2. Type `make' to compile the package. + + 3. Optionally, type `make check' to run any self-tests that come with + the package. + + 4. Type `make install' to install the programs and any data files and + documentation. + + 5. You can remove the program binaries and object files from the + source code directory by typing `make clean'. To also remove the + files that `configure' created (so you can compile the package for + a different kind of computer), type `make distclean'. There is + also a `make maintainer-clean' target, but that is intended mainly + for the package's developers. If you use it, you may have to get + all sorts of other programs in order to regenerate files that came + with the distribution. + +Compilers and Options +===================== + +Some systems require unusual options for compilation or linking that the +`configure' script does not know about. Run `./configure --help' for +details on some of the pertinent environment variables. + + You can give `configure' initial values for configuration parameters +by setting variables in the command line or in the environment. Here +is an example: + + ./configure CC=c99 CFLAGS=-g LIBS=-lposix + + *Note Defining Variables::, for more details. + +Compiling For Multiple Architectures +==================================== + +You can compile the package for more than one kind of computer at the +same time, by placing the object files for each architecture in their +own directory. To do this, you can use GNU `make'. `cd' to the +directory where you want the object files and executables to go and run +the `configure' script. `configure' automatically checks for the +source code in the directory that `configure' is in and in `..'. + + With a non-GNU `make', it is safer to compile the package for one +architecture at a time in the source code directory. After you have +installed the package for one architecture, use `make distclean' before +reconfiguring for another architecture. + +Installation Names +================== + +By default, `make install' installs the package's commands under +`/usr/local/bin', include files under `/usr/local/include', etc. You +can specify an installation prefix other than `/usr/local' by giving +`configure' the option `--prefix=PREFIX'. + + You can specify separate installation prefixes for +architecture-specific files and architecture-independent files. If you +pass the option `--exec-prefix=PREFIX' to `configure', the package uses +PREFIX as the prefix for installing programs and libraries. +Documentation and other data files still use the regular prefix. + + In addition, if you use an unusual directory layout you can give +options like `--bindir=DIR' to specify different values for particular +kinds of files. Run `configure --help' for a list of the directories +you can set and what kinds of files go in them. + + If the package supports it, you can cause programs to be installed +with an extra prefix or suffix on their names by giving `configure' the +option `--program-prefix=PREFIX' or `--program-suffix=SUFFIX'. + +Optional Features +================= + +Some packages pay attention to `--enable-FEATURE' options to +`configure', where FEATURE indicates an optional part of the package. +They may also pay attention to `--with-PACKAGE' options, where PACKAGE +is something like `gnu-as' or `x' (for the X Window System). The +`README' should mention any `--enable-' and `--with-' options that the +package recognizes. + + For packages that use the X Window System, `configure' can usually +find the X include and library files automatically, but if it doesn't, +you can use the `configure' options `--x-includes=DIR' and +`--x-libraries=DIR' to specify their locations. + +Specifying the System Type +========================== + +There may be some features `configure' cannot figure out automatically, +but needs to determine by the type of machine the package will run on. +Usually, assuming the package is built to be run on the _same_ +architectures, `configure' can figure that out, but if it prints a +message saying it cannot guess the machine type, give it the +`--build=TYPE' option. TYPE can either be a short name for the system +type, such as `sun4', or a canonical name which has the form: + + CPU-COMPANY-SYSTEM + +where SYSTEM can have one of these forms: + + OS KERNEL-OS + + See the file `config.sub' for the possible values of each field. If +`config.sub' isn't included in this package, then this package doesn't +need to know the machine type. + + If you are _building_ compiler tools for cross-compiling, you should +use the option `--target=TYPE' to select the type of system they will +produce code for. + + If you want to _use_ a cross compiler, that generates code for a +platform different from the build platform, you should specify the +"host" platform (i.e., that on which the generated programs will +eventually be run) with `--host=TYPE'. + +Sharing Defaults +================ + +If you want to set default values for `configure' scripts to share, you +can create a site shell script called `config.site' that gives default +values for variables like `CC', `cache_file', and `prefix'. +`configure' looks for `PREFIX/share/config.site' if it exists, then +`PREFIX/etc/config.site' if it exists. Or, you can set the +`CONFIG_SITE' environment variable to the location of the site script. +A warning: not all `configure' scripts look for a site script. + +Defining Variables +================== + +Variables not defined in a site shell script can be set in the +environment passed to `configure'. However, some packages may run +configure again during the build, and the customized values of these +variables may be lost. In order to avoid this problem, you should set +them in the `configure' command line, using `VAR=value'. For example: + + ./configure CC=/usr/local2/bin/gcc + +causes the specified `gcc' to be used as the C compiler (unless it is +overridden in the site shell script). + +Unfortunately, this technique does not work for `CONFIG_SHELL' due to +an Autoconf bug. Until the bug is fixed you can use this workaround: + + CONFIG_SHELL=/bin/bash /bin/bash ./configure CONFIG_SHELL=/bin/bash + +`configure' Invocation +====================== + +`configure' recognizes the following options to control how it operates. + +`--help' +`-h' + Print a summary of the options to `configure', and exit. + +`--version' +`-V' + Print the version of Autoconf used to generate the `configure' + script, and exit. + +`--cache-file=FILE' + Enable the cache: use and save the results of the tests in FILE, + traditionally `config.cache'. FILE defaults to `/dev/null' to + disable caching. + +`--config-cache' +`-C' + Alias for `--cache-file=config.cache'. + +`--quiet' +`--silent' +`-q' + Do not print messages saying which checks are being made. To + suppress all normal output, redirect it to `/dev/null' (any error + messages will still be shown). + +`--srcdir=DIR' + Look for the package's source code in directory DIR. Usually + `configure' can determine that directory automatically. + +`configure' also accepts some other, not widely useful, options. Run +`configure --help' for more details. + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/NEWS b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/NEWS new file mode 100644 index 0000000..a0ba8db --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/NEWS @@ -0,0 +1,2486 @@ + Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, + 2005, 2006, 2007 Free Software Foundation, Inc. + + Copying and distribution of this file, with or without modification, + are permitted in any medium without royalty provided the copyright + notice and this notice are preserved. + +Changes from 3.1.5 to 3.1.6 +--------------------------- + +1. `gawk 'program' /non/existant/file' no longer core dumps. + +2. Too many people the world over have complained about gawk's use of the + locale's decimal point for parsing input data instead of the traditional + period. So, even though gawk was being nicely standards-compliant, in + a Triumph For The Users, gawk now only uses the locale's decimal point + if --posix is supplied or if POSIXLY_CORRECT is set. It is the sincere + hope that this change will eliminate this FAQ from being asked. + +3. `gawk -v BINMODE=1 ...' works again. + +4. Internal file names like `/dev/user' now work again. (Note that these + file names are obsolete and will go away eventually.) + +5. Problems with wide strings in non "C" locales have been straightened + out everywhere. (At least, we think so.) + +6. Use of `ansi2knr' is no longer supported. Please use an ANSI C compiler. + +7. Updated to Autoconf 2.61, Automake 1.10, and Gettext 0.16.1. + +8. The getopt* and regex* files were synchronized with current GLIBC CVS. + See the ChangeLog for the versions and minor edits made. + +9. There are additional --lint-old warnings. + +10. Gawk now uses getaddrinfo(3) to look up names and IP addresses. This + allows the use of an IPv6 format address and paves the way for + eventual addition of `/inet6/...' and `/inet4/...' hostnames. + +11. We believe gawk to now be valgrind clean. At least when run against + the test suite. + +12. A number of issues dealing with the formatting and printing of very + large numbers in integer formats have been dealt with and fixed. + +13. Gawk now converts "+inf", "-inf", "+nan" and "-nan" into the corresponding + magic IEEE floating point values. Only those strings (case independent) + work. With --posix, gawk calls the system strtod directly. You asked + for it, you got it, you deal with it. + +14. Defining YYDEBUG enables the -D command line option. + +15. Gawk should now work out of the box on Tandem NSK/OSS systems. + +16. Lint messages rationalized: many more of the messages are now printed + only once, instead of every time they are encountered. + +17. The strftime() function now accepts an optional third argument, which + if non-zero or non-null, indicates that the time should be formatted + as UTC instead of as local time. + +18. The precedence of concatenation and `| getline' (in something like + "echo " "date" | getline stuff) has been reverted to the earlier + behavior and now once again matches Unix awk. + +19. New configure time flag --disable-directories-fatal which causes + gawk to silently skip directories on the command line. This behavior + is also enabled for --traditional, since it's what Unix awk does. + +20. A new option, --use-lc-numeric, forces use of the locale's decimal + point without the rest of the draconian restrictions imposed by + --posix. This softens somewhat the stance taken in item #2. + +21. Everything relevant has been updated to the GPL 3. + +22. Array growth should be faster now, at no cost in space. + +23. Lots more tests. + +24. One new translation. + +25. Various bugs fixed, see the ChangeLog for details. + +Changes from 3.1.4 to 3.1.5 +--------------------------- + +1. The random() suite has been updated to a current FreeBSD version, which + works on systems with > 32-bit ints. + +2. A new option, `--exec' has been added. It's like -f but ends option + processing. It also disables `x=y' variable assignments, but not -v. + It's needed mainly for CGI scripts, so that source code can't be + passed in as part of the URL. + +3. dfa.[ch] have been synced with GNU grep development. This also fixes + multiple regex matching problems in multibyte locales. + +4. Updated to Automake 1.9.5. + +5. Updated to Bison 2.0. + +6. The getopt* and regex* files were synchronized with current GLIBC CVS. + See the ChangeLog for the versions and minor edits made. + +7. `configure --disable-nls' now disables just gawk's own translations. + Gawk continues to work with the locale's numeric formatting. This + includes a bug fix in handling the printf ' flag (e.g., %'d). + +8. Gawk is now multibyte aware. This means that index(), length(), + substr() and match() all work in terms of characters, not bytes. + +9. Gawk is now smarter about parsing numeric constants in corner cases. + +11. Not closing open redirections no longer causes gawk to exit non-zero. + +10. The VMS port has been updated. + +11. Changes from Andrew Schorr at the xmlgawk project to provide for + open hooks from extensions are now included. This will let the + xmlgawk extension work in the standard gawk. + +12. Updated to gettext 0.14.4. Gawk no longer includes its own copy + of the gettext `intl' library, following current GNU practice to + rely on there being an external version thereof. + +13. A regexp of the form `//' will now generate a warning that it + is not a C++ comment from --lint (awk.y). + +14. The ^ and ^= operators with an integer exponent now use Exponentiation + by Squaring. This simultaneously fixes a problem with ^= and a negative + integer exponent. + +15. length(array) now returns the number of elements in the array. This is + is a non-standard extension that will fail in POSIX mode. + +16. Carriage return characters are now ignored in program source code. + +17. Four new translations added. + +18. Various minor bugs fixed. See the ChangeLog for the details. + +Changes from 3.1.3 to 3.1.4 +--------------------------- + +1. Gawk now supports the POSIX %F format, falling back to %f if the local + system printf doesn't handle it. + +2. Gawk now supports the ' flag in printf. E.g., %'d in a locale with thousands + separators includes the thousands separator in the value, e.g. 12,345. + + This has one problem; the ' flag is next to impossible to use on the + command line, without major quoting games. Oh well, TANSTAAFL. + +3. The dfa code has been reinstated; the performance degradation was + just too awful. Sigh. (For fun, use `export GAWK_NO_DFA=1' to + see the difference.) + +4. The special case `x = x y' is now recognized in the grammar, and gawk + now uses `realloc' to append the new value to the end of the existing + one. This can speed up the common case of appending onto a string. + +5. The dfa code was upgraded with most of the fixes from grep 2.5.1, and + the regex code was upgraded with GLIBC as mid-January 2004. The regex + code is faster than it was, but still not as fast as the dfa code, so + the dfa code stays in. The getopt code was also synced to current GLIBC. + +6. Support code upgraded to Automake 1.8.5, Autoconf 2.59, and gettext 0.14.1. + +7. When --posix is in effect, sub/gsub now follow the 2001 POSIX behavior. + Yippee. This is even documented in the manual. + +8. Gawk will now recover children that have died (input pipelines, two-way + pipes), upon detecting EOF from them, thus avoiding filling + up the process table. Open file descriptors are not recovered + (unfortunately), since that could break awk semantics. See the + ChangeLog and the source code for the details. + +9. Handling of numbers like `0,1' in non-American locales ought to + work correctly now. + +10. IGNORECASE is now locale-aware for characters with values above 128. + The dfa matcher is now used for IGNORECASE matches too. + +11. Dynamic function loading is better. The documentation has been improved + and some new APIs for use by dynamic functions have been added. + +12. Gawk now has a fighting chance of working on older systems, + a la SunOS 4.1.x. + +13. Issues with multibyte support on HP-UX are now resolved. `configure' now + disables such support there, since it's not up to what gawk needs. + +14. There are now even more tests in the test suite. + +15. Various bugs fixed; see ChangeLog for the details. + +Changes from 3.1.2 to 3.1.3 +--------------------------- + +1. Gawk now follows POSIX in handling of local numeric formats for + input, output and number/string conversions. + +2. Multibyte detection improved. See README_d/README.multibyte for more + info about multibyte locales. + +3. Handling of `close' made more POSIX-compliant for POSIXLY_CORRECT, + see the documentation. + +4. The record reading code was redone, again. This time it's much + better. Really! + +5. For RS = "\n" and RS = "", gawk now only sets RT when it has changed. + This provides considerable performance improvement. + +6. `match' now sets all the subscripts in the third argument array + correctly, even if not all subexpressions matched. + +7. Updated to Automake 1.7.5. configure.in renamed configure.ac. + +8. C-style switch statements are available, but must be enabled at + compile time via `configure --enable-switch'. For 3.2 they'll be + enabled by default. Thanks to Michael Benzinger for the initial + code. + +9. %c now always prints no more than one character, whatever + precision is provided. + +10. strtonum(<number>) now works again. + +11. Gawk is now much better about scalar/array typing of global + uninitiailzed variables passed as parameters. Once the parameter + is then used one way or the other, the global var's type is + adjusted accordingly. Thanks to Stepan Kasal for the original + (considerable) changes. + +12. Dynamic function loading under Windows32 should now be possible. See + README_d/README.pcdynamic. Thanks to Patrick T.J. McPhee for the changes. + +13. Updated to gettext 0.12.1. + +14. Gawk now follows historical practice and POSIX for the return + value of `rand': It's now 0 <= N < 1. + +Changes from 3.1.1 to 3.1.2 +--------------------------- + +1. Loops of the form: + + for (iggy in foo) + next + + no longer leak memory. + +2. gawk -v FIELDWIDTHS="..." now sets PROCINFO["FS"] correctly. + +3. All builtin operations and functions should now fully evaluate their + arguments so that side effects take place correctly. + +4. Fixed a logic bug in gsub/gensub for matches to null strings that occurred + later in the string after a nonnull match. + +5. getgroups code now works on Ultrix again. + +6. Completely new version of the full GNU regex engine now in place. + +7. Argument parsing and variable assignment has been cleaned up. + +8. An I/O bug on HP-UX has been documented and worked around. See + README_d/README.hpux. + +9. awklib/grcat should now compile correctly. + +10. Updated to automake 1.7.3, autoconf 2.57 and gettext 0.11.5 ; thanks to + Paul Eggert for the initial automake and autoconf work. + +11. As a result of #6, removed the use of the dfa code from GNU grep. + +12. It is now possible to use ptys for |& two-way pipes instead of + pipes. The basic plumbing for this was provided by Paolo Bonzini. + To make this happen: + + command = "unix command etc" + PROCINFO[command, "pty"] = 1 + + print ... |& command + command |& getline stuff + + In other words, set the element in PROCINFO *before* opening the + two-way pipe, and then gawk will use ptys instead of pipes. + + On systems without ptys or where all the ptys are in use, gawk + will fall back to using plain pipes. + +13. Fixed a regex matching across buffer boundaries bug, with a + heuristic. See io.c:rsre_get_a_record. + +14. Profiling no longer dumps core if there are extension functions in place. + +15. Grammar and scanner cleaned up, courtesy of Stepen Kasal, to hopefully + once and for all fix the `/=' operator vs. `/=.../' regex ambiguity. + Lots of other grammar simplifications applied, as well. + +16. BINMODE should work now on more Windows ports. + +17. Updated to bison 1.875. Includes fix to bisonfix.sed script. + +18. The NODE structure is now 20% (8 bytes) smaller (on x86, anyway), which + should help conserve memory. + +19. Builds not in the source directory should work again. + +20. Arrays now use 2 NODE's per element instead of three. Combined with + #18, (on the x86) this reduces the overhead from 120 bytes per element + to just 64 bytes: almost a 50% improvement. + +21. Programs that make heavy use of changing IGNORECASE should now be + much faster, particularly if using a regular expression for FS or RS. + IGNORECASE now correctly affects RS regex record splitting, as well. + +22. IGNORECASE no longer affects single-character field splitting (FS = "c"), + or single-character record splitting (RS = "c"). + + This cleans up some weird behavior, and makes gawk better match the + documentation, which says it only affects regex-based field splitting + and record splitting. + + The documentation on this was improved, too. + +23. The framework in test/ has been simplified, making it much easier to + add new tests while keeping the size of Makefile.am reasonable. Thanks + for this to Stepan Kasal. + +24. --lint=invalid causes lint warnings only about stuff that's actually + invalid. This needs additional work. + +25. More translations. + +26. The `get_a_record' routine has been revamped (currently by splitting it + into three variants). This should improve long-term maintainability. + +27. `match' now adds more entries to 3rd array arg: + match("the big dog", /([a-z]+) ([a-z]+) ([a-z]+)/, data) + fills in variables: + data[1, "start"], data[1, "length"], and so on. + +28. New `asorti' function with same interface as `asort', but sorts indices + instead of values. + +29. Documentation updated to FDL 1.2. + +30. New `configure' option --disable-lint at compile time disables lint + checking. With GCC dead-code-elimination, cuts almost 200K off the + executable size on GNU/Linux x86. Presumably speeds up runtime. + + Using this will cause some of the tests in the test suite to fail. + This option may be removed at a later date. + +31. Various minor cleanups, see the ChangeLog for details. + +Changes from 3.1.0 to 3.1.1 +--------------------------- + +1. Six new translations. + +2. Having more than 4 different values for OFMT and/or CONVFMT now works. + +3. The handling of dynamic regexes is now more more sane, esp. w.r.t. + the profiling code. The profiling code has been fixed in several + places. + +4. The return value of index("", "") is now 1. + +5. Gawk should no longer close fd 0 in child processes. + +6. Fixed test for strtod semantics and regenerated configure. + +7. Gawk can now be built with byacc; an accidental bison dependency was + removed. + +8. `yyerror' will no longer dump core on long source lines. + +9. Gawk now correctly queries getgroups(2) to figure out how many groups + the process has. + +10. New configure option to force use of included strftime, e.g. on + Solaris systems. See `./configure --help' for the details. Replaced + the included strftime.c with the one from textutils. + +11. OS/2 port has been updated. + +12. Multi-byte character support has been added, courtesy of IBM Japan. + +13. The `for (iggy in foo) delete foo[iggy]' -> `delete foo' optimisation + now works. + +14. Upgraded to gettext 0.11.2 and automake 1.5. + +15. Full gettext compatibility (new dcngettext function). + +16. The O'Reilly copyedits and indexing changes for the documentation have + been folded into the texinfo version of the manuals. + +17. A humongously long value for the AWKPATH environment variable will no + longer dump core. + +18. Configuration / Installation issues have been straightened out in + Makefile.am. + +Changes from 3.0.6 to 3.1.0 +--------------------------- + +1. A new PROCINFO array provides info about the process. The non-I/O /dev/xxx + files are now obsolete, and their use always generates a warning. + +2. A new `mktime' builtin function was added for creating time stamps. The + `mktime' function written in awk was removed from the user's guide. + +3. New `--gen-po' option creates GNU gettext .po files for strings marked + with a leading underscore. + +4. Gawk now completely interprets special file names internally, ignoring the + existence of real /dev/stdin, /dev/stdout files, etc. + +5. The mmap code was removed. It was a worthwhile experiment that just + didn't work out. + +6. The BINMODE variable is new; on non-UNIX systems it affects how gawk + opens files for text vs. binary. + +7. The atari port is now unsupported. + +8. Gawk no longer supports `next file' as two words. + +9. On systems that support it, gawk now sets the `close on exec' flag on all + files and pipes it opens. This makes sure that child processes run via + `system' or pipes have plenty of file descriptors available. + +10. New ports: Tandem and BeOS. The Tandem port is unsupported. + +11. If `--posix' is in effect, newlines are not allowed after ?:. + +12. Weird OFMT/CONVFMT formats no longer cause fatal errors. + +13. Diagnostics about array parameters now include the parameter's name, + not just its number. + +14. configure should now automatically add -D_SYSV3 for ISC Unix. + (This seems to have made it into the gawk 3.0.x line long ago.) + +15. It is now possible to open a two-way pipe via the `|&' operator. + See the discussion in the manual about putting `sort' into such a pipeline, + though. (NOTE! This is borrowed from ksh: it is not the same as + the same operator in csh!) + +16. The `close' function now takes an optional second string argument + that allows closing one or the other end of the two-way pipe to + a co-process. This is needed to use `sort' in a co-process, see + the doc. + +17. If TCP/IP is available, special file names beginning with `/inet' + can be used with `|&' for IPC. Thanks to Juergen Kahrs for the initial + code. + +18. With `--enable-portals' on the configure command line, gawk will also + treat file names that start with `/p/' as a 4.4 BSD type portal file, + i.e., a two-way pipe for `|&'. + +19. Unrecognized escapes, such as "\q" now always generate a warning. + +20. The LINT variable is new; it provides dynamic control over the --lint + option. + +21. Lint warnings can be made fatal by using --lint=fatal or `LINT = "fatal"'. + Use this if you're really serious about portable code. + +22. Due to an enhanced sed script, there is no longer any need to worry + about finding or using alloca. alloca.c is thus now gone. + +23. A number of lint warnings have been added. Most notably, gawk will + detect if a variable is used before assigned to. Warnings for + when a string that isn't a number gets converted to a number are + in the code but disabled; they seem to be too picky in practice. + + Also, gawk will now warn about function parameter names that shadow + global variable names. + +24. It is now possible to dynamically add builtin functions on systems + that support dlopen. This facility is not (yet) as portable or well + integrated as it might be. *** WARNING *** THIS FEATURE WILL EVOLVE! + +25. There are *many* new tests in the test suite. + +26. Profiling has been added! A separate version of gawk, named pgawk, is + built and generates a run-time execution profile. The --profile option + can be used to change the default output file. In regular gawk, this + option pretty-prints the parse tree. + +27. Gawk has been internationalized, using GNU gettext. Translations for + future distributions are most welcome. Simultaneously, gawk was switched + over to using automake. You need Automake 1.4a (from the CVS archive) + if you want to muck with the Makefile.am files. + +28. New `asort' function for sorting arrays. See the doc for details. + +29. The match function takes an optional array third argument to hold + the text matched by parenthesized sub-expressions. + +30. The bit op functions and octal and hex source code constants are on by + default, no longer a configure-time option. Recognition of non-decimal + data is now enabled at runtime with --non-decimal-data command line option. + +31. Internationalization features available at the awk level: new TEXTDOMAIN + variable and `bindtextdomain' and `dcgettext' functions. printf formats + may contain the "%2$3.5d" kind of notation for use in translations. See + the texinfo manual for details. + +32. The return value from `close' has been rationalized. Most notably, + closing something that wasn't open returns -1 but remains non-fatal. + +33. The array effeciency change from 3.0.5 was reverted; the semantics were + not right. Additionally, index values of previously stored elements + can no longer change dynamically. + +34. The new option --dump-variables dumps a list of all global variables and + their final types and values to a file you give, or to `awkvars.out'. + +35. Gawk now uses a recent version of random.c courtesy of the FreeBSD + project. + +36. The gawk source code now uses ANSI C function definitions (new style), + with ansi2knr to translate code for old compilers. + +37. `for (iggy in foo)' loops should be more robust now in the face of + adding/deleting elements in the middle; they loop over just the elements + that are present in the array when the loop starts. + +Changes from 3.0.5 to 3.0.6 +--------------------------- + +This is a bug fix release only, pending further development on 3.1.0. + +Bugs fixed and changes made: + +1. Subscripting an array with a variable that is just a number no + longer magically converts the variable into a string. + +2. Similarly, running a `for (iggy in foo)' loop where `foo' is a + function parameter now works correctly. + +3. Similarly, `i = ""; v[i] = a; if (i in v) ...' now works again. + +4. Gawk now special cases `for (iggy in foo) delete foo[iggy]' and + treats it as the moral equivalent of `delete foo'. This should be + a major efficiency win when portably deleting large arrays. + +5. VMS port brought up to date. + +Changes from 3.0.4 to 3.0.5 +--------------------------- + +This is a bug fix release only, pending further development on 3.1.0. + +Bugs Fixed: + + 1. `function foo(foo)' is now a fatal error. + + 2. Array indexing is now much more efficient: where possible, only one + copy of an index string is kept, even if used in multiple arrays. + + 3. Support was added for MacOS X and an `install-strip' target. + + 4. [s]printf formatting for `0' flag and floating point formats now + works correctly. + + 5. HP-UX large file support with GCC 2.95.1 now works. + + 6. Arguments that contain `=' but that aren't syntactically valid are + now treated as filenames, instead of as fatal errors. + + 7. `-v NF=foo' now works. + + 8. Non-ascii alphanumeric characters are now treated as such in the + right locales by regex.c. Similarly, a Latin-1 y-umlaut (decimal + value 255) in the program text no longer acts like EOF. + + 9. Array indexes are always compared as strings; fixes an obscure bug + when user input gets used for the `x in array' test. + +10. The usage message now points users to the documentation for how + to report bugs. + +11. `/=' now works after an array. + +12. `b += b += 1' now works correctly. + +13. IGNORECASE changing with calls `match' now works better. (Fix for + semi-obscure bug.) + +14. Multicharacter values for RS now generate a lint warning. + +15. The gawk open file caching is now much more efficient. + +16. Global arrays passed to functions are now managed better. In particular, + test/arynocls.awk won't crash referencing freed memory. + +17. In obscure cases, `getline var' can no longer clobber $0. + +Changes from 3.0.3 to 3.0.4 +--------------------------- + +This is a bug fix release only, pending further development on 3.1.0. + +Bugs Fixed: + + 1. A memory leak when turning a function parameter into an array was + fixed. + + 2. The non-decimal data option now works correctly. + + 3. Using an empty pair of brackets as an array subscript no longer causes + a core dump during parsing. In general, syntax errors should not + cause core dumps any more. + + 4. Standard input is no longer closed if it provides program source, + avoiding strange I/O problems. + + 5. Memory corruption during printing with `print' has been fixed. + + 6. The gsub function now correctly counts the number of matches. + + 7. A typo in doc/Makefile.in has been fixed, making installation work. + + 8. Calling `next' or `nextfile' from a BEGIN or END rule is now fatal. + + 9. Subtle problems in rebuilding $0 when fields were changed have been + fixed. + +10. `FS = FS' now correctly turns off the use of FIELDWIDTHS. + +11. Gawk now parses fields correctly when FS is a single character. + +12. It is now possible for RS to be the NUL character ("\0"). + +13. Weird problems with number conversions on MIPS and other systems + have been fixed. + +14. When parsing using FIELDWIDTHS is in effect, `split' with no third + argument will still use the value of FS. + +15. Large File Support for Solaris, HP-UX, AIX, and IRIX is now enabled at + compile time, thanks to Paul Eggert. + +16. Attempting to use the name of a function as a variable or array + from within the function is now caught as a fatal error, instead + of as a core dump. + +17. A bug in parsing hex escapes was fixed. + +18. A weird bug with concatenation where one expression has side effects + that changes another was fixed. + +19. printf/sprintf now behave much better for uses of the '0' and '#' flags + and with precisions and field widths. + +20. Further strangenesses with concatenation and multiple accesses of some + of the special variables was fixed. + +21. The Atari port is marked as no longer supported. + +22. Build problems on HP-UX have been fixed. + +23. Minor fixes and additional explanations added to the documentation. + +24. For RS = "", even a single leading newline is now correctly stripped. + +25. Obscure parsing problems for regex constants like /=.../ fixed, so + that a regex constant is recognized, and not the /= operator. + +26. Fixed a bug when closing a redirection that matched the current + or last FILENAME. + +27. Build problems on AIX fixed. + +Changes from 3.0.2 to 3.0.3 +--------------------------- + +The horrendous per-record memory leak introduced in 3.0.1 is gone, finally. + +The `amiga' directory is now gone; Amiga support is now entirely handled +by the POSIX support. + +Windows32 support has been added in the `pc' directory. See `README_d/README.pc' +for more info. + +The mmap changes are disabled in io.c, and will be removed entirely +in the next big release. They were an interesting experiment that just +really didn't work in practice. + +A minor memory leak that occurred when using `next' from within a +function has also been fixed. + +Problems with I/O from sub-processes via a pipe are now gone. + +Using "/dev/pid" and the other special /dev files no longer causes a core dump. + +The files regex.h, regex.c, getopt.h, getopt.c, and getopt1.c have been +merged with the versions in GNU libc. Thanks to Ulrich Drepper for his help. + +Some new undocumented features have been added. Use the source, Luke! +It is not clear yet whether these will ever be fully supported. + +Array performance should be much better for very very large arrays. "Virtual +memory required, real memory helpful." + +builtin.c:do_substr rationalized, again. + +The --re-interval option now works as advertised. + +The license text on some of the missing/* files is now generic. + +Lots more new test cases. + +Lots of other small bugs fixed, see the ChangeLog files for details. + +Changes from 3.0.1 to 3.0.2 +--------------------------- + +Gawk now uses autoconf 2.12. + +strftime now behaves correctly if passed an empty format string or if +the string formats to an empty result string. + +Several minor compilation and installation problems have been fixed. + +Minor page break issues in the user's guide have been fixed. + +Lexical errors no longer repeat ad infinitum. + +Changes from 3.0.0 to 3.0.1 +--------------------------- + +Troff source for a handy-dandy five color reference card is now provided. +Thanks to SSC for their macros. + +Gawk now behaves like Unix awk and mawk, in that newline acts as white +space for separating fields and for `split', by default. In posix mode, +only space and tab separate fields. The documentation has been updated to +reflect this. + +Tons and tons of small bugs fixed and new tests added, see the ChangeLogs. + +Lots fewer compile time warnings from gcc -Wall. Remaining ones aren't +worth fixing. + +Gawk now pays some attention to the locale settings. + +Fixes to gsub to catch several corner cases. + +The `print' statement now evaluates all expressions first, and then +prints them. This leads to less suprising behaviour if any expression has +output side effects. + +Miscellanious improvements in regex.h and regex.c. + +Gawk will now install itself as gawk-M.N.P in $(bindir), and link +`gawk' to it. This makes it easy to have multiple versions of gawk +simultaneously. It will also now install itself as `awk' in $(bindir) +if there is no `awk' there. This is in addition to installing itself as +`gawk'. This change benefits the Hurd, and possibly other systems. One +day, gawk will drop the `g', but not yet. + +`--posix' turns on interval expressions. Gawk now matches its documentation. + +`close(FILENAME)' now does something meaningful. + +Field management code in field.c majorly overhauled, several times. + +The gensub code has been fixed, several bugs are now gone. + +Gawk will use mmap for data file input if it is available. + +The printf/sprintf code has been improved. + +Minor issues in Makefile setup worked on and improved. + +builtin.c:do_substr rationalized. + +Regex matching fixed so that /+[0-9]/ now matches the leading +. + +For building on vms, the default compiler is now DEC C rather than VAX C. + +Changes from 2.15.6 to 3.0.0 +---------------------------- + +Fixed spelling of `Programming' in the copyright notice in all the files. + +New --re-interval option to turn on interval expressions. They're off +by default, except for --posix, to avoid breaking old programs. + +Passing regexp constants as parameters to user defined functions now +generates a lint warning. + +Several obscure regexp bugs fixed; alas, a small number remain. + +The manual has been thoroughly revised. It's now almost 50% bigger than +it used to be. + +The `+' modifier in printf is now reset correctly for each item. + +The do_unix variable is now named do_traditional. + +Handling of \ in sub and gsub rationalized (somewhat, see the manual for +the gory [and I do mean gory] details). + +IGNORECASE now uses ISO 8859-1 Latin-1 instead of straight ASCII. See the +source for how to revert to pure ASCII. + +--lint will now warn if an assignment occurs in a conditional context. +This may become obnoxious enough to need turning off in the future, but +"it seemed like a good idea at the time." + +%hf and %Lf are now diagnosed as invalid in printf, just like %lf. + +Gawk no longer incorrectly closes stdin in child processes used in +input pipelines. + +For integer formats, gawk now correctly treats the precision as the +number of digits to print, not the number of characters. + +gawk is now much better at catching the use of scalar values when +arrays are needed, both in function calls and the `x in y' constructs. + +New gensub function added. See the manual. + +If do_tradtional is true, octal and hex escapes in regexp constants are +treated literally. This matches historical behavior. + +yylex/nextc fixed so that even null characters can be included +in the source code. + +do_format now handles cases where a format specifier doesn't end in +a control letter. --lint reports an error. + +strftime() now uses a default time format equivalent to that of the +Unix date command, thus it can be called with no arguments. + +Gawk now catches functions that are used but not defined at parse time +instead of at run time. (This is a lint error, making it fatal could break +old code.) + +Arrays that max out are now handled correctly. + +Integer formats outside the range of an unsigned long are now detected +correctly using the SunOS 4.x cc compiler. + +--traditional option added as new preferred name for --compat, in keeping +with GCC. + +--lint-old option added, so that warnings about things not in old awk +are only given if explicitly asked for. + +`next file' has changed to one word, `nextfile'. `next file' is still +accepted but generates a lint warning. `next file' will go away eventually. + +Gawk with --lint will now notice empty source files and empty data files. + +Amiga support using the Unix emulation added. Thanks to fnf@ninemoons.com. + +test/Makefile is now "parallel-make safe". + +Gawk now uses POSIX regexps + GNU regex ops by default. --posix goes to +pure posix regexps, and --compat goes to traditional Unix regexps. However, +interval expressions, even though specified by POSIX, are turned off by +default, to avoid breaking old code. + +IGNORECASE now applies to string comparison as well as regexp operations. + +The AT&T Bell Labs Research awk fflush builtin function is now supported. +fflush is extended to flush stdout if no arg and everything if given +the null string as an argument. + +If RS is more than one character, it is treated as a regular expression +and records are delimited accordingly. The variable RT is set to the record +terminator string. This is disabled in compatibility mode. + +If FS is set to the null string (or the third arg. of split() is the null +string), splitting is done at every single character. This is disabled in +compatibility mode. + +Gawk now uses the Autoconf generated configure script, doing away with all +the config/* files and the machinery that went with them. The Makefile.in +has also changed accordingly, complete with all the standard GNU Makefile +targets. (Non-unix systems may still have their own config.h and Makefile; +see the appropriate README_d/README.* and/or subdirectory.) + +The source code has been cleaned up somewhat and the formatting improved. + +Changes from 2.15.5 to 2.15.6 +----------------------------- + +Copyrights updated on all changed files. + +test directory enhanced with four new tests. + +Gawk now generates a warning for \x without following hexadecimal digits. +In this case, it returns 'x', not \0. + +Several fixes in main.c related to variable initialization: + CONVFMT has a default value + resetup is called before initializing variables + the varinit table fixed up a bit (see the comments) + +gawk.1 updated with new BUG REPORTS section. + +A plain `print' inside a BEGIN or END now generates a lint warning (awk.y). + +Small fix in iop.c:get_a_record to avoid reading uninitialized memory. + +awk.y:yylex now does a better job of handling things if the source file +does not end in a newline. Probably there is more work to be done. + +Memory leaks fixed in awk.y, particularly in cases of duplicate function +parameters. Also, calling a function doesn't leak memory during parsing. + +Empty function bodies are now allowed (awk.y). + +Gawk now detects duplicate parameter names in functions (awk.y). + +New function `error' in msg.c added for use from awk.y. + +eval.c:r_get_lhs now checks if its argument is a parameter on the stack, +and pulls down the real variable. This catches more 'using an array as +a scalar' kinds of errors. + +main.c recovers C alloca space after parsing, this is important for +bison-based parsers. re.c recovers C alloca space after doing an research. +[Changes from Pat Rankin] + +builtin.c now declares the random() related functions based on +RANDOM_MISSING from config.h. [Suggested by Pat Rankin] + +awk.h now handles alloca correctly for HP-UX. [Kaveh Ghazi] + +regex.h and config/cray60 updated for Unicos 8.0. [Hal Peterson] + +Fixed re.c and dfa.c so that gawk no longer leaks memory when using +lots of dynamic regexps. + +Removed dependency on signed chars from `idx' variable in awk.h. Gawk +now passes its test suite if compiled with `gcc -fno-signed-char'. + +Fixed warning on close in io.c to go under lint control. Too many people +have complained about the spurious message, particularly when closing a +child pipeline early. + +Gawk now correctly handles RS = "" when input is from a terminal +(iop.c:get_a_record). + +Config file added for GNU. + +gawk 'BEGIN { exit 1 } ; END { exit }' now exits 1, as it should +(eval.c:interpret). + +sub and gsub now follow posix, \ escapes both & and \. Each \ must +be doubled initially in the program to get it into the string. +Thanks to Mike Brennan for pointing this out (builtin.c:sub_common). + +If FS is "", gawk behaves like mawk and nawk, making the whole record be $1. +Yet Another Dark Corner. Sigh (field.c:def_parse_field). + +Gawk now correctly recomputes string values for numbers if CONVFMT has +changed (awk.h:force_string, node.c:r_force_string). + +A regexp of the form `/* this looks like a comment but is not */' will +now generate a warning from --lint (awk.y). + +Gawk will no longer core dump if given an empty input file (awk.y:get_src_buf, +iop.c:optimal_bufsize). + +A printf format of the form %lf is handled correctly. The `l' generates +a lint warning (builtin.c:format_tree) [Thanks to Mark Moraes]. + +Lynxos config file added. + +`continue' outside a loop treated as `next' only in compatibility mode, +instead of by default; recent att nawk chokes on this now. `break' +outside a loop now treated as `next' in compatibility mode (eval.c). + +Bug fix in string concatenation, an arbitrary number of expressions +are allowed (eval.c). + +$1 += $2 now works correctly (eval.c). + +Changing IGNORECASE no longer resets field-splitting to FS if it was +using FIELDWIDTHS (eval.c, field.c). + +Major enhancement: $0 and NF for last record read are now preserved +into the END rule (io.c). + +Regexp fixes: + /./ now matches a newline (regex.h) + ^ and $ match beginning and end of string only, not any embedded + newlines (re.c) + regex.c should compile and work ok on 64-bit mips/sgi machines + +Changes from 2.15.4 to 2.15.5 +----------------------------- + +FUTURES file updated and re-arranged some with more rational schedule. + +Many prototypes handled better for ANSI C in protos.h. + +getopt.c updated somewhat. + +test/Makefile now removes junk directory, `bardargtest' renamed `badargs.' + +Bug fix in iop.c for RS = "". Eat trailing newlines off of record separator. + +Bug fix in Makefile.bsd44, use leading tab in actions. + +Fix in field.c:set_FS for FS == "\\" and IGNORECASE != 0. + +Config files updated or added: + cray60, DEC OSF/1 2.0, Utek, sgi405, next21, next30, atari/config.h, + sco. + +Fix in io.c for ENFILE as well as EMFILE, update decl of groupset to +include OSF/1. + +Rationalized printing as integers if numbers are outside the range of a long. +Changes to node.c:force_string and builtin.c. + +Made internal NF, NR, and FNR variables longs instead of ints. + +Add LIMITS_H_MISSING stuff to config.in and awk.h, and default defs for +INT_MAX and LONG_MAX, if no limits.h file. Add a standard decl of +the time() function for __STDC__. From ghazi@noc.rutgers.edu. + +Fix tree_eval in awk.h and r_tree_eval in eval.c to deal better with +function parameters, particularly ones that are arrays. + +Fix eval.c to print out array names of arrays used in scalar contexts. + +Fix eval.c in interpret to zero out source and sourceline initially. This +does a better job of providing source file and line number information. + +Fix to re_parse_field in field.c to not use isspace when RS = "", but rather +to explicitly look for blank and tab. + +Fix to sc_parse_field in field.c to catch the case of the FS character at the +end of a record. + +Lots of miscellanious bug fixes for memory leaks, courtesy Mark Moraes, +also fixes for arrays. + +io.c fixed to warn about lack of explicit closes if --lint. + +Updated missing/strftime.c to match posted strftime 6.2. + +Bug fix in builtin.c, in case of non-match in sub_common. + +Updated constant used for division in builtin.c:do_rand for DEC Alpha +and CRAY Y-MP. + +POSIXLY_CORRECT in the environment turns on --posix (fixed in main.c). + +Updated srandom prototype and calls in builtin.c. + +Fix awk.y to enforce posix semantics of unary +: result is numeric. + +Fix array.c to not rearrange the hash chain upon finding an index in +the array. This messed things up in cases like: + for (index1 in array) { + blah + if (index2 in array) # blew away the for + stuff + } + +Fixed spelling errors in the man page. + +Fixes in awk.y so that + gawk '' /path/to/file +will work without core dumping or finding parse errors. + +Fix main.c so that --lint will fuss about an empty program. +Yet another fix for argument parsing in the case of unrecognized options. + +Bug fix in dfa.c to not attempt to free null pointers. + +Bug fix in builtin.c to only use DEFAULT_G_PRECISION for %g or %G. + +Bug fix in field.c to achieve call by value semantics for split. + +Changes from 2.15.3 to 2.15.4 +----------------------------- + +Lots of lint fixes, and do_sprintf made mostly ANSI C compatible. + +Man page updated and edited. + +Copyrights updated. + +Arrays now grow dynamically, initially scaling up by an order of magnitude + and then doubling, up to ~ 64K. This should keep gawk's performance + graceful under heavy load. + +New `delete array' feature added. Only documented in the man page. + +Switched to dfa and regex suites from grep-2.0. These offer the ability to + move to POSIX regexps in the next release. + +Disabled GNU regex ops. + +Research awk -m option now recognized. It does nothing in gawk, since gawk + has no static limits. Only documented in the man page. + +New bionic (faster, better, stronger than before) hashing function. + +Bug fix in argument handling. `gawk -X' now notices there was no program. + Additional bug fixes to make --compat and --lint work again. + +Many changes for systems where sizeof(int) != sizeof(void *). + +Add explicit alloca(0) in io.c to recover space from C alloca. + +Fixed file descriptor leak in io.c. + +The --version option now follows the GNU coding standards and exits. + +Fixed several prototypes in protos.h. + +Several tests updated. On Solaris, warn that the out? tests will fail. + +Configuration files for SunOS with cc and Solaris 2.x added. + +Improved error messages in awk.y on gawk extensions if do_unix or do_compat. + +INSTALL file added. + +Fixed Atari Makefile and several VMS specific changes. + +Better conversion of numbers to strings on systems with broken sprintfs. + +Changes from 2.15.2 to 2.15.3 +----------------------------- + +Increased HASHSIZE to a decent number, 127 was way too small. + +FILENAME is now the null string in a BEGIN rule. + +Argument processing fixed for invalid options and missing arguments. + +This version will build on VMS. This included a fix to close all files + and pipes opened with redirections before closing stdout and stderr. + +More getpgrp() defines. + +Changes for BSD44: <sys/param.h> in io.c and Makefile.bsd44. + +All directories in the distribution are now writable. + +Separated LDFLAGS and CFLAGS in Makefile. CFLAGS can now be overridden by + user. + +Make dist now builds compressed archives ending in .gz and runs doschk. + +Amiga port. + +New getopt.c fixes Alpha OSF/1 problem. + +Make clean now removes possible test output. + +Improved algorithm for multiple adjacent string concatenations leads to + performance improvements. + +Fix nasty bug whereby command-line assignments, both with -v and at run time, + could create variables with syntactically illegal names. + +Fix obscure bug in printf with %0 flag and filling. + +Add a lint check for substr if provided length exceeds remaining characters + in string. + +Update atari support. + +PC support enhanced to include support for both DOS and OS/2. (Lots more + #ifdefs. Sigh.) + +Config files for Hitachi Unix and OSF/1, courtesy of Yoko Morishita + (morisita@sra.co.jp) + +Changes from 2.15.1 to 2.15.2 +----------------------------- + +Additions to the FUTURES file. + +Document undefined order of output when using both standard output + and /dev/stdout or any of the /dev output files that gawk emulates in + the absence of OS support. + +Clean up the distribution generation in Makefile.in: the info files are + now included, the distributed files are marked read-only and patched + distributions are now unpacked in a directory named with the patch level. + +Changes from 2.15 to 2.15.1 +--------------------------- + +Close stdout and stderr before all redirections on program exit. This allows + detection of write errors and also fixes the messages test on Solaris 2.x. + +Removed YYMAXDEPTH define in awk.y which was limiting the parser stack depth. + +Changes to config/bsd44, Makefile.bsd44 and configure to bring it into line + with the BSD4.4 release. + +Changed Makefile to use prefix, exec_prefix, bindir etc. + +make install now installs info files. + +make install now sets permissions on installed files. + +Make targets added: uninstall, distclean, mostlyclean and realclean. + +Added config.h to cleaner and clobber make targets. + +Changes to config/{hpux8x,sysv3,sysv4,ultrix41} to deal with alloca(). + +Change to getopt.h for portability. + +Added more special cases to the getpgrp() call. + +Added README.ibmrt-aos and config/ibmrt-aos. + +Changes from 2.14 to 2.15 +--------------------------- + +Command-line source can now be mixed with library functions. + +ARGIND variable tracks index in ARGV of FILENAME. + +GNU style long options in addition to short options. + +Plan 9 style special files interpreted by gawk: + /dev/pid + /dev/ppid + /dev/pgrpid + /dev/user + $1 = getuid + $2 = geteuid + $3 = getgid + $4 = getegid + $5 ... $NF = getgroups if supported + +ERRNO variable contains error string if getline or close fails. + +Very old options -a and -e have gone away. + +Inftest has been removed from the default target in test/Makefile -- the + results were too machine specific and resulted in too many false alarms. + +A README.amiga has been added. + +The "too many arguments supplied for format string" warning message is only + in effect under the lint option. + +Code improvements in dfa.c. + +Fixed all reported bugs: + + Writes are checked for failure (such as full filesystem). + + Stopped (at least some) runaway error messages. + + gsub(/^/, "x") does the right thing for $0 of 0, 1, or more length. + + close() on a command being piped to a getline now works properly. + + The input record will no longer be freed upon an explicit close() + of the input file. + + A NUL character in FS now works. + + In a substitute, \\& now means a literal backslash followed by what + was matched. + + Integer overflow of substring length in substr() is caught. + + An input record without a newline termination is handled properly. + + In io.c, check is against only EMFILE so that system file table + is not filled. + + Renamed all files with names longer than 14 characters. + + Escaped characters in regular expressions were being lost when + IGNORECASE was used. + + Long source lines were not being handled properly. + + Sourcefiles that ended in a tab but no newline were bombing. + + Patterns that could match zero characters in split() were not working + properly. + + The parsedebug option was not working. + + The grammar was being a bit too lenient, allowing some very dubious + programs to pass. + + Compilation with DEBUG defined now works. + + A variable read in with getline was not being treated as a potential + number. + + Array subscripts were not always of string type. + + +Changes from 2.13.2 to 2.14 +--------------------------- + +Updated manual! + +Added "next file" to skip efficiently to the next input file. + +Fixed potential of overflowing buffer in do_sprintf(). + +Plugged small memory leak in sub_common(). + +EOF on a redirect is now "sticky" -- it can only be cleared by close()ing + the pipe or file. + +Now works if used via a #! /bin/gawk line at the top of an executable file + when that line ends with whitespace. + +Added some checks to the grammar to catch redefinition of builtin functions. + This could eventually be the basis for an extension to allow redefining + functions, but in the mean time it's a good error catching facility. + +Negative integer exponents now work. + +Modified do_system() to make sure it had a non-null string to be passed + to system(3). Thus, system("") will flush any pending output but not go + through the overhead of forking an un-needed shell. + +A fix to floating point comparisons so that NaNs compare right on IEEE systems. + +Added code to make sure we're not opening directories for reading and such. + +Added code to do better diagnoses of weird or null file names. + +Allow continue outside of a loop, unless in strict posix mode. Lint option + will issue warning. + +New missing/strftime.c. There has been one change that affects gawk. Posix + now defines a %V conversion so the vms conversion has been changed to %v. + If this version is used with gawk -Wlint and they use %V in a call to + strftime, they'll get a warning. + +Error messages now conform to GNU standard (I hope). + +Changed comparisons to conform to the description found in the file POSIX. + This is inconsistent with the current POSIX draft, but that is broken. + Hopefully the final POSIX standard will conform to this version. + (Alas, this will have to wait for 1003.2b, which will be a revision to + the 1003.2 standard. That standard has been frozen with the broken + comparison rules.) + +The length of a string was a short and now is a size_t. + +Updated VMS help. + +Added quite a few new tests to the test suite and deleted many due to lack of + written releases. Test output is only removed if it is identical to the + "good" output. + +Fixed a couple of bugs for reference to $0 when $0 is "" -- particularly in + a BEGIN block. + +Fixed premature freeing in construct "$0 = $0". + +Removed the call to wait_any() in gawk_popen(), since on at least some systems, + if gawk's input was from a pipe, the predecessor process in the pipe was a + child of gawk and this caused a deadlock. + +Regexp can (once again) match a newline, if given explicitly. + +nextopen() makes sure file name is null terminated. + +Fixed VMS pipe simulation. Improved VMS I/O performance. + +Catch . used in variable names. + +Fixed bug in getline without redirect from a file -- it was quitting after the + first EOF, rather than trying the next file. + +Fixed bug in treatment of backslash at the end of a string -- it was bombing + rather than doing something sensible. It is not clear what this should mean, + but for now I issue a warning and take it as a literal backslash. + +Moved setting of regexp syntax to before the option parsing in main(), to + handle things like -v FS='[.,;]' + +Fixed bug when NF is set by user -- fields_arr must be expanded if necessary + and "new" fields must be initialized. + +Fixed several bugs in [g]sub() for no match found or the match is 0-length. + +Fixed bug where in gsub() a pattern anchored at the beginning would still + substitute throughout the string. + +make test does not assume that . is in PATH. + +Fixed bug when a field beyond the end of the record was requested after + $0 was altered (directly or indirectly). + +Fixed bug for assignment to field beyond end of record -- the assigned value + was not found on subsequent reference to that field. + +Fixed bug for FS a regexp and it matches at the end of a record. + +Fixed memory leak for an array local to a function. + +Fixed hanging of pipe redirection to getline + +Fixed coredump on access to $0 inside BEGIN block. + +Fixed treatment of RS = "". It now parses the fields correctly and strips + leading whitespace from a record if FS is a space. + +Fixed faking of /dev/stdin. + +Fixed problem with x += x + +Use of scalar as array and vice versa is now detected. + +IGNORECASE now obeyed for FS (even if FS is a single alphabetic character). + +Switch to GPL version 2. + +Renamed awk.tab.c to awktab.c for MSDOS and VMS tar programs. + +Renamed this file (CHANGES) to NEWS. + +Use fmod() instead of modf() and provide FMOD_MISSING #define to undo + this change. + +Correct the volatile declarations in eval.c. + +Avoid errant closing of the file descriptors for stdin, stdout and stderr. + +Be more flexible about where semi-colons can occur in programs. + +Check for write errors on all output, not just on close(). + +Eliminate the need for missing/{strtol.c,vprintf.c}. + +Use GNU getopt and eliminate missing/getopt.c. + +More "lint" checking. + + +Changes from 2.13.1 to 2.13.2 +----------------------------- + +Toward conformity with GNU standards, configure is a link to mkconf, the latter + to disappear in the next major release. + +Update to config/bsd43. + +Added config/apollo, config/msc60, config/cray2-50, config/interactive2.2 + +sgi33.cc added for compilation using cc rather than gcc. + +Ultrix41 now propagates to config.h properly -- as part of a general + mechanism in configure for kludges -- #define anything from a config file + just gets tacked onto the end of config.h -- to be used sparingly. + +Got rid of an unnecessary and troublesome declaration of vprintf(). + +Small improvement in locality of error messages. + +Try to diagnose use of array as scalar and vice versa -- to be improved in + the future. + +Fix for last bug fix for Cray division code--sigh. + +More changes to test suite to explicitly use sh. Also get rid of + a few generated files. + +Fixed off-by-one bug in string concatenation code. + +Fix for use of array that is passed in from a previous function parameter. + Addition to test suite for above. + +A number of changes associated with changing NF and access to fields + beyond the end of the current record. + +Change to missing/memcmp.c to avoid seg. fault on zero length input. + +Updates to test suite (including some inadvertently left out of the last patch) + to invoke sh explicitly (rather than rely on #!/bin/sh) and remove some + junk files. test/chem/good updated to correspond to bug fixes. + +Changes from 2.13.0 to 2.13.1 +----------------------------- + +More configs and PORTS. + +Fixed bug wherein a simple division produced an erroneous FPE, caused by + the Cray division workaround -- that code is now #ifdef'd only for + Cray *and* fixed. + +Fixed bug in modulus implementation -- it was very close to the above + code, so I noticed it. + +Fixed portability problem with limits.h in missing.c + +Fixed portability problem with tzname and daylight -- define TZNAME_MISSING + if strftime() is missing and tzname is also. + +Better support for Latin-1 character set. + +Fixed portability problem in test Makefile. + +Updated PROBLEMS file. + +=============================== gawk-2.13 released ========================= +Changes from 2.12.42 to 2.12.43 +------------------------------- + +Typo in awk.y + +Fixed up strftime.3 and added doc. for %V. + +Changes from 2.12.41 to 2.12.42 +------------------------------- + +Fixed bug in devopen() -- if you had write permission in /dev, + it would just create /dev/stdout etc.!! + +Final (?) VMS update. + +Make NeXT use GFMT_WORKAROUND + +Fixed bug in sub_common() for substitute on zero-length match. Improved the + code a bit while I was at it. + +Fixed grammar so that $i++ parses as ($i)++ + +Put support/* back in the distribution (didn't I already do this?!) + +Changes from 2.12.40 to 2.12.41 +------------------------------- + +VMS workaround for broken %g format. + +Changes from 2.12.39 to 2.12.40 +------------------------------- + +Minor man page update. + +Fixed latent bug in redirect(). + +Changes from 2.12.38 to 2.12.39 +------------------------------- + +Updates to test suite -- remove dependence on changing gawk.1 man page. + +Changes from 2.12.37 to 2.12.38 +------------------------------- + +Fixed bug in use of *= without whitespace following. + +VMS update. + +Updates to man page. + +Option handling updates in main.c + +test/manyfiles redone and added to bigtest. + +Fixed latent (on Sun) bug in handling of save_fs. + +Changes from 2.12.36 to 2.12.37 +------------------------------- + +Update REL in Makefile-dist. Incorporate test suite into main distribution. + +Minor fix in regtest. + +Changes from 2.12.35 to 2.12.36 +------------------------------- + +Release takes on dual personality -- 2.12.36 and 2.13.0 -- any further + patches before public release won't count for 2.13, although they will for + 2.12 -- be careful to avoid confusion! patchlevel.h will be the last thing + to change. + +Cray updates to deal with arithmetic problems. + +Minor test suite updates. + +Fixed latent bug in parser (freeing memory). + +Changes from 2.12.34 to 2.12.35 +------------------------------- + +VMS updates. + +Flush stdout at top of err() and stderr at bottom. + +Fixed bug in eval_condition() -- it wasn't testing for MAYBE_NUM and + doing the force_number(). + +Included the missing manyfiles.awk and a new test to catch the above bug which + I am amazed wasn't already caught by the test suite -- it's pretty basic. + +Changes from 2.12.33 to 2.12.34 +------------------------------- + +Atari updates -- including bug fix. + +More VMS updates -- also nuke vms/version.com. + +Fixed bug in handling of large numbers of redirections -- it was probably never + tested before (blush!). + +Minor rearrangement of code in r_force_number(). + +Made chem and regtest tests a bit more portable (Ultrix again). + +Added another test -- manyfiles -- not invoked under any other test -- very Unix + specific. + +Rough beginning of LIMITATIONS file -- need my AWK book to complete it. + +Changes from 2.12.32 to 2.12.33 +------------------------------- + +Expunge debug.? from various files. + +Remove vestiges of Floor and Ceil kludge. + +Special case integer division -- mainly for Cray, but maybe someone else + will benefit. + +Workaround for iop_close closing an output pipe descriptor on Cray -- + not conditional since I think it may fix a bug on SGI as well and I don't + think it can hurt elsewhere. + +Fixed memory leak in assoc_lookup(). + +Small cleanup in test suite. + +Changes from 2.12.31 to 2.12.32 +------------------------------- + +Nuked debug.c and debugging flag -- there are better ways. + +Nuked version.sh and version.c in subdirectories. + +Fixed bug in handling of IGNORECASE. + +Fixed bug when FIELDWIDTHS was set via -v option. + +Fixed (obscure) bug when $0 is assigned a numerical value. + +Fixed so that escape sequences in command-line assignments work (as it already + said in the comment). + +Added a few cases to test suite. + +Moved support/* back into distribution. + +VMS updates. + +Changes from 2.12.30 to 2.12.31 +------------------------------- + +Cosmetic manual page changes. + +Updated sunos3 config. + +Small changes in test suite including renaming files over 14 chars. in length. + +Changes from 2.12.29 to 2.12.30 +------------------------------- + +Bug fix for many string concatenations in a row. + +Changes from 2.12.28 to 2.12.29 +------------------------------- + +Minor cleanup in awk.y + +Minor VMS update. + +Minor atari update. + +Changes from 2.12.27 to 2.12.28 +------------------------------- + +Got rid of the debugging goop in eval.c -- there are better ways. + +Sequent port. + +VMS changes left out of the last patch -- sigh! config/vms.h renamed + to config/vms-conf.h. + +Fixed missing/tzset.c + +Removed use of gcvt() and GCVT_MISSING -- turns out it was no faster than + sprintf("%g") and caused all sorts of portability headaches. + +Tuned get_field() -- it was unnecessarily parsing the whole record on reference + to $0. + +Tuned interpret() a bit in the rule_node loop. + +In r_force_number(), worked around bug in Uglix strtod() and got rid of + ugly do{}while(0) at Michal's urging. + +Replaced do_deref() and deref with unref(node) -- much cleaner and a bit faster. + +Got rid of assign_number() -- contrary to comment, it was no faster than + just making a new node and freeing the old one. + +Replaced make_number() and tmp_number() with macros that call mk_number(). + +Changed freenode() and newnode() into macros -- the latter is getnode() + which calls more_nodes() as necessary. + +Changes from 2.12.26 to 2.12.27 +------------------------------- + +Completion of Cray 2 port (includes a kludge for floor() and ceil() + that may go or be changed -- I think that it may just be working around + a bug in chem that is being tweaked on the Cray). + +More VMS updates. + +Moved kludge over yacc's insertion of malloc and realloc declarations + from protos.h to the Makefile. + +Added a lisp interpreter in awk to the test suite. (Invoked under + bigtest.) + +Cleanup in r_force_number() -- I had never gotten around to a thorough + profile of the cache code and it turns out to be not worth it. + +Performance boost -- do lazy force_number()'ing for fields etc. i.e. + flag them (MAYBE_NUM) and call force_number only as necessary. + +Changes from 2.12.25 to 2.12.26 +------------------------------- + +Rework of regexp stuff so that dynamic regexps have reasonable + performance -- string used for compiled regexp is stored and + compared to new string -- if same, no recompilation is necessary. + Also, very dynamic regexps cause dfa-based searching to be turned + off. + +Code in dev_open() is back to returning fileno(std*) rather than + dup()ing it. This will be documented. Sorry for the run-around + on this. + +Minor atari updates. + +Minor vms update. + +Missing file from MSDOS port. + +Added warning (under lint) if third arg. of [g]sub is a constant and + handle it properly in the code (i.e. return how many matches). + +Changes from 2.12.24 to 2.12.25 +------------------------------- + +MSDOS port. + +Non-consequential changes to regexp variables in preparation for + a more serious change to fix a serious performance problem. + +Changes from 2.12.23 to 2.12.24 +------------------------------- + +Fixed bug in output flushing introduced a few patches back. This caused + serious performance losses. + +Changes from 2.12.22 to 2.12.23 +------------------------------- + +Accidentally left config/cray2-60 out of last patch. + +Added some missing dependencies to Makefile. + +Cleaned up mkconf a bit; made yacc the default parser (no alloca needed, + right?); added rs6000 hook for signed characters. + +Made regex.c with NO_ALLOCA undefined work. + +Fixed bug in dfa.c for systems where free(NULL) bombs. + +Deleted a few cant_happen()'s that *really* can't hapen. + +Changes from 2.12.21 to 2.12.22 +------------------------------- + +Added to config stuff the ability to choose YACC rather than bison. + +Fixed CHAR_UNSIGNED in config.h-dist. + +Second arg. of strtod() is char ** rather than const char **. + +stackb is now initially malloc()'ed since it may be realloc()'ed. + +VMS updates. + +Added SIZE_T_MISSING to config stuff and a default typedef to awk.h. + (Maybe it is not needed on any current systems??) + +re_compile_pattern()'s size is now size_t unconditionally. + +Changes from 2.12.20 to 2.12.21 +------------------------------- + +Corrected missing/gcvt.c. + +Got rid of use of dup2() and thus DUP_MISSING. + +Updated config/sgi33. + +Turned on (and fixed) in cmp_nodes() the behaviour that I *hope* will be in + POSIX 1003.2 for relational comparisons. + +Small updates to test suite. + +Changes from 2.12.19 to 2.12.20 +------------------------------- + +Sloppy, sloppy, sloppy!! I didn't even try to compile the last two + patches. This one fixes goofs in regex.c. + +Changes from 2.12.18 to 2.12.19 +------------------------------- + +Cleanup of last patch. + +Changes from 2.12.17 to 2.12.18 +------------------------------- + +Makefile renamed to Makefile-dist. + +Added alloca() configuration to mkconf. (A bit kludgey.) Just + add a single line containing ALLOCA_PW, ALLOCA_S or ALLOCA_C + to the appropriate config file to have Makefile-dist edited + accordingly. + +Reorganized output flushing to correspond with new semantics of + devopen() on "/dev/std*" etc. + +Fixed rest of last goof!! + +Save and restore errno in do_pathopen(). + +Miscellaneous atari updates. + +Get rid of the trailing comma in the NODETYPE definition (Cray + compiler won't take it). + +Try to make the use of `const' consistent since Cray compiler is + fussy about that. See the changes to `basename' and `myname'. + +It turns out that, according to section 3.8.3 (Macro Replacement) + of the ANSI Standard: ``If there are sequences of preprocessing + tokens within the list of arguments that would otherwise act as + preprocessing directives, the behavior is undefined.'' That means + that you cannot count on the behavior of the declaration of + re_compile_pattern in awk.h, and indeed the Cray compiler chokes on it. + +Replaced alloca with malloc/realloc/free in regex.c. It was much simpler + than expected. (Inside NO_ALLOCA for now -- by default no alloca.) + +Added a configuration file, config/cray60, for Unicos-6.0. + +Changes from 2.12.16 to 2.12.17 +------------------------------- + +Ooops. Goofed signal use in last patch. + +Changes from 2.12.15 to 2.12.16 +------------------------------- + +RENAMED *_dir to just * (e.g. missing_dir). + +Numerous VMS changes. + +Proper inclusion of atari and vms files. + +Added experimental (ifdef'd out) RELAXED_CONTINUATION and DEFAULT_FILETYPE + -- please comment on these! + +Moved pathopen() to io.c (sigh). + +Put local directory ahead in default AWKPATH. + +Added facility in mkconf to echo comments on stdout: lines beginning + with "#echo " will have the remainder of the line echoed when mkconf is run. + Any lines starting with "#" will otherwise be treated as comments. The + intent is to be able to say: + "#echo Make sure you uncomment alloca.c in the Makefile" + or the like. + +Prototype fix for V.4 + +Fixed version_string to not print leading @(#). + +Fixed FIELDWIDTHS to work with strict (turned out to be easy). + +Fixed conf for V.2. + +Changed semantics of /dev/fd/n to be like on real /dev/fd. + +Several configuration and updates in the makefile. + +Updated manpage. + +Include tzset.c and system.c from missing_dir that were accidently left out of + the last patch. + +Fixed bug in cmdline variable assignment -- arg was getting freed(!) in + call to variable. + +Backed out of parse-time constant folding for now, until I can figure out + how to do it right. + +Fixed devopen() so that getline <"-" works. + +Changes from 2.12.14 to 2.12.15 +------------------------------- + +Changed config/* to a condensed form that can be used with mkconf to generate + a config.h from config.h-dist -- much easier to maintain. Please check + carefully against what you had before for a particular system and report + any problems. vms.h remains separate since the stuff at the bottom + didn't quite fit the mkconf model -- hopefully cleared up later. + +Fixed bug in grammar -- didn't allow function definition to be separated from + other rules by a semi-colon. + +VMS fix to #includes in missing.c -- should we just be including awk.h? + +Updated README for texinfo.tex version. + +Updating of copyright in all .[chy] files. + +Added but commented out Michal's fix to strftime. + +Added tzset() emulation based on Rick Adams' code. Added TZSET_MISSING to + config.h-dist. + +Added strftime.3 man page for missing_dir + +More posix: func, **, **= don't work in -W posix + +More lint: ^, ^= not in old awk + +gawk.1: removed ref to -DNO_DEV_FD, other minor updating. + +Style change: pushbak becomes pushback() in yylex(). + +Changes from 2.12.13 to 2.12.14 +------------------------------- + +Better (?) organization of awk.h -- attempt to keep all system dependencies + near the top and move some of the non-general things out of the config.h + files. + +Change to handling of SYSTEM_MISSING. + +Small change to ultrix config. + +Do "/dev/fd/*" etc. checking at runtime. + +First pass at VMS port. + +Improvements to error handling (when lexeme spans buffers). + +Fixed backslash handling -- why didn't I notice this sooner? + +Added programs from book to test suite and new target "bigtest" to Makefile. + +Changes from 2.12.12 to 2.12.13 +------------------------------- + +Recognize OFS and ORS specially so that OFS = 9 works without efficiency hit. + Took advantage of opportunity to tune do_print*() for about 10% win on a + print with 5 args (i.e. small but significant). + +Somewhat pervasive changes to reconcile CONVFMT vs. OFMT. + +Better initialization of builtin vars. + +Make config/* consistent wrt STRTOL_MISSING. + +Small portability improvement to alloca.s + +Improvements to lint code in awk.y + +Replaced strtol() with a better one by Chris Torek. + +Changes from 2.12.11 to 2.12.12 +------------------------------- + +Added PORTS file to record successful ports. + +Added #define const to nothing if not STDC and added const to strtod() header. + +Added * to printf capabilities and partially implemented ' ' and '+' (has an + effect for %d only, silently ignored for other formats). I'm afraid that's + as far as I want to go before I look at a complete replacement for + do_sprintf(). + +Added warning for /regexp/ on LHS of MATCHOP. + +Changes from 2.12.10 to 2.12.11 +------------------------------- + +Small Makefile improvements. + +Some remaining nits from the NeXT port. + +Got rid of bcopy() define in awk.h -- not needed anymore (??) + +Changed private in builtin.c -- it is special on Sequent. + +Added subset implementation of strtol() and STRTOL_MISSING. + +A little bit of cleanup in debug.c, dfa.c. + +Changes from 2.12.9 to 2.12.10 +------------------------------ + +Redid compatability checking and checking for # of args. + +Removed all references to variables[] from outside awk.y, in preparation + for a more abstract interface to the symbol table. + +Got rid of a remaining use of bcopy() in regex.c. + +Changes from 2.12.8 to 2.12.9 +----------------------------- + +Portability improvements for atari, next and decstation. + +Bug fix in substr() -- wasn't handling 3rd arg. of -1 properly. + +Manpage updates. + +Moved support from src release to doc release. + +Updated FUTURES file. + +Added some "lint" warnings. + +Changes from 2.12.7 to 2.12.8 +----------------------------- + +Changed time() to systime(). + +Changed warning() in snode() to fatal(). + +strftime() now defaults second arg. to current time. + +Changes from 2.12.6 to 2.12.7 +----------------------------- + +Fixed bug in sub_common() involving inadequate allocation of a buffer. + +Added some missing files to the Makefile. + +Changes from 2.12.5 to 2.12.6 +----------------------------- + +Fixed bug wherein non-redirected getline could call iop_close() just + prior to a call from do_input(). + +Fixed bug in handling of /dev/stdout and /dev/stderr. + +Changes from 2.12.4 to 2.12.5 +----------------------------- + +Updated README and support directory. + +Changes from 2.12.3 to 2.12.4 +----------------------------- + +Updated CHANGES and TODO (should have been done in previous 2 patches). + +Changes from 2.12.2 to 2.12.3 +----------------------------- + +Brought regex.c and alloca.s into line with current FSF versions. + +Changes from 2.12.1 to 2.12.2 +----------------------------- + +Portability improvements; mostly moving system prototypes out of awk.h + +Introduction of strftime. + +Use of CONVFMT. + +Changes from 2.12 to 2.12.1 +----------------------------- + +Consolidated treatment of command-line assignments (thus correcting the +-v treatment). + +Rationalized builtin-variable handling into a table-driven process, thus +simplifying variable() and eliminating spc_var(). + +Fixed bug in handling of command-line source that ended in a newline. + +Simplified install() and lookup(). + +Did away with double-mallocing of identifiers and now free second and later +instances of a name, after the first gets installed into the symbol table. + +Treat IGNORECASE specially, simplifying a lot of code, and allowing +checking against strict conformance only on setting it, rather than on each +pattern match. + +Fixed regexp matching when IGNORECASE is non-zero (broken when dfa.c was +added). + +Fixed bug where $0 was not being marked as valid, even after it was rebuilt. +This caused mangling of $0. + + +Changes from 2.11.1 to 2.12 +----------------------------- + +Makefile: + +Portability improvements in Makefile. +Move configuration stuff into config.h + +FSF files: + +Synchronized alloca.[cs] and regex.[ch] with FSF. + +array.c: + +Rationalized hash routines into one with a different algorithm. +delete() now works if the array is a local variable. +Changed interface of assoc_next() and avoided dereferencing past the end of the + array. + +awk.h: + +Merged non-prototype and prototype declarations in awk.h. +Expanded tree_eval #define to short-circuit more calls of r_tree_eval(). + +awk.y: + +Delinted some of the code in the grammar. +Fixed and improved some of the error message printing. +Changed to accomodate unlimited length source lines. +Line continuation now works as advertised. +Source lines can be arbitrarily long. +Refined grammar hacks so that /= assignment works. Regular expressions + starting with /= are recognized at the beginning of a line, after && or || + and after ~ or !~. More contexts can be added if necessary. +Fixed IGNORECASE (multiple scans for backslash). +Condensed expression_lists in array references. +Detect and warn for correct # args in builtin functions -- call most of them + with a fixed number (i.e. fill in defaults at parse-time rather than at + run-time). +Load ENVIRON only if it is referenced (detected at parse-time). +Treat NF, FS, RS, NR, FNR specially at parse time, to improve run time. +Fold constant expressions at parse time. +Do make_regexp() on third arg. of split() at parse tiem if it is a constant. + +builtin.c: + +srand() returns 0 the first time called. +Replaced alloca() with malloc() in do_sprintf(). +Fixed setting of RSTART and RLENGTH in do_match(). +Got rid of get_{one,two,three} and allowance for variable # of args. at + run-time -- this is now done at parse-time. +Fixed latent bug in [g]sub whereby changes to $0 would never get made. +Rewrote much of sub_common() for simplicity and performance. +Added ctime() and time() builtin functions (unless -DSTRICT). ctime() returns + a time string like the C function, given the number of seconds since the epoch + and time() returns the current time in seconds. +do_sprintf() now checks for mismatch between format string and number of + arguments supplied. + +dfa.c + +This is borrowed (almost unmodified) from GNU grep to provide faster searches. + +eval.c + +Node_var, Node_var_array and Node_param_list handled from macro rather + than in r_tree_eval(). +Changed cmp_nodes() to not do a force_number() -- this, combined with a + force_number() on ARGV[] and ENVIRON[] brings it into line with other awks +Greatly simplified cmp_nodes(). +Separated out Node_NF, Node_FS, Node_RS, Node_NR and Node_FNR in get_lhs(). +All adjacent string concatenations now done at once. + +field.c + +Added support for FIELDWIDTHS. +Fixed bug in get_field() whereby changes to a field were not always + properly reflected in $0. +Reordered tests in parse_field() so that reference off the end of the buffer + doesn't happen. +set_FS() now sets *parse_field i.e. routine to call depending on type of FS. +It also does make_regexp() for FS if needed. get_field() passes FS_regexp + to re_parse_field(), as does do_split(). +Changes to set_field() and set_record() to avoid malloc'ing and free'ing the + field nodes repeatedly. The fields now just point into $0 unless they are + assigned to another variable or changed. force_number() on the field is + *only* done when the field is needed. + +gawk.1 + +Fixed troff formatting problem on .TP lines. + +io.c + +Moved some code out into iop.c. +Output from pipes and system() calls is properly synchronized. +Status from pipe close properly returned. +Bug in getline with no redirect fixed. + +iop.c + +This file contains a totally revamped get_a_record and associated code. + +main.c + +Command line programs no longer use a temporary file. +Therefore, tmpnam() no longer required. +Deprecated -a and -e options -- they will go away in the next release, + but for now they cause a warning. +Moved -C, -V, -c options to -W ala posix. +Added -W posix option: throw out \x +Added -W lint option. + + +node.c + +force_number() now allows pure numerics to have leading whitespace. +Added make_string facility to optimize case of adding an already malloc'd + string. +Cleaned up and simplified do_deref(). +Fixed bug in handling of stref==255 in do_deref(). + +re.c + +contains the interface to regexp code + +Changes from 2.11.1 to FSF version of same +------------------------------------------ +Thu Jan 4 14:19:30 1990 Jim Kingdon (kingdon at albert) + + * Makefile (YACC): Add -y to bison part. + + * missing.c: Add #include <stdio.h>. + +Sun Dec 24 16:16:05 1989 David J. MacKenzie (djm at hobbes.ai.mit.edu) + + * Makefile: Add (commented out) default defines for Sony News. + + * awk.h: Move declaration of vprintf so it will compile when + -DVPRINTF_MISSING is defined. + +Mon Nov 13 18:54:08 1989 Robert J. Chassell (bob at apple-gunkies.ai.mit.edu) + + * gawk.texinfo: changed @-commands that are not part of the + standard, currently released texinfmt.el to those that are. + Otherwise, only people with the as-yet unreleased makeinfo.c can + format this file. + +Changes from 2.11beta to 2.11.1 (production) +-------------------------------------------- + +Went from "beta" to production status!!! + +Now flushes stdout before closing pipes or redirected files to +synchronize output. + +MS-DOS changes added in. + +Signal handler return type parameterized in Makefile and awk.h and +some lint removed. debug.c cleaned up. + +Fixed FS splitting to never match null strings, per book. + +Correction to the manual's description of FS. + +Some compilers break on char *foo = "string" + 4 so fixed version.sh and +main.c. + +Changes from 2.10beta to 2.11beta +--------------------------------- + +This release fixes all reported bugs that we could reproduce. Probably +some of the changes are not documented here. + +The next release will probably not be a beta release! + +The most important change is the addition of the -nostalgia option. :-) + +The documentation has been improved and brought up-to-date. + +There has been a lot of general cleaning up of the code that is not otherwise +documented here. There has been a movement toward using standard-conforming +library routines and providing them (in missing.d) for systems lacking them. +Improved (hopefully) configuration through Makfile modifications and missing.c. +In particular, straightened out confusion over vprintf #defines, declarations +etc. + +Deleted RCS log comments from source, to reduce source size by about one third. +Most of them were horribly out-of-date, anyway. + +Renamed source files to reflect (for the most part) their contents. + +More and improved error messages. Cleanup and fixes to yyerror(). +String constants are not altered in input buffer, so error messages come out +better. Fixed usage message. Make use of ANSI C strerror() function +(provided). + +Plugged many more memory leaks. The memory consumption is now quite +reasonable over a wide range of programs. + +Uses volatile declaration if STDC > 0 to avoid problems due to longjmp. + +New -a and -e options to use awk or egrep style regexps, respectively, +since POSIX says awk should use egrep regexps. Default is -a. + +Added -v option for setting variables before the first file is encountered. +Version information now uses -V and copyleft uses -C. + +Added a patchlevel.h file and its use for -V and -C. + +Append_right() optimized for major improvement to programs with a *lot* +of statements. + +Operator precedence has been corrected to match draft Posix. + +Tightened up grammar for builtin functions so that only length +may be called without arguments or parentheses. + +/regex/ is now a normal expression that can appear in any expression +context. + +Allow /= to begin a regexp. Allow ..[../..].. in a regexp. + +Allow empty compound statements ({}). + +Made return and next illegal outside a function and in BEGIN/END respectively. + +Division by zero is now illegal and causes a fatal error. + +Fixed exponentiation so that x ^ 0 and x ^= 0 both return 1. + +Fixed do_sqrt, do_log, and do_exp to do argument/return checking and +print an error message, per the manual. + +Fixed main to catch SIGSEGV to get source and data file line numbers. + +Fixed yyerror to print the ^ at the beginning of the bad token, not the end. + +Fix to substr() builtin: it was failing if the arguments +weren't already strings. + +Added new node value flag NUMERIC to indicate that a variable is +purely a number as opposed to type NUM which indicates that +the node's numeric value is valid. This is set in make_number(), +tmp_number and r_force_number() when appropriate and used in +cmp_nodes(). This fixed a bug in comparison of variables that had +numeric prefixes. The new code uses strtod() and eliminates is_a_number(). +A simple strtod() is provided for systems lacking one. It does no +overflow checking, so could be improved. + +Simplification and efficiency improvement in force_string. + +Added performance tweak in r_force_number(). + +Fixed a bug with nested loops and break/continue in functions. + +Fixed inconsistency in handling of empty fields when $0 has to be rebuilt. +Happens to simplify rebuild_record(). + +Cleaned up the code associated with opening a pipe for reading. Gawk +now has its own popen routine (gawk_popen) that allocates an IOBUF +and keeps track of the pid of the child process. gawk_pclose +marks the appropriate child as defunct in the right struct redirect. + +Cleaned up and fixed close_redir(). + +Fixed an obscure bug to do with redirection. Intermingled ">" and ">>" +redirects did not output in a predictable order. + +Improved handling of output buffering: now all print[f]s redirected to a tty +or pipe are flushed immediately and non-redirected output to a tty is flushed +before the next input record is read. + +Fixed a bug in get_a_record() where bcopy() could have copied over +a random pointer. + +Fixed a bug when RS="" and records separated by multiple blank lines. + +Got rid of SLOWIO code which was out-of-date anyway. + +Fix in get_field() for case where $0 is changed and then $(n) are +changed and then $0 is used. + +Fixed infinite loop on failure to open file for reading from getline. +Now handles redirect file open failures properly. + +Filenames such as /dev/stdin now allowed on the command line as well as +in redirects. + +Fixed so that gawk '$1' where $1 is a zero tests false. + +Fixed parsing so that `RLENGTH -1' parses the same as `RLENGTH - 1', +for example. + +The return from a user-defined function now defaults to the Null node. +This fixes a core-dump-causing bug when the return value of a function +is used and that function returns no value. + +Now catches floating point exceptions to avoid core dumps. + +Bug fix for deleting elements of an array -- under some conditions, it was +deleting more than one element at a time. + +Fix in AWKPATH code for running off the end of the string. + +Fixed handling of precision in *printf calls. %0.2d now works properly, +as does %c. [s]printf now recognizes %i and %X. + +Fixed a bug in printing of very large (>240) strings. + +Cleaned up erroneous behaviour for RS == "". + +Added IGNORECASE support to index(). + +Simplified and fixed newnode/freenode. + +Fixed reference to $(anything) in a BEGIN block. + +Eliminated use of USG rand48(). + +Bug fix in force_string for machines with 16-bit ints. + +Replaced use of mktemp() with tmpnam() and provided a partial implementation of +the latter for systems that don't have it. + +Added a portability check for includes in io.c. + +Minor portability fix in alloc.c plus addition of xmalloc(). + +Portability fix: on UMAX4.2, st_blksize is zero for a pipe, thus breaking +iop_alloc() -- fixed. + +Workaround for compiler bug on Sun386i in do_sprintf. + +More and improved prototypes in awk.h. + +Consolidated C escape parsing code into one place. + +strict flag is now turned on only when invoked with compatability option. +It now applies to fewer things. + +Changed cast of f._ptr in vprintf.c from (unsigned char *) to (char *). +Hopefully this is right for the systems that use this code (I don't). + +Support for pipes under MSDOS added. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/PROBLEMS b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/PROBLEMS new file mode 100644 index 0000000..072d56e --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/PROBLEMS @@ -0,0 +1,15 @@ + Copyright (C) 2005, 2006 Free Software Foundation, Inc. + + Copying and distribution of this file, with or without modification, + are permitted in any medium without royalty provided the copyright + notice and this notice are preserved. + +This is a list of known problems in gawk 3.1. +I don't know when this will be fixed, if ever. See also FUTURES +and the gawk.texi doc for other things that need doing. + +1. The interactions with the lexer and yyerror need reworking. It is possible + to get line numbers that are one line off if --compat or --posix is + true and either `nextfile' or `delete array' are used. + + Really the whole lexical analysis stuff needs reworking. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README new file mode 100644 index 0000000..1206429 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README @@ -0,0 +1,113 @@ + Copyright (C) 2005, 2006, 2007 Free Software Foundation, Inc. + + Copying and distribution of this file, with or without modification, + are permitted in any medium without royalty provided the copyright + notice and this notice are preserved. + +README: + +This is GNU Awk 3.1.6. It is upwardly compatible with the Bell Labs +research version of awk. It is almost completely compliant with the +2004 POSIX 1003.1 standard for awk. (See the note below about POSIX.) + +This is a bug fix release. See NEWS and ChangeLog for details. + +Work to be done is described briefly in the FUTURES file. Changes in this +version are summarized in the NEWS file. Please read the LIMITATIONS file. + +Read the file POSIX.STD for a discussion of issues where the standard +says one thing but gawk does something different. + +To format the documentation with TeX, use at least version 2000-10-27.17 +of texinfo.tex. There is a usable copy of texinfo.tex in the doc directory. + +INSTALLATION: + +Check whether there is a system-specific README file for your system under +the `README_d' directory. If there's something there that you should +have read and didn't, and you bug me about it, I'm going to yell at you. + +See the file INSTALL for installation instructions. + +If you have neither bison nor yacc, use the awkgram.c file here. It was +generated with bison, and has no proprietary code in it. (Note that +modifying awkgram.y without bison or yacc will be difficult, at best. +You might want to get a copy of bison from the FSF too.) + +If you have a Windows32, MS-DOS or OS/2 system, use the stuff in the `pc' +directory. Similarly, there is a separate directory for VMS. + +Ports for the Atari and old Tandem systems are supplied, but they are +unsupported. Thus, their code appears in the `unsupported' directory. + +Appendix B of ``GAWK: Effective Awk Programming'' discusses configuration +in detail. The configuration process is based on GNU Autoconf and +Automake. + +After successful compilation, do `make check' to run the test suite. +There should be no output from the `cmp' invocations except in the +cases where there are small differences in floating point values, and +possibly in the case of strftime. Several of the tests ignore errors +on purpose; those are not a problem. If there are other differences, +please investigate and report the problem. + +PRINTING THE MANUAL + +The `doc' directory contains a recent version of texinfo.tex, which will +be necessary for printing the manual. Use `make dvi' to get a DVI file +from the manual. In the `doc' directory, use `make postscript' to get +PostScript versions of the manual, the man page, and the reference card. + +BUG REPORTS AND FIXES (Un*x systems): + +Please coordinate changes through Arnold Robbins. In particular, see +the section in the manual on reporting bugs. Note that comp.lang.awk +is about the worst place to post a gawk bug report. Please, use the +mechanisms outlined in the manual. + +Email should be sent to bug-gawk@gnu.org. This address sends mail to +Arnold Robbins and the general GNU utilities bug list. The advantage +to using this address is that bug reports are archived at GNU Central. + +Arnold Robbins + +BUG REPORTS AND FIXES, non-Unix systems: + +Amiga: + Fred Fish + fnf@ninemoons.com + +Alpha/Linux: + Michal Jaegermann + michal@gortel.phys.ualberta.ca + +BeOS: + Martin Brown + mc@whoever.com + +MS-DOS: + Scott Deifik + scottd.mail@sbcglobal.net + + Darrel Hankerson + hankedr@mail.auburn.edu + +MS-Windows: + Juan Grigera + juan@biophnet.unlp.edu.ar + +OS/2: + andreas.buening@@nexgo.de + +Tandem: + Stephen Davies + scldad@sdc.com.au + (Original Tandem port) + + Ralf Wildenhues + <Ralf.Wildenhues@gmx.de> + POSIX-compliant Tandem systems + +VMS: + Pat Rankin + rankin@pactechdata.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.FIRST b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.FIRST new file mode 100644 index 0000000..4957cb3 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.FIRST @@ -0,0 +1,21 @@ +Sat Feb 18 23:07:55 EST 1995 + +Starting with 2.15.6, gawk will preserve the value of NF and $0 for +the last record read into the END rule(s). This is important to you +if your program uses + + print + +in an END rule to mean + + print "" + +(i.e., print nothing). Examine your awk programs carefully to make sure +that they use `print ""' instead of `print', otherwise you will get +strange results. + +If you send me email about this, without having read this +file, I will yell at you. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.linux b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.linux new file mode 100644 index 0000000..9ba15c5 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.linux @@ -0,0 +1,21 @@ +Thu Apr 17 14:41:17 EDT 1997 + +Some Linux systems, notably RedHat systems through RedHat 4.1, have the +symbolic links for /dev/stdin and /dev/stdout messed up. Specifically, +/dev/stdin is linked to ../proc/self/fd/1 and /dev/stdout to +../proc/self/fd/0. This is backwards. This causes strange behavior +when using those files from within gawk. + +Removing and redoing the symlinks fixes the problem. It is fixed in +post-4.1 RedHat Linux. + +Arnold Robbins +arnold@skeeve.com + +Sun Aug 3 15:07:06 EDT 1997 + +As of version 3.1 of gawk, this is no longer a problem, since gawk now +completely interprets the special file names internally. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sco b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sco new file mode 100644 index 0000000..71494b7 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sco @@ -0,0 +1,67 @@ +Tue Dec 24 22:41:39 EST 1996 + +SCO's awk has a -e option which is similar to gawk's --source option, +allowing you to specify the script anywhere on the awk command line. + +This can be a problem, since gawk will install itself as `awk' in +$(bindir). If this is ahead of /bin and /usr/bin in the search path, +several of SCO's scripts that use -e will break, since gawk does not +accept this option. + +The solution is simple. After doing a `make install', do: + + rm -f /usr/local/bin/awk # or wherever it is installed. + +This removes the `awk' symlink so that SCO's programs will continue +to work. + +If you complain to me about this, I will fuss at you for not having +done your homework. + +Arnold Robbins +arnold@skeeve.com + +--------------------------- +Date: 14 Oct 1997 12:17 +0000 +From: Leigh Hebblethwaite <LHebblethwaite@transoft.com> +To: bug-gnu-utils@prep.ai.mit.edu + +I've just built gawk 3.0.3 on my system and have experienced a problem +with the routine pipeio2.awk in the test suite. However the problem +appears to be in the tr command rather than gawk. + +I'm using SCO Open Server 5. On the version I have there appears to be +a problem with tr such that: + + tr [0-9]. ........... + +does NOT translate 9s. This means that the output from: + + echo " 5 6 7 8 9 10 11" | tr [0-9]. ........... + +is: + + . . . . 9 .. .. + +This problem causes the pipeio2 test to be reported as a failure. + +Note that the following variation on the tr command works fine: + + tr 0123456789. ........... + +For your info the details of my system are summarised by the out put +of the uname -X command, which is: + +System = SCO_SV +Node = sgscos5 +Release = 3.2v5.0.2 +KernelID = 96/01/23 +Machine = Pentium +BusType = EISA +Serial = 4EC023443 +Users = 5-user +OEM# = 0 +Origin# = 1 +NumCPU = 1 + + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sony b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sony new file mode 100644 index 0000000..29ba875 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.sony @@ -0,0 +1,12 @@ +Sun Jan 19 23:13:50 EST 1997 + +> Machine: SONY NWS-5000 (MIPS r4000) +> OS : NEWS-OS 4.2.1 (4.3BSD compatible) +> This OS doesn't have `uname' +> Tools : gcc-2.7.2.1, bison-1.25, cmp-2.7, bash-2.0 + +This system has the same problem with the test/tweakfld case that Ultrix MIPS +has. See the README.ultrix file for details. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.ultrix b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.ultrix new file mode 100644 index 0000000..917f02f --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.ultrix @@ -0,0 +1,46 @@ +When compiling on DECstation running Ultrix 4.0 a command 'cc -c -O +regex.c' is causing an infinite loop in an optimizer. Other sources +compile fine with -O flag. If you are going to use this flag either +add a special rule to Makefile for a compilation of regex.c, or issue +'cc -c regex.c' before hitting 'make'. + +From: Steve Simmons <scs@wotan.iti.org> +Subject: Non-bug report on gawk 2.13.2 +To: david@cs.dal.ca, arnold@skeeve.atl.ga.us +Date: Thu, 25 Jul 1991 13:45:38 -0300 + +Just fyi -- it passes tests with flying colors under Ultrix 4.2. The +README.ultrix file applies more than ever. You might want to add +these paragraphs to it: + + As of Ultrix 4.2 the optimise works for regex.c, but you must give an + additional switch to get everything optimised. Using '-Olimit 1500' + does the job. Without the switch gawk will compile and run correctly, + but you will get complaints about lost optimisations in builtin.c, + awk.tab.c and regex.c. + +From: Arnold Robbins <arnold@math.utah.edu> +Date: Sun Sep 8 07:05:07 EDT 1996 + +On Decstations using Ultrix 4.3, the tweakfld test case will fail. It +appears that routines in the math library return very small but non-zero +numbers in cases where most other systems return zero. + +From: Juergen Kahrs <jkahrs@castor.atlas.de> +Date: Wed Jan 17 13:15:34 MET 2001 + +On Ultrix 4.3, configure like this: + + ./configure --disable-nls + +In custom.h, we defined HAVE_MKTIME in order to avoid a linker error. +If you compile with + + make check + +every test will pass, except for the badargs test: + + *** Error code 1 (ignored) + +This shouldnt cause problems. + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.yacc b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.yacc new file mode 100644 index 0000000..6332986 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/OBSOLETE/README.yacc @@ -0,0 +1,10 @@ +Sat Jan 28 22:07:17 EST 1995 + +Some older versions of yacc (notably Ultrix's) have limits on the depth +of the parse stack. This only shows up when gawk is dealing with deeply +nested control structures, such as those in `awf'. + +The problem goes away if you use either bison or Berkeley yacc. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.VMS b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.VMS new file mode 100644 index 0000000..4d19398 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.VMS @@ -0,0 +1,81 @@ + +Compiling GAWK on VMS: + + There's a DCL command procedure that will issue all the necessary +CC and LINK commands, and there's also a Makefile for use with the MMS +utility. From the source directory, use either + |$ @[.VMS]VMSBUILD.COM +or + |$ MMS/DECRIPTION=[.VMS]DECSRIP.MMS GAWK + +DEC C -- use either vmsbuild.com or descrip.mms as is. +VAX C -- use `@vmsbuild VAXC' or `MMS/MACRO=("VAXC")'. On a system + with both VAX C and DEC C installed where DEC C is the default, + use `MMS/MACRO=("VAXC","CC=CC/VAXC")' for the MMS variant; for + the vmsbuild.com variant, any need for `/VAXC' will be detected + automatically. +GNU C -- use `@vmsbuild GNUC' or `MMS/MACRO=("GNUC")'. On a system + where the GCC command is not already defined, use either + `@vmsbuild GNUC DO_GNUC_SETUP' or + `MMS/MACRO=("GNUC","DO_GNUC_SETUP")'. + + Tested under Alpha/VMS V7.1 using DEC C V6.4. GAWK should work +without modifications for VMS V4.6 and up. + + +Installing GAWK on VMS: + + All that's needed is a 'foreign' command, which is a DCL symbol +whose value begins with a dollar sign. + |$ GAWK :== $device:[directory]GAWK +(Substitute the actual location of gawk.exe for 'device:[directory]'.) +That symbol should be placed in the user's login.com or in the system- +wide sylogin.com procedure so that it will be defined every time the +user logs on. + + Optionally, the help entry can be loaded into a VMS help library. + |$ LIBRARY/HELP SYS$HELP:HELPLIB [.VMS]GAWK.HLP +(You may want to substitute a site-specific help library rather than +the standard VMS library 'HELPLIB'.) After loading the help text, + |$ HELP GAWK +will provide information about both the gawk implementation and the +awk programming language. + + The logical name AWK_LIBRARY can designate a default location +for awk program files. For the '-f' option, if the specified filename +has no device or directory path information in it, Gawk will look in +the current directory first, then in the directory specified by the +translation of AWK_LIBRARY if it the file wasn't found. If the file +still isn't found, then ".awk" will be appended and the file access +will be re-tried. If AWK_LIBRARY is not defined, that portion of the +file search will fail benignly. + + +Running GAWK on VMS: + + Command line parsing and quoting conventions are significantly +different on VMS, so examples in _The_GAWK_Manual_ or the awk book +often need minor changes. They *are* minor though, and all the awk +programs should run correctly. + + Here are a couple of trivial tests: + |$ gawk -- "BEGIN {print ""Hello, World!""}" + |$ gawk -"W" version !could also be -"W version" or "-W version" +Note that upper- and mixed-case text must be quoted. + + The VMS port of Gawk includes a DCL-style interface in addition +to the original shell-style interface. See the help entry for details. +One side-effect of dual command line parsing is that if there's only a +single parameter (as in the quoted string program above), the command +becomes ambiguous. To work-around this, the normally optional "--" +flag is required to force shell rather than DCL parsing. If any other +dash-type options (or multiple parameters such as data files to be +processed) are present, there is no ambiguity and "--" can be omitted. + + The logical name AWKPATH can be used to override the default +search path of "SYS$DISK:[],AWK_LIBRARY:" when looking for awk program +files specified by the '-f' option. The format of AWKPATH is a comma- +separated list of directory specifications. When defining it, the +value should be quoted so that it retains a single translation, not a +multi-translation RMS searchlist. + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.aix b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.aix new file mode 100644 index 0000000..283d387 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.aix @@ -0,0 +1,6 @@ +Tue Mar 11 13:21:26 IST 2003 +============================ + +On AIX 4.2 systems, you need: + + ./configure --disable-nls && make all check install diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.atari b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.atari new file mode 100644 index 0000000..0c7fd74 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.atari @@ -0,0 +1,26 @@ +Sun May 2 18:40:46 IDT 1999 + +See the README.1st file in the atari directory. + +-------------------------------------------------------- +Gawk on the Atari has been compiled and tested using gcc, both +with and without -mshort flag. Other compilers can be used but if +sizeof(pointer) != sizeof(int) this code will not compile correctly +with a non-ANSI compiler (prototypes and library). + +Compiled executables were tested and passed successfully a test suite +similar to 'make test'. Required changes are minor and minor +modifications are due to differences in environment and/or shell. If +a need will arise a modified test suite with a driving Makefile (for +gulam) is available on a request from Michal Jaegermann, +michal@gortel.phys.ualberta.ca or michal@ellpspace.math.ualberta.ca, +via e-mail. + +Sample files atari/Makefile.st, atari/Makefile.awklib and +atari/config.h assume gcc compilation and execution under TOS; it is +likely that one would want to change it for another setup. If they +are ok then copy atari/Makefile.st to Makefile, atari/config.h to +config.h and atari/Makefile.awklib to awklib/Makefile.. Pay attention +to code fragments bracketed by '#ifdef atarist ... #endif'. These +modifications may not be required/desired with a different OS and/or +libraries. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.beos b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.beos new file mode 100644 index 0000000..e0a8189 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.beos @@ -0,0 +1,86 @@ +README for GNU awk under BeOS +Last updated MCB, Tue Feb 6 10:15:46 GMT 2001 + +BeOS port contact: Martin C Brown (mc@whoever.com) + +Building/Installing +-------------------------- + +Since BeOS DR9, all the tools that you should need to build gawk are now +included with BeOS. The process is basically identical to the Unix process +of running configure and then make. Full instructions are given below: + +You can compile gawk under BeOS by extracting the standard sources, +and running the configure script. You MUST specify the location prefix +for the installation directory. Under BeOS DR9 and beyond the best +directory to use is /boot/home/config, so the configure command +would be: + +$ configure --prefix=/boot/home/config + +This will install the compiled application into /boot/home/config/bin, +which is already specified in the standard PATH. + +Once the configuration process has been completed, you can run make and +then make install: + +$ make +.... +$ make install + +Socket Notes +---------------------- + +Due to the socket implementation under BeOS not all of the features under +gawk's socket implementation may work properly. In particular: + + BeOS does not support a BSD SO_LINGER option, so sockets cannot remain + open after a close if data is still present on the incoming buffer. + + BeOS does not allow data to be read from a socket without removing the data + from the buffer (peek). If you need to use this feature in gawk, create a + separate input buffer and peek into your own copy, rather than the OS version. + + BeOS does not support RAW socket connections, only UDP or TCP. + +Note that these are BeOS Unix-layer compatibility problems, and only affect certain +aspects of network communication. Most socket based gawk scripts, and any scripts +that do not rely on sockets should work fine (excepting any other notes in this section). + +File Handle Notes +--------------------------- + +Expect the multiple file test (when running make check) to fail. The reason for this is +explained in the email shown below: + +------------------------------------------------------- +From mc@whoever.com Sun Jul 23 17:06:38 2000 +Date: Sun, 23 Jul 2000 07:23:49 +0100 +Subject: Re: gawk-3.0.5 results on BeOS +From: Martin C Brown <mc@whoever.com> +To: Aharon Robbins <arnold@skeeve.com>, <haible@ilog.fr> + +Arnold/Bruno, + +> This is a known BeOS problem. I am cc'ing the BeOS port person. +> Sorry I don't have a fix. + +This problem is directly related to the FOPEN_MAX/OPEN_MAX parameter used in +the stdio library by the BeOS. It seems that the BeOS strictly enforces this +number to the point that opening the 128th file causes all previously opened +files (except stdin/out/err) to be closed - hence the bad number. + +I've tried this outside of gawk and the same thing happens, so it's not a +gawk problem. + +I've spent the past few days trying to find a suitable workaround, but it's +obviously difficult trying to patch a kernel from the outside :)) + +I'll be reporting this as a bug to Be shortly. + +MC + +-- +Martin 'MC' Brown, mc@mcslp.com http://www.mcwords.com +Writer, Author, Consultant +'Life is pain, anyone who says differently is selling something' diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.cygwin-dynamic b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.cygwin-dynamic new file mode 100644 index 0000000..948538f --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.cygwin-dynamic @@ -0,0 +1,88 @@ +From: courierdavid@hotmail.com +Newsgroups: comp.lang.awk +Subject: Re: Compiling gawk extensions under Cygwin +Date: 14 Mar 2005 20:47:09 -0800 +Organization: http://groups.google.com +Lines: 67 +Message-ID: <1110862029.175727.109280@o13g2000cwo.googlegroups.com> +References: <1e4e8dbe.0501140813.18248833@posting.google.com> + <u62nb2-pro.ln1@news.heiming.de> +NNTP-Posting-Host: 194.237.142.24 +Mime-Version: 1.0 +Content-Type: text/plain; charset="iso-8859-1" +X-Trace: posting.google.com 1110862033 8921 127.0.0.1 (15 Mar 2005 04:47:13 GMT) +X-Complaints-To: groups-abuse@google.com +NNTP-Posting-Date: Tue, 15 Mar 2005 04:47:13 +0000 (UTC) +User-Agent: G2/0.2 +Complaints-To: groups-abuse@google.com +Injection-Info: o13g2000cwo.googlegroups.com; posting-host=194.237.142.24; + posting-account=Iz4C5wwAAABx1yG_ft8eEAI99Wu1Tku1 +Path: news.012.net.il!seanews2.seabone.net!newsfeed.albacom.net!news.mailgate.org!newsfeed.stueberl.de!proxad.net!64.233.160.134.MISMATCH!postnews.google.com!o13g2000cwo.googlegroups.com!not-for-mail +Xref: news.012.net.il comp.lang.awk:21835 + +Thanks for your help there Michael. I wouldn't have thought of that one +myself without your help :-) + +Anyway - for those who must stick with Cygwin here's a method that +works using the mingw32 makefiles and some modifications: + +Basically you need to extract all exportable symbol names from the +gawk.exe file into a text file and then create a dummy library file +which we can link against on Cygwin. You then throw the library file +away because in reality we use the gawk.exe file as the provider of +those functions. + +1. First grab the gawk source, e.g. gawk-3.1.4.tar.bz2 and decompress +it. +2. Move to the gawk-3.1.4 directory you just created. +3. cp pc/* . (copy the pc directory into the main one) +4. edit makefile - uncomment lines "DYN_FLAGS", "DYN_EXP", "DYN_OBJ" +and "DYN_MAKEXP=$(DMEmingw32) +5. make mingw32 (make a gawk.exe) +6. run "gcc -o gawk.exe array.o builtin.o eval.o field.o gawkmisc.o +io.o main.o ext.o msg.o node.o profile.o re.o version.o dlfcn.o +gawk.exp awkgram.o getid.o popen.o getopt.o getopt1.o dfa.o regex.o +random.o" (i.e. remove the -s from the compile command from the +makefile so the symbols are left in gawk.exe) + +now export all symbols from gawk.exe into foo.def so that we can put +these in our library +7. echo EXPORTS > foo.def +8. nm gawk.exe | grep -E ' [TBD] _' | sed 's/.* [TBD] _//' >> foo.def +9. cp foo.def gawkw32.def + +build the new library with all symbols included +10. make mingw32 + +Now you will see a file "libgawk.a" which you can link against to +create extensions. For example to build an extension called "file" run: + +gcc -shared -dll -DHAVE_CONFIG_H -I . extension/file.c -o file.dll -L . +-lgawk + +Then you can load it in gawk using the expression: + +extension("./file.dll", "dlload"); + +You must use the gawk you compiled from source though. It won't work +with any other gawk unfortunately :-( But that's OK because the +stripped gawk is not too big in size. + +Cheers, +Dave. + +Michael Heiming wrote: +> In comp.lang.awk David Smith <courierdavid@hotmail.com>: +> > Has anyone managed to compile gawk extensions (such as "filefuncs") +> > under Cygwin? +> +> Solution is pretty simple, install a real OS, Linux/*BSD or any +> other unix and this and further problems won't happen. +> +> Good luck +> +> -- +> Michael Heiming (X-PGP-Sig > GPG-Key ID: EDD27B94) +> mail: echo zvpunry@urvzvat.qr | perl -pe 'y/a-z/n-za-m/' +> #bofh excuse 242: Software uses US measurements, but the OS +> is in metric... diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.hpux b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.hpux new file mode 100644 index 0000000..78e6f35 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.hpux @@ -0,0 +1,78 @@ +Wed Jul 28 16:28:42 IDT 2004 +============================ +As of gawk 3.1.4, configure should correctly handle HP-UX and +I18N issues. -- Arnold +-------------------------------------------------------------- +2003-12-10 15:19:38 EST +Michael Elizabeth Chastain <mec.gnu@mindspring.com> + +I built and tested gawk on hppa-hp-hpux11.11 and ia64-hp-hpux11.23. +All the tests in the test suite passed. + +I built with these compilers: + + gcc 3.3.2 + hp ansi C from /opt/ansic/bin + hp aCC from /opt/aCC/bin + +I ran into these problems: + + NLS does not work; configure with --disable-nls. + -D_XOPEN_SOURCE=500 does not work. + Multibyte support is not available. + +To get multibyte support, the following ugly hack might work: +--- gawk-3.1.3.orig/custom.h 2003-06-09 17:45:53.000000000 +0200 ++++ gawk-3.1.3/custom.h 2003-12-17 15:55:04.000000000 +0100 +@@ -101,4 +101,7 @@ + #undef HAVE_TZSET + #define HAVE_TZSET 1 + #define _TZSET 1 ++/* an ugly hack: */ ++#include <sys/_mbstate_t.h> ++#define HAVE_MBRTOWC 1 + #endif + +------------------------------- +Mon, 27 May 2002 17:55:46 +0800 + +The network support "|&" may not work under HP-UX 11. +An error message appears similar to this: +gawk: test_script.awk:3: fatal: get_a_record: iop->buf: can't allocate -61246 +bytes of memory (not enough space) + +Solution: +This is a bug in the fstat() call of HP-UX 11.00, please apply +the cumulative ARPA Transport patch PHNE_26771 to fix it. + +The following is the related description in PHNE_26771: + + Customer's application gets the wrong value from fstat(). + Resolution: + The value returned via st_blksize is now retrieved + from the same info as in 10.20. + +In case you cannot apply the HP patch, the attached patch to gawk source +might work. + +Xiang Zhao <xiangz@163.net> +Stepan Kasal <kasal@math.cas.cz> + +diff -ur gawk-3.1.3.a0/posix/gawkmisc.c gawk-3.1.3.a1/posix/gawkmisc.c +--- gawk-3.1.3.a0/posix/gawkmisc.c Sun May 25 15:26:19 2003 ++++ gawk-3.1.3.a1/posix/gawkmisc.c Fri Jul 11 08:56:03 2003 +@@ -126,7 +126,13 @@ + * meant for in the first place. + */ + #ifdef HAVE_ST_BLKSIZE +-#define DEFBLKSIZE (stb->st_blksize > 0 ? stb->st_blksize : BUFSIZ) ++ /* ++ * 100k must be enough for everybody, ++ * bigger number means probably a bug in fstat() ++ */ ++#define MAXBLKSIZE 102400 ++#define DEFBLKSIZE (stb->st_blksize > 0 && stb->st_blksize <= MAXBLKSIZE \ ++ ? stb->st_blksize : BUFSIZ) + #else + #define DEFBLKSIZE BUFSIZ + #endif diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.ia64 b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.ia64 new file mode 100644 index 0000000..844d6a6 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.ia64 @@ -0,0 +1,30 @@ +Tue Mar 11 13:19:45 IST 2003 +============================ + +On real Itanium systems, builds with GCC are fine. If you're using the +Intel compiler `ecc', you need: + + CC=ecc ./configure && make all check install CFLAGS='-g -Drestrict=' + +Tue Apr 16 13:55:15 IDT 2002 +============================ +The current version of the IA-64 environment builds gawk without any problems. + +Wed Apr 25 17:17:01 IDT 2001 +============================ + +The Intel IA-64 emulation environment that sits on top of 32-bit Linux +has problems. Gawk does not work on it. + +1. The `sgicc' compiler lies to `configure' and pretends it's gcc. But it +really isn't, and several things don't work. + +2. Even if used with gcc, the executable doesn't run; somehow quoted +strings don't stay as one argument to gawk, which is, of course, +disastrous. + +3. It's flaky; initially `configure' wouldn't even get past the getpgrp +test. Then later it would. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.macos b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.macos new file mode 100644 index 0000000..684e028 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.macos @@ -0,0 +1,32 @@ +Mon Jun 11 05:37:03 IDT 2007 +============================ + +The notes below no longer seem to apply. + +Mon Jul 4 09:55:22 IDT 2005 +============================ + +If you use GCC 4.0 under Mac OS X to compile gawk with optimization, +AND multibyte support is *disabled*, the `ignrcas2' test fails. This is +a compiler bug. Either compile it without optimization, or use gcc-3.3. + +All the other tests pass. + +Happily, the default is for the multibyte support to be enabled, so all +the tests pass by defualt. + + +Sun Dec 3 18:11:09 IST 2000 +============================ + +The `posix' test will fail because of output format differences but this +is apparently otherwise benign. + +Gawk uses the system's mktime(3) routine, even though Autoconf thinks +it's broken, so Caveat Emptor. + +If you ask me about either of these I will fuss at you for not having +done your homework. + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.multibyte b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.multibyte new file mode 100644 index 0000000..135ba86 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.multibyte @@ -0,0 +1,29 @@ +Fri Jun 3 12:20:17 IDT 2005 +============================ + +As noted in the NEWS file, as of 3.1.5, gawk uses character values instead +of byte values for `index', `length', `substr' and `match'. This works +in multibyte and unicode locales. + +Wed Jun 18 16:47:31 IDT 2003 +============================ + +Multibyte locales can cause occasional weirdness, in particular with +ranges inside brackets: /[....]/. Something that works great for ASCII +will choke for, e.g., en_US.UTF-8. One such program is test/gsubtst5.awk. + +By default, the test suite runs with LC_ALL=C and LANG=C. You +can change this by doing (from a Bourne-style shell): + + $ GAWKLOCALE=some_locale make check + +Then the test suite will set LC_ALL and LANG to the given locale. + +As of this writing, this works for en_US.UTF-8, and all tests +pass except gsubtst5. + +For the normal case of RS = "\n", the locale is largely irrelevant. +For other single byte record separators, using LC_ALL=C will give you +much better performance when reading records. Otherwise, gawk has to +make several function calls, *per input character* to find the record +terminator. You have been warned. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pc b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pc new file mode 100644 index 0000000..9ee2f12 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pc @@ -0,0 +1,378 @@ +This is the README for GNU awk 3.1 under Windows32, OS/2, and DOS. + + Gawk has been compiled and tested under OS/2, DOS, and Windows32 using +the GNU development tools from DJ Delorie (DJGPP; DOS with special +support for long filenames under Win95), Eberhard Mattes (EMX; OS/2, +DOS, and Windows32 with rsxnt), and Jan-Jaap van der Heijden and Mumit Khan +(Mingw32; Windows32). Microsoft Visual C/C++ can be used to build a Windows32 +version for Windows 9x/NT, and MSC can be used to build 16-bit versions +for DOS and OS/2. (As of 3.1.2, the MSC version doesn't work, but the +maintainer for it is working on fixing it.) + + The cygwin environment (http://www.cygwin.com) may also be used +to compile and run gawk under Windows. For cygwin, building and +installation is the same as under Unix: + + tar -xvpzf gawk-3.1.x.tar.gz + cd gawk-3.1.x + ./configure && make + +The `configure' step takes a long time, but works otherwise. + +******************************** N O T E ********************************** +* The `|&' operator only works when gawk is compiled for cygwin. Neither * +* socket support nor two-way pipes work in any other Windows environment! * +*************************************************************************** + +Building gawk +------------- + +Building on DOS or Windows environments can be troublesome, in part due +to shell limitations, the long filename issue, and various Windows32 pipe +considerations. The situation is somewhat better on OS/2. The general +recommendation is to use tools (especially make) which are compatible +or built with the compiler to be used on gawk. + +Building versions which do not understand long filenames on systems +that offer long names is a special case. The maintainers unpack the +distribution and process using utilities (unzip, make, cmp) which do not +use long filenames. (For example, the djgpp tools will work if LFN=n is +set in the environment.) + +Copy the files in the `pc' directory (EXCEPT for `ChangeLog') to the +directory with the rest of the gawk sources. (The subdirectories of +`pc' need not be copied.) The makefile contains a configuration +section with comments, and may need to be edited in order to work +with your make utility. + +The "prefix" line in the Makefile is used during the install of gawk +(and in building igawk.bat and igawk.cmd). Since the libraries for +gawk will be installed under $(prefix)/lib/awk (e.g., /gnu/lib/awk), +it is convenient to have this directory in DEFPATH of config.h. + +The makefile contains a number of targets for building various DOS and +OS/2 versions. A list of targets will be printed if the make command is +given without a target. As an example, to build gawk using the djgpp +tools, enter "make djgpp". + + +Testing and installing gawk +--------------------------- + +The command "make test" (and possibly "make install") requires several +Unix-like tools, including an sh-like shell, sed, cp, and cmp. Only +dmake and GNU make are known to work on "make test". + +There are two methods for the install: Method 1 uses a typical Unix-like +approach and requires cat, cp, mkdir, sed, and sh; method 2 uses gawk +and batch files. See the configuration section of the makefile. + +The file test/Makefile will need some editing (especially for DOS). A +sample makefile with comments appears in pc/Makefile.tst, and can be +used to modify test/Makefile for your platform. In addition, some +files in the test directory may need to have their end-of-line markers +converted, as described in Makefile.tst. + +As with building gawk, the OS, shell, and long filename issues come into +play when testing, too. If you are testing gawk on a LFN aware system with +some LFN aware tools, you may have problems if the shell that you specify in +test/Makefile is not LFN aware. This problem will apply whether or not +you are building a LFN aware gawk. See the comments in pc/Makefile.tst +for more information on this. + +It is routine to install by hand, but note that the install target also +builds igawk.bat and igawk.cmd, which are used to add an include +facility to gawk (and which require sh). + + +Notes +----- + +1. Collections containing gawk and various utilities for OS/2 or DOS +include the GNUish Project, Rommel's OS/2 collection at LEO, and the +djgpp collection. + +The GNUish Project was designed to bring GNU-like programs to small +systems running OS/2 and DOS. Binary distributions of gawk are +maintained in GNUish, and include 16bit OS/2 and DOS, 32bit djgpp, +and Windows32 versions. Information on GNUish is available via + + http://www.simtel.net/simtel.net/ +or + ftp://ftp.simtel.net/simtelnet/gnu/gnuish + +Documentation appears in gnuish.htm (html) or gnuish.inf (info). + +Kai Uwe Rommel <rommel@leo.org> maintains a (mostly OS/2) collection at + + http://www.leo.org/archiv/os2 or ftp://ftp.leo.org + +It contains emx-compiled (32bit) versions of gawk for OS/2, DOS, and Windows32, +along with many OS/2 utilities. + +The djgpp collection at + + ftp://ftp.delorie.com/pub/djgpp/current/v2gnu/ + +contains a djgpp-compiled (32bit) version of gawk, along with many +djgpp-compiled utilities. + +The Mingw32 collection at http://www.mingw.org contains links to ported +software. The site by Jan-Jaap van der Heijden + + http://agnes.dida.physik.uni-essen.de/~janjaap/ + +is apparently no longer maintained, but it was accessible as of Jan 2001 +and may contain files of interest. + + +2. The following table illustrates some of the differences among the various +compiled versions of gawk. For example, the djgpp version runs on all the +systems, but with differing capabilities: it supports long filenames under +Win-9x but not under NT, and it runs as a DPMI application under OS/2 (which +translates into "works in the DOS-box under OS/2, but not as a true OS/2 +application"). + + DOS Win/WfW Win9x NT OS/2 + ------------------------------------------------------- + djgpp | DPMI DPMI DPMI DPMI,NoLFN DPMI + emx(1) | N N N N OS2 + emxbnd(2) | VCPI,DPMI DPMI DPMI,NoLFN DPMI,NoLFN DPMI,OS2 + emxnt(3) | N N Windows32 Windows32 N + msc(4) | 16 16 16,NoLFN 16,NoLFN 16,DOS + msc6bnd | 16 16 16,NoLFN 16,NoLFN 16,DOS,OS2 + msc6os2 | N N N N 16,OS2 + vcWin32 | N N Windows32 Windows32 N + mingw32 | N N Windows32 Windows32 N + + (1) Requires emxrt. + + (2) May run as a DPMI app in plain DOS and in a DOS-shell under OS/2 + or Windows, and as a true OS/2 application under OS/2. DPMI + requires rsxnt, and VCPI or use as an OS/2 app requires emxrt. + + (3) Requires rsxnt. + + (4) When compiling, MSC 8, when run in Windows 9x, will require that if + files are listed in #include statements with LFNs + (eg. <patchlevel.h>), that the file be named with the LFN. + + 16 16bit; limited capacity, especially under DOS. + + DOS Runs as a DOS application. + + DPMI Dos Protected Mode Interface; program runs as a DOS application. + Under plain DOS, a DPMI server (such as csdpmi from the djgpp + archives) is required. See also VCPI. + + emxrt The emx runtime, available from LEO. + + N Not supported. + + NoLFN No long filename support. + + OS2 Runs as an OS/2 application. + + rsxnt Runtimes for use with DPMI or Windows32. + + VCPI Virtual Control Program Interface; program runs as a DOS app. + Memory managers (such as emm386) may need adjustment. VCPI cannot + be used under OS/2, Win/WfW, Win-95, or NT. See also DPMI. + +Windows32 Uses/supports Windows32 features (such as long filenames). + +Reportedly, NTEmacs (another Windows32 program) can run programs such as +Windows32-gawk asynchronously. Similarly, as native OS/2 versions are a +plus under OS/2 even for command-line programs, native Windows32 versions +may be desired under NT and Win95. + +Users interested in Windows32 applications may also wish to examine the +Cygnus cygwin project at http://sources.redhat.com/cygwin/ or the +Mingw32 work at http://www.mingw.org. Windows32 gawk will often require +that utilities run from within gawk be Windows32 (e.g., the tests place this +requirement on the cat utility). + + +3. An sh-like shell may be useful for awk programming (and is essential +for running "make test"). Stewartson's sh (OS/2 and DOS) is a good +choice, and may be found in GNUish. + +Stewartson's shell uses a configuration file (see "Command Line Building" +in the sh manual page), and it may be necessary to edit the entry for +gawk. The following entries are suggested: + + -- $(EXTENDED_LINE) -- -- Comment only, not part of file -- + gawk = unix ignoretype # emxbnd + gawk = unix # djgpp; msc* with Stewartson's stdargv + # No entry for emx or for msc* without stdargv + gawk = ignoretype # if you want something which which always work + # --but without the use of @-include files. + +However, users of djgpp versions of gawk may prefer "dos" over "unix" +in the above, due to the way djgpp handles @-include files. Entries +for other other utilities (such as sed and wc) may need to be edited +in order to match your specific collection of programs. + +Daisuke Aoyama <jack@st.rim.or.jp> has ported Bash 1.14.7 to djgpp. +This version worked flawlessly in tests with djgpp gawk and make. bash +is now part of the djgpp collection; the older port may be found on + + http://www.neongenesis.com/~jack/djgpp-work/beta/index.html + +Under OS/2, bash should be a good choice; however, there has been some +trouble getting a solid version. As of Feb-95, there are two bash ports, +available at LEO under shells/gnu/. + +LEO also contains a Korn shell (ksh), tcsh, zsh, and a demo of +Hamilton's C shell, but these have not been tested with gawk by the +maintainers. Reports are welcomed. + +Users of the emx versions of gawk may wish to set EMXSHELL, which +overrides COMSPEC when running shells from emx programs. Similarly, +the djgpp version of gawk respects SHELL. + +Compatibility among shells and various utilities (including gawk) +continues to be a problem. Stewartson's shell may be the best choice +for emx-compiled programs (although djgpp-bash almost works with +emx on DOS). GNU make is recommended if using djgpp-bash. + +Beginning with 3.0.4, the MSC (DOS/Windows32) and Mingw32 versions write +pipe and system() commands to a temporary file, and then execute +with SHELL or COMSPEC. The current mechanism defaults to dos-style +shell conventions unless the shell is one of sh, bash, csh, tcsh, sh32, +sh16, or ksh. + + +4. GNU make is available at LEO for OS/2, in the djgpp collection +for DOS, and in the Mingw32 collection for Windows32. + +dmake is by Dennis Vadura (dvadura@watdragon.uwaterloo.ca), CS +Dept., University of Waterloo. OS/2 and DOS versions can be found as +part of the GNUish project. Note that DOS users will need the DOS-only +version (due to the swap requirement). + +Ndmake is by D.G. Kneller. This ShareWare program was later released +as Opus Make (which is available for OS/2 and DOS). Ndmake 4.5 is +available at + + ftp://ftp.simtel.net/simtelnet/msdos/c/ndmake45.zip + + +5. Stewartson's shell contains sources for a setargv-replacement +for MSC, which can add enhanced command-line processing capabilities +to gawk. See the makefile. Note that there is a fatal bug in +stdargv.c, triggered in the case of no closing quote. The following +patch treats this case as if a quote was inserted as the last +character on the command-line. + +478,479c478,482 +< else +< spos = &spos[strlen (cpos)]; +--- +> else { +> /* No matching quote. Fake it. */ +> spos = cpos + strlen (cpos) + 1; +> break; +> } + + +Known bugs +---------- + +1. DJGPP version 1 has known problems with signals, and in the way it +handles command-lines. Older versions of this file contain notes on +other bugs, and on a few bugs uncovered in the v2 betas. Testing of +gawk with DJGPP v1 ended with gawk-3.0. djgpp-2.01 and djgpp ports of +GNU make 3.75 or later are strongly preferred, in part due to enhanced +support for sh-like shells. + +2. emx does not support DST. On 2-Jan-96, Mattes writes: + + Quotation from ISO 9899-1990: + + 7.12.3.5 The strftime function + [...] + %Z is replaced by the time zone name or abbreviation, or by no + characters if no time zone is determinable. + + As emx does not yet support DST, it does not know which one of the two + time zones (with DST vs. without DST) applies. In consequence, `no + time zone is determinable'. + +As a workaround, it may be possible to edit do_strftime() of builtin.c +according to Mattes' recommendation: + + If you happen to know whether DST applies or not for a given struct + tm, just set its tm_isdst to a positive value or to zero, respectively. + Then, strftime() will replace %Z with the name of the time zone. + +However, this probably won't yield a generic solution given that the rules +for when DST starts and stops vary depending upon your location and the +rules have changed over time. Most versions of UNIX maintain this +information in a database (of sorts). In Solaris, for instance, it can be +found in /usr/share/zoneinfo/*. The setting of the TZ environment variable +(eg. TZ=US/Pacific) is then used to lookup the specifics for that locale. + +3. The 16-bit DOS version can exhaust memory on scripts such as Henry +Spencer's "awf". Use GNU C versions if possible. + +4. builtin.c of gawk-3.0.[1-6] triggers a bug in MSC 6.00A. The makefile +works around the bug by compiling builtin.c without optimizations (-Od). +In limited testing, it appears that inserting some dummy code in +builtin.c can provide a better solution than disabling optimizations. + +5. There are problems with system() when using the rsx package with emx +programs (rsx is used in DPMI environments such as MS-Win). The djgpp +versions are preferred in this case. + +6. In contrast to getpid() on UNIX, the getpid() in Microsoft C/C++ 1.52 +(AKA 8.0) sometimes returns negative numbers. The DOS Gawk developers felt +that it was best to use Microsoft's built-in function; but at the same time, +we are placing this warning here, because this behavior will undoubtably be +surprising to many. + +7. MSC 6 fails the strftlng test. The funstack test exhausts memory +on the 16bit DOS versions. + +8. Eli Zaretskii writes: "Make can crash with SIGFPE after finishing all +the tests. This happens on Windows 95 only, and Gawk 3.0.3 does that as +well (as do older versions of Make). The cause for this is the log(-1) +call in the last test. Based on some limited testing, I'd say that the +problem is in sloppy Windows handling of the FPU: it doesn't clean up the +FPU after a program exits, so if Make has SIGFPE unmasked, it crashes." + +9. gawk built from the mingw32 and vcWin32 targets continues to have +problems with pipes; in particular, the pipeio1 test fails. + +10. As mentioned above, `|&' only works with cygwin. + + +Gawk thanks +----------- + +The DOS maintainers wish to express their thanks to Eli Zaretskii +<eliz@is.elta.co.il> for his work and for the many conversations +concerning gawk, make, and djgpp. His FAQ for djgpp is essential +reading, and he was always willing to answer our questions (even when +we didn't read the relevant portions of the FAQ :). + +We are indebted to Juan Grigera <juan@biophnet.unlp.edu.ar> for the +Visual C++ target, and for additional help on changes for Windows32. + + +---- +If you have any problems with the DOS or OS/2 versions of Gawk, +please send bug reports (along with the version and compiler used) to + + Scott Deifik, scottd.mail@sbcglobal.net (DOS versions) +or + gawk-maintainer@unixos2.org (OS/2 version) + Darrel Hankerson, hankedr@mail.auburn.edu + +Support for Windows32 started in gawk-3.0.3. Reports on +the Visual C++ version (vcWin32) may be sent to + + Juan Grigera, juan@biophnet.unlp.edu.ar (Visual C++ version) + +with a copy to Scott Deifik. Other Windows32 reports may go to Darrel +Hankerson. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pcdynamic b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pcdynamic new file mode 100644 index 0000000..678206e --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.pcdynamic @@ -0,0 +1,93 @@ +This is the README for dynamic extension support for GNU awk 3.1.2 under Windows32 +This part of the README is directed to the gawk maintainers. + +The implementation consists of + +pc/dlfcn.h +pc/dlfcn.c + An implementation of the POSIX dynamic loading functions for Windows32. + Bugs and limitations: + the RTLD_* flags are ignored + passing NULL as the module name is not really supported. + dlerror() doesn't always generate useful output. + +pc/w32dynamic.patch + A patch to pc/Makefile. This adds macros to allow dynamic loading + to be compiled in. The macros (DYN_EXP, DYN_OBJ, DYN_FLAGS, and + DYN_MAKEXP) are commented-out by default (which is the default on + Unix as well). I've added definitions only for MS VC and MinGW. + I also added support for pgawk under MS VC and MinGW. + +pc/gawkw32.def + A list of functions to export from gawk.exe. Every function used + in an extension DLL needs to be in this file. I've added the ones + required by the provided examples, but some thought should go into + determining a useful set of API functions. From a maintenance + perspective, it's important that the ordinals (the number following @) + never change. You can use an existing DLL with a gawk.exe which has + new exported functions, but if you change the ordinal of an existing + function, you have to recompile all the extensions that use it. + +extension/Makefile.pc + A make file which compiles a few of the extension examples. + Only readfile, ordchr, and arrayparm are built, since the + other functions didn't compile without sizeable modifications. + +extension/pcext.def + A module definition file which exports dlload. + +extension/w32dynamic.patch + A patch to readfile.c to have it open files in binary mode. Without + this, the bytes read doesn't always match the file size. + +w32dynamic.patch + A patch to awk.h. This makes the temporary variable _t static and + adds an attribute to some data declarations when WIN32_EXTENSION is + defined. The issue is that data imported from a separate module has + a different level of indirection from the same data in the + original module. The difference can be made transparent by adding + __declspec(dllimport)) to the declarations used in the importing module. + Since _t doesn't actually have to be shared, I've just made it + static to the extension module and avoided the problem. + +README_d/README.pcdynamic + This file. + +The remainder of the file is intended for people installing and using gawk +and probably ought to be added to README.pc +--- +To compile gawk with dynamic extension support, uncomment the +definitions of DYN_FLAGS, DYN_EXP, DYN_OBJ, and DYN_MAKEXP in the +configuration section of Makefile. There are two definitions for +DYN_MAKEXP -- pick the one that matches your target. + +To build some of the example extension libraries, cd to the extension +directory and copy Makefile.pc to Makefile. You can then build using the same +two targets. To run the example awk scripts, you'll need to either change the +call to the `extension' function to match the name of the library (for +instance, change "./ordchr.so" to "ordchr.dll" or simply "ordchr"), or rename +the library to match the call (for instance, rename ordchr.dll to ordchr.so). + +If you build gawk.exe with one compiler but want to build an extension library +with the other, you need to copy the import library. Visual C uses a library +called gawk.lib, while MinGW uses a library called libgawk.a. These files +are equivalent and will interoperate if you give them the correct name. +The resulting shared libraries are also interoperable. + +To create your own extension library, you can use the examples as models, but +you're essentially on your own. Post to comp.lang.awk or send e-mail to +ptjm@interlog.com if you have problems getting started. If you need to access +functions or variables which are not exported by gawk.exe, add them to +gawkw32.def and rebuild. You should also add ATTRIBUTE_EXPORTED to the +declaration in awk.h of any variables you add to gawkw32.def. + +Note that extension libraries have the name of the awk executable embedded in +them at link time, so they will work only with gawk.exe. In particular, they won't +work if you rename gawk.exe to awk.exe or if you try to use pgawk.exe. You can +perform profiling by temporarily renaming pgawk.exe to gawk.exe. You can resolve +this problem by changing the program name in the definition of DYN_MAKEXP for +your compiler. + +On Windows32, libraries are sought first in the current directory, then in the +directory containing gawk.exe, and finally through the PATH environment +variable. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sgi b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sgi new file mode 100644 index 0000000..5d754a8 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sgi @@ -0,0 +1,20 @@ +Tue Jan 30 10:51:39 IST 2001 + +There will be linker warnings on SGI Irix will be building gawk. +These are related to use of dlopen and the dynamic loading of +builtins. The warnings can be ignored. +====================================== +Tue May 2 11:40:54 IDT 2000 + +GCC and gawk often don't mix on SGI systems. Use the native C compiler to +compile gawk. `make test' should work ok, although the `tweakfld' test +may fail. That's ok; see README.ultrix for the details on that one. + +Note that the SGI compiler will complain about some constructs in +regex.c and dfa.c. It's ok to ignore those complaints. + +If you ask me about this, I will fuss at you for not having done +your homework! + +Arnold Robbins +arnold@skeeve.com diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.solaris b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.solaris new file mode 100644 index 0000000..4b5affd --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.solaris @@ -0,0 +1,138 @@ +Solaris Problem #1: +=================== +From: carson@lehman.com +Date: Fri, 7 Feb 1997 01:05:58 -0500 +To: arnold@gnu.ai.mit.edu +Subject: Solaris 2.5.1 x86 bug in gawk-3.0.2 + +awktab.c has the following bogus logic: + +#ifndef alloca +#ifdef __GNUC__ +#define alloca __builtin_alloca +#else /* not GNU C. */ +#if (!defined (__STDC__) && defined (sparc)) || defined (__sparc__) || defined (__sparc) || defined (__sgi) +#include <alloca.h> +#else /* not sparc */ + +Solaris x86 obviously dosn't define sparc or __sparc. + +What you _meant_ to say was: + +if (defined(__sun) && defined(__SVR4)) + +(which identifies Solaris 2.x under both Sun's cc and gcc) + +-- +Carson Gaspar -- carson@cs.columbia.edu carson@lehman.com +http://www.cs.columbia.edu/~carson/home.html +<This is the boring business .sig - no outre sayings here> + + * * * * * * * + +Solution to Problem #1: +======================= +Tue Oct 20 21:25:11 IST 1998 + +This has been fixed in 3.1.0 with the bisonfix.sed script. + +Arnold Robbins +arnold@skeeve.com + +Solaris Problem #2: +=================== +Tue Apr 13 16:57:45 IDT 1999 + +There is a known problem in that the `manyfiles' test will fail under +Solaris if you set your soft limit on the number of file descriptors to +above 256. This is due to a "feature" of fdopen that an fd must be +less than 256 (see fdopen(3)). + +IMHO this is Sun's problem, not mine. + +Arnold Robbins +arnold@skeeve.com + +Solution (a) to Problem #2: +=========================== +Now fixed in the code via Paul Eggert's 2001-09-0 patch. See the +ChangeLog. + +Solution (b) to Problem #2: +=========================== +From: Paul Nevai <nevai@math.ohio-state.edu> +Subject: Re: gawk-3.0.4 +To: arnold@skeeve.com (Aharon Robbins) +Date: Tue, 6 Jul 1999 09:09:05 -0400 (EDT) + +Dear Aharon: + +Toda raba. Why don't you add something like that to README_d/README.solaris +file: + +for the SunOS do in + +/bin/sh: ulimit -n 256; ulimit -a; make test +/bin/tcsh: limit descriptors 256; ulimit -a; make test + +otherwise "make test" will fail + +Shalom, Paul + +Aharon Robbins wrote to Paul Nevai: +# >From the README_d/README.solaris file: +# +# Tue Apr 13 16:57:45 IDT 1999 +# +# There is a known problem in that the `manyfiles' test will fail under +# Solaris if you set your soft limit on the number of file descriptors to +# above 256. This is due to a "feature" of fdopen that an fd must be +# less than 256 (see fdopen(3)). +# +# IMHO this is Sun's problem, not mine. +# +# Arnold Robbins +# arnold@skeeve.com +# +# Double check your settings with ulimit; I suspect that this is +# your problem. +# +# Thanks, +# +# Arnold +# -- +# Aharon (Arnold) Robbins arnold@skeeve.com [ <<=== NOTE: NEW ADDRESS!! ] +# P.O. Box 354 Home Phone: +972 8 979-0381 Fax: +1 603 761-6761 +# Nof Ayalon Cell Phone: +972 51 297-545 (See www.efax.com) +# D.N. Shimshon 99784 Laundry increases exponentially in the +# ISRAEL number of children. -- Miriam Robbins +# +# + + + +Paul Nevai pali+@osu.edu +Department of Mathematics nevai@math.ohio-state.edu +The Ohio State University http://www.math.ohio-state.edu/~nevai/ +231 West Eighteenth Avenue http://www.math.ohio-state.edu/~jat/ +Columbus, Ohio 43210-1174 1-614-292-5310 (Office/Answering Device) +The United States of America 1-614-292-1479 (Math Dept Fax) + +Solaris Problem #3: +=================== +Sun Feb 9 10:35:51 IST 2003 + +Certain versions of Sun C give compilation errors under Solaris 5.5, 5.6 and +possibly later. Here's what I was told: + +> We have this version of cc here: +> cc -V +> cc: Sun WorkShop 6 update 1 C 5.2 2000/09/11 +> +> Probably, the others use different combinations of OS and CC. +> A quick fix was this (we use csh-syntax here): +> +> setenv CC "/opt/SUNWspro/bin/cc -Xc" +> ./configure +> make check + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sunos4 b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sunos4 new file mode 100644 index 0000000..7cef068 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.sunos4 @@ -0,0 +1,24 @@ +Sun Jan 7 23:49:46 EST 1996 + +GCC and Autoconf disagree about the type of the array argument passed +to getgroups(2). You can thus ignore the warning that gcc will +generate under SunOS 4.1.x for io.c. + +If you send me email about this without having read this file, I will +fuss at you! + +Arnold Robbins +arnold@skeeve.com + +Tue Jan 30 07:01:39 EST 1996 + +The manyfiles test fails under SunOS 4.1.4. There appears to be some +bug in libc (shared and static) for SunOS 4.1.4. I got a working gawk +binary by linking in /usr/5lib/libc.a statically. + + +,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-, + Jim Farrell | phone 610-940-6020 | Platinum technology +Systems Administrator | vmail 800-526-9096 x7512 | 620 W. Germantown Pike + jwf@platinum.com | fax 610-940-6021 | Plymouth Meeting,Pa,19462 +'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~'`^`'~*-,._.,-*~' diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tandem b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tandem new file mode 100644 index 0000000..3f7ba93 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tandem @@ -0,0 +1,33 @@ +The Tandem port was done on a Cyclone machine running D20. +The port is pretty clean and all facilities seem to work except for +some of the I/O piping stuff which is just too foreign a concept for +Tandem. + +Usage is as for UNIX except that D20 requires all "{" and "}" characters +to be escaped with "~" on the command line (not in script files) and the +standard Tandem syntax for "/in filename,out filename/" must be used +instead of the usual UNIX "<" and ">" for file redirection. (Redirection +options on getline, print etc are supported.) + +The -mr=val option has been "stolen" to enable Tandem users to +process fixed-length records with no "end-of-line" character. That +is, -mr=74 tells gawk to read the input file as fixed 74-byte +records. + +To build a Tandem executable from source, down-load all of the files +so that the file names on the Tandem box are, for example ARRAYC or +AWKH. That is, make all of the file names conform to the restrictions +of D20. The "totally Tandem-specific" files are in the tandem +"subvolume" and should be copied to the main src directory before +building gawk. + +The file compit can then be used to compile and bind an executable. +Sorry, no make and no autoconfig. + +This is my first UNIX port to Tandem so I may well have missed the best +way of doing things: I just desperately needed a working awk at a +Tandem shop. + +Cheers, +Stephen Davies +(scldad@sdc.com.au) diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tests b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tests new file mode 100644 index 0000000..4b3d74b --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/README_d/README.tests @@ -0,0 +1,45 @@ +Date: Sat, 22 Apr 2000 06:07:06 -0600 (MDT) +From: "Nelson H. F. Beebe" <beebe@math.utah.edu> +Cc: beebe@math.utah.edu, sysstaff@math.utah.edu, othmer@math.utah.edu +Subject: gawk-3.0.4 and a GNU/Linux gotcha + +Yesterday, I was assisting a colleague install some software on his +GNU/Linux machine for which uname -r reports 2.2.14. + +A (mis)feature of this system, which I've never encountered before, +broke the build of one of my programs, and also of gawk-3.0.4. + +Namely, the kernel will not execute anything that resides in /tmp, +though it will if the same script is in /usr/tmp! + +% cat /tmp/foo.sh +#! /bin/sh +echo hello + +ls -l /tmp/foo.sh +-rwxr-xr-x 1 othmer math 22 Apr 21 10:34 /tmp/foo.sh* + +% /tmp/foo.sh +bash: /tmp/foo.sh: Permission denied + +% cp /tmp/foo.sh /usr/tmp + +% /usr/tmp/foo.sh +hello + +Thus, programs that do a temporary install in /tmp, as some of mine do +in order to run the validation suite, will fail. + +gawk-3.0.4, and likely other gawk versions, hits this problem too. It +fails because test/poundbang starts with + +#! /tmp/gawk -f + +I tracked down where it comes from: + +% grep /tmp /etc/fstab +/dev/hda3 /tmp ext2 rw,nosuid,noexec,nouser,auto,async,nodev 1 1 + !!!!!! + +Since this is done via a mount command, potentially ANY directory tree +could be mounted with noexec. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/README.card b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/README.card new file mode 100644 index 0000000..ef77cda --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/README.card @@ -0,0 +1,19 @@ +Mon Dec 9 12:45:48 EST 1996 + +The AWK reference card included here requires a modern version of troff +(ditroff). GNU Troff (groff) is known to work. + +If your troff is able to produce Postscript but does not know how to +properly use the macros from `colors' file then try to uncomment in +Makefile the defintion which sets AWKCARD to awkcard.nc (no colors). +This will definitely require changes to the TROFF macro and you have to +ensure that the tbl preprocessor is called. For example, the following +modifications on NeXT: + +TROFF = tbl +SEDME = ptroff -t | sed -e \ + "s/^level0 restore/level0 restore flashme 100 72 moveto\ + (Copyright `date`, FSF, Inc. (all)) show/" \ + -e "s/^\/level0 save def/\/level0 save def 30 -48 translate/" + +will produce a correctly formatted, albeit monochromatic, reference card. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawk.info b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawk.info new file mode 100644 index 0000000..98e33fb --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawk.info @@ -0,0 +1,24684 @@ +INFO-DIR-SECTION Text creation and manipulation +START-INFO-DIR-ENTRY +This is gawk.info, produced by makeinfo version 4.11 from gawk.texi. + +* Gawk: (gawk). A text scanning and processing language. +END-INFO-DIR-ENTRY +INFO-DIR-SECTION Individual utilities +START-INFO-DIR-ENTRY +* awk: (gawk)Invoking gawk. Text scanning and processing. +END-INFO-DIR-ENTRY + + Copyright (C) 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000, +2001, 2002, 2003, 2004, 2005, 2007 Free Software Foundation, Inc. + + + This is Edition 3 of `GAWK: Effective AWK Programming: A User's +Guide for GNU Awk', for the 3.1.6 (or later) version of the GNU +implementation of AWK. + + Permission is granted to copy, distribute and/or modify this document +under the terms of the GNU Free Documentation License, Version 1.2 or +any later version published by the Free Software Foundation; with the +Invariant Sections being "GNU General Public License", the Front-Cover +texts being (a) (see below), and with the Back-Cover Texts being (b) +(see below). A copy of the license is included in the section entitled +"GNU Free Documentation License". + + a. "A GNU Manual" + + b. "You have freedom to copy and modify this GNU Manual, like GNU + software. Copies published by the Free Software Foundation raise + funds for GNU development." + + +File: gawk.info, Node: Top, Next: Foreword, Up: (dir) + +General Introduction +******************** + +This file documents `awk', a program that you can use to select +particular records in a file and perform operations upon them. + + Copyright (C) 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000, +2001, 2002, 2003, 2004, 2005, 2007 Free Software Foundation, Inc. + + + This is Edition 3 of `GAWK: Effective AWK Programming: A User's +Guide for GNU Awk', for the 3.1.6 (or later) version of the GNU +implementation of AWK. + + Permission is granted to copy, distribute and/or modify this document +under the terms of the GNU Free Documentation License, Version 1.2 or +any later version published by the Free Software Foundation; with the +Invariant Sections being "GNU General Public License", the Front-Cover +texts being (a) (see below), and with the Back-Cover Texts being (b) +(see below). A copy of the license is included in the section entitled +"GNU Free Documentation License". + + a. "A GNU Manual" + + b. "You have freedom to copy and modify this GNU Manual, like GNU + software. Copies published by the Free Software Foundation raise + funds for GNU development." + +* Menu: + +* Foreword:: Some nice words about this + Info file. +* Preface:: What this Info file is about; brief + history and acknowledgments. +* Getting Started:: A basic introduction to using + `awk'. How to run an `awk' + program. Command-line syntax. +* Regexp:: All about matching things using regular + expressions. +* Reading Files:: How to read files and manipulate fields. +* Printing:: How to print using `awk'. Describes + the `print' and `printf' + statements. Also describes redirection of + output. +* Expressions:: Expressions are the basic building blocks + of statements. +* Patterns and Actions:: Overviews of patterns and actions. +* Arrays:: The description and use of arrays. Also + includes array-oriented control statements. +* Functions:: Built-in and user-defined functions. +* Internationalization:: Getting `gawk' to speak your + language. +* Advanced Features:: Stuff for advanced users, specific to + `gawk'. +* Invoking Gawk:: How to run `gawk'. +* Library Functions:: A Library of `awk' Functions. +* Sample Programs:: Many `awk' programs with complete + explanations. +* Language History:: The evolution of the `awk' + language. +* Installation:: Installing `gawk' under various + operating systems. +* Notes:: Notes about `gawk' extensions and + possible future work. +* Basic Concepts:: A very quick introduction to programming + concepts. +* Glossary:: An explanation of some unfamiliar terms. +* Copying:: Your right to copy and distribute + `gawk'. +* GNU Free Documentation License:: The license for this Info file. +* Index:: Concept and Variable Index. + +* History:: The history of `gawk' and + `awk'. +* Names:: What name to use to find `awk'. +* This Manual:: Using this Info file. Includes + sample input files that you can use. +* Conventions:: Typographical Conventions. +* Manual History:: Brief history of the GNU project and this + Info file. +* How To Contribute:: Helping to save the world. +* Acknowledgments:: Acknowledgments. +* Running gawk:: How to run `gawk' programs; + includes command-line syntax. +* One-shot:: Running a short throwaway `awk' + program. +* Read Terminal:: Using no input files (input from terminal + instead). +* Long:: Putting permanent `awk' programs in + files. +* Executable Scripts:: Making self-contained `awk' + programs. +* Comments:: Adding documentation to `gawk' + programs. +* Quoting:: More discussion of shell quoting issues. +* Sample Data Files:: Sample data files for use in the + `awk' programs illustrated in this + Info file. +* Very Simple:: A very simple example. +* Two Rules:: A less simple one-line example using two + rules. +* More Complex:: A more complex example. +* Statements/Lines:: Subdividing or combining statements into + lines. +* Other Features:: Other Features of `awk'. +* When:: When to use `gawk' and when to use + other things. +* Regexp Usage:: How to Use Regular Expressions. +* Escape Sequences:: How to write nonprinting characters. +* Regexp Operators:: Regular Expression Operators. +* Character Lists:: What can go between `[...]'. +* GNU Regexp Operators:: Operators specific to GNU software. +* Case-sensitivity:: How to do case-insensitive matching. +* Leftmost Longest:: How much text matches. +* Computed Regexps:: Using Dynamic Regexps. +* Locales:: How the locale affects things. +* Records:: Controlling how data is split into records. +* Fields:: An introduction to fields. +* Nonconstant Fields:: Nonconstant Field Numbers. +* Changing Fields:: Changing the Contents of a Field. +* Field Separators:: The field separator and how to change it. +* Regexp Field Splitting:: Using regexps as the field separator. +* Single Character Fields:: Making each character a separate field. +* Command Line Field Separator:: Setting `FS' from the command-line. +* Field Splitting Summary:: Some final points and a summary table. +* Constant Size:: Reading constant width data. +* Multiple Line:: Reading multi-line records. +* Getline:: Reading files under explicit program + control using the `getline' function. +* Plain Getline:: Using `getline' with no arguments. +* Getline/Variable:: Using `getline' into a variable. +* Getline/File:: Using `getline' from a file. +* Getline/Variable/File:: Using `getline' into a variable from a + file. +* Getline/Pipe:: Using `getline' from a pipe. +* Getline/Variable/Pipe:: Using `getline' into a variable from a + pipe. +* Getline/Coprocess:: Using `getline' from a coprocess. +* Getline/Variable/Coprocess:: Using `getline' into a variable from a + coprocess. +* Getline Notes:: Important things to know about + `getline'. +* Getline Summary:: Summary of `getline' Variants. +* Print:: The `print' statement. +* Print Examples:: Simple examples of `print' statements. +* Output Separators:: The output separators and how to change + them. +* OFMT:: Controlling Numeric Output With + `print'. +* Printf:: The `printf' statement. +* Basic Printf:: Syntax of the `printf' statement. +* Control Letters:: Format-control letters. +* Format Modifiers:: Format-specification modifiers. +* Printf Examples:: Several examples. +* Redirection:: How to redirect output to multiple files + and pipes. +* Special Files:: File name interpretation in `gawk'. + `gawk' allows access to inherited + file descriptors. +* Special FD:: Special files for I/O. +* Special Process:: Special files for process information. +* Special Network:: Special files for network communications. +* Special Caveats:: Things to watch out for. +* Close Files And Pipes:: Closing Input and Output Files and Pipes. +* Constants:: String, numeric and regexp constants. +* Scalar Constants:: Numeric and string constants. +* Nondecimal-numbers:: What are octal and hex numbers. +* Regexp Constants:: Regular Expression constants. +* Using Constant Regexps:: When and how to use a regexp constant. +* Variables:: Variables give names to values for later + use. +* Using Variables:: Using variables in your programs. +* Assignment Options:: Setting variables on the command-line and a + summary of command-line syntax. This is an + advanced method of input. +* Conversion:: The conversion of strings to numbers and + vice versa. +* Arithmetic Ops:: Arithmetic operations (`+', `-', + etc.) +* Concatenation:: Concatenating strings. +* Assignment Ops:: Changing the value of a variable or a + field. +* Increment Ops:: Incrementing the numeric value of a + variable. +* Truth Values:: What is ``true'' and what is ``false''. +* Typing and Comparison:: How variables acquire types and how this + affects comparison of numbers and strings + with `<', etc. +* Variable Typing:: String type versus numeric type. +* Comparison Operators:: The comparison operators. +* Boolean Ops:: Combining comparison expressions using + boolean operators `||' (``or''), + `&&' (``and'') and `!' (``not''). +* Conditional Exp:: Conditional expressions select between two + subexpressions under control of a third + subexpression. +* Function Calls:: A function call is an expression. +* Precedence:: How various operators nest. +* Pattern Overview:: What goes into a pattern. +* Regexp Patterns:: Using regexps as patterns. +* Expression Patterns:: Any expression can be used as a pattern. +* Ranges:: Pairs of patterns specify record ranges. +* BEGIN/END:: Specifying initialization and cleanup + rules. +* Using BEGIN/END:: How and why to use BEGIN/END rules. +* I/O And BEGIN/END:: I/O issues in BEGIN/END rules. +* Empty:: The empty pattern, which matches every + record. +* Using Shell Variables:: How to use shell variables with + `awk'. +* Action Overview:: What goes into an action. +* Statements:: Describes the various control statements in + detail. +* If Statement:: Conditionally execute some `awk' + statements. +* While Statement:: Loop until some condition is satisfied. +* Do Statement:: Do specified action while looping until + some condition is satisfied. +* For Statement:: Another looping statement, that provides + initialization and increment clauses. +* Switch Statement:: Switch/case evaluation for conditional + execution of statements based on a value. +* Break Statement:: Immediately exit the innermost enclosing + loop. +* Continue Statement:: Skip to the end of the innermost enclosing + loop. +* Next Statement:: Stop processing the current input record. +* Nextfile Statement:: Stop processing the current file. +* Exit Statement:: Stop execution of `awk'. +* Built-in Variables:: Summarizes the built-in variables. +* User-modified:: Built-in variables that you change to + control `awk'. +* Auto-set:: Built-in variables where `awk' + gives you information. +* ARGC and ARGV:: Ways to use `ARGC' and `ARGV'. +* Array Intro:: Introduction to Arrays +* Reference to Elements:: How to examine one element of an array. +* Assigning Elements:: How to change an element of an array. +* Array Example:: Basic Example of an Array +* Scanning an Array:: A variation of the `for' statement. It + loops through the indices of an array's + existing elements. +* Delete:: The `delete' statement removes an + element from an array. +* Numeric Array Subscripts:: How to use numbers as subscripts in + `awk'. +* Uninitialized Subscripts:: Using Uninitialized variables as + subscripts. +* Multi-dimensional:: Emulating multidimensional arrays in + `awk'. +* Multi-scanning:: Scanning multidimensional arrays. +* Array Sorting:: Sorting array values and indices. +* Built-in:: Summarizes the built-in functions. +* Calling Built-in:: How to call built-in functions. +* Numeric Functions:: Functions that work with numbers, including + `int', `sin' and `rand'. +* String Functions:: Functions for string manipulation, such as + `split', `match' and + `sprintf'. +* Gory Details:: More than you want to know about `\' + and `&' with `sub', `gsub', + and `gensub'. +* I/O Functions:: Functions for files and shell commands. +* Time Functions:: Functions for dealing with timestamps. +* Bitwise Functions:: Functions for bitwise operations. +* I18N Functions:: Functions for string translation. +* User-defined:: Describes User-defined functions in detail. +* Definition Syntax:: How to write definitions and what they + mean. +* Function Example:: An example function definition and what it + does. +* Function Caveats:: Things to watch out for. +* Return Statement:: Specifying the value a function returns. +* Dynamic Typing:: How variable types can change at runtime. +* I18N and L10N:: Internationalization and Localization. +* Explaining gettext:: How GNU `gettext' works. +* Programmer i18n:: Features for the programmer. +* Translator i18n:: Features for the translator. +* String Extraction:: Extracting marked strings. +* Printf Ordering:: Rearranging `printf' arguments. +* I18N Portability:: `awk'-level portability issues. +* I18N Example:: A simple i18n example. +* Gawk I18N:: `gawk' is also internationalized. +* Nondecimal Data:: Allowing nondecimal input data. +* Two-way I/O:: Two-way communications with another + process. +* TCP/IP Networking:: Using `gawk' for network + programming. +* Portal Files:: Using `gawk' with BSD portals. +* Profiling:: Profiling your `awk' programs. +* Command Line:: How to run `awk'. +* Options:: Command-line options and their meanings. +* Other Arguments:: Input file names and variable assignments. +* AWKPATH Variable:: Searching directories for `awk' + programs. +* Obsolete:: Obsolete Options and/or features. +* Undocumented:: Undocumented Options and Features. +* Known Bugs:: Known Bugs in `gawk'. +* Library Names:: How to best name private global variables + in library functions. +* General Functions:: Functions that are of general use. +* Nextfile Function:: Two implementations of a `nextfile' + function. +* Assert Function:: A function for assertions in `awk' + programs. +* Round Function:: A function for rounding if `sprintf' + does not do it correctly. +* Cliff Random Function:: The Cliff Random Number Generator. +* Ordinal Functions:: Functions for using characters as numbers + and vice versa. +* Join Function:: A function to join an array into a string. +* Gettimeofday Function:: A function to get formatted times. +* Data File Management:: Functions for managing command-line data + files. +* Filetrans Function:: A function for handling data file + transitions. +* Rewind Function:: A function for rereading the current file. +* File Checking:: Checking that data files are readable. +* Empty Files:: Checking for zero-length files. +* Ignoring Assigns:: Treating assignments as file names. +* Getopt Function:: A function for processing command-line + arguments. +* Passwd Functions:: Functions for getting user information. +* Group Functions:: Functions for getting group information. +* Running Examples:: How to run these examples. +* Clones:: Clones of common utilities. +* Cut Program:: The `cut' utility. +* Egrep Program:: The `egrep' utility. +* Id Program:: The `id' utility. +* Split Program:: The `split' utility. +* Tee Program:: The `tee' utility. +* Uniq Program:: The `uniq' utility. +* Wc Program:: The `wc' utility. +* Miscellaneous Programs:: Some interesting `awk' programs. +* Dupword Program:: Finding duplicated words in a document. +* Alarm Program:: An alarm clock. +* Translate Program:: A program similar to the `tr' + utility. +* Labels Program:: Printing mailing labels. +* Word Sorting:: A program to produce a word usage count. +* History Sorting:: Eliminating duplicate entries from a + history file. +* Extract Program:: Pulling out programs from Texinfo source + files. +* Simple Sed:: A Simple Stream Editor. +* Igawk Program:: A wrapper for `awk' that includes + files. +* V7/SVR3.1:: The major changes between V7 and System V + Release 3.1. +* SVR4:: Minor changes between System V Releases 3.1 + and 4. +* POSIX:: New features from the POSIX standard. +* BTL:: New features from the Bell Laboratories + version of `awk'. +* POSIX/GNU:: The extensions in `gawk' not in + POSIX `awk'. +* Contributors:: The major contributors to `gawk'. +* Gawk Distribution:: What is in the `gawk' distribution. +* Getting:: How to get the distribution. +* Extracting:: How to extract the distribution. +* Distribution contents:: What is in the distribution. +* Unix Installation:: Installing `gawk' under various + versions of Unix. +* Quick Installation:: Compiling `gawk' under Unix. +* Additional Configuration Options:: Other compile-time options. +* Configuration Philosophy:: How it's all supposed to work. +* Non-Unix Installation:: Installation on Other Operating Systems. +* Amiga Installation:: Installing `gawk' on an Amiga. +* BeOS Installation:: Installing `gawk' on BeOS. +* PC Installation:: Installing and Compiling `gawk' on + MS-DOS and OS/2. +* PC Binary Installation:: Installing a prepared distribution. +* PC Compiling:: Compiling `gawk' for MS-DOS, Windows32, + and OS/2. +* PC Using:: Running `gawk' on MS-DOS, Windows32 and + OS/2. +* PC Dynamic:: Compiling `gawk' for dynamic + libraries. +* Cygwin:: Building and running `gawk' for + Cygwin. +* VMS Installation:: Installing `gawk' on VMS. +* VMS Compilation:: How to compile `gawk' under VMS. +* VMS Installation Details:: How to install `gawk' under VMS. +* VMS Running:: How to run `gawk' under VMS. +* VMS POSIX:: Alternate instructions for VMS POSIX. +* VMS Old Gawk:: An old version comes with some VMS systems. +* Unsupported:: Systems whose ports are no longer + supported. +* Atari Installation:: Installing `gawk' on the Atari ST. +* Atari Compiling:: Compiling `gawk' on Atari. +* Atari Using:: Running `gawk' on Atari. +* Tandem Installation:: Installing `gawk' on a Tandem. +* Bugs:: Reporting Problems and Bugs. +* Other Versions:: Other freely available `awk' + implementations. +* Compatibility Mode:: How to disable certain `gawk' + extensions. +* Additions:: Making Additions To `gawk'. +* Adding Code:: Adding code to the main body of + `gawk'. +* New Ports:: Porting `gawk' to a new operating + system. +* Dynamic Extensions:: Adding new built-in functions to + `gawk'. +* Internals:: A brief look at some `gawk' + internals. +* Sample Library:: A example of new functions. +* Internal File Description:: What the new functions will do. +* Internal File Ops:: The code for internal file operations. +* Using Internal File Ops:: How to use an external extension. +* Future Extensions:: New features that may be implemented one + day. +* Basic High Level:: The high level view. +* Basic Data Typing:: A very quick intro to data types. +* Floating Point Issues:: Stuff to know about floating-point numbers. +* String Conversion Precision:: The String Value Can Lie. +* Unexpected Results:: Floating Point Numbers Are Not + Abstract Numbers. +* POSIX Floating Point Problems:: Standards Versus Existing Practice. + + To Miriam, for making me complete. + + To Chana, for the joy you bring us. + + To Rivka, for the exponential increase. + + To Nachum, for the added dimension. + + To Malka, for the new beginning. + +File: gawk.info, Node: Foreword, Next: Preface, Prev: Top, Up: Top + +Foreword +******** + +Arnold Robbins and I are good friends. We were introduced 11 years ago +by circumstances--and our favorite programming language, AWK. The +circumstances started a couple of years earlier. I was working at a new +job and noticed an unplugged Unix computer sitting in the corner. No +one knew how to use it, and neither did I. However, a couple of days +later it was running, and I was `root' and the one-and-only user. That +day, I began the transition from statistician to Unix programmer. + + On one of many trips to the library or bookstore in search of books +on Unix, I found the gray AWK book, a.k.a. Aho, Kernighan and +Weinberger, `The AWK Programming Language', Addison-Wesley, 1988. +AWK's simple programming paradigm--find a pattern in the input and then +perform an action--often reduced complex or tedious data manipulations +to few lines of code. I was excited to try my hand at programming in +AWK. + + Alas, the `awk' on my computer was a limited version of the +language described in the AWK book. I discovered that my computer had +"old `awk'" and the AWK book described "new `awk'." I learned that +this was typical; the old version refused to step aside or relinquish +its name. If a system had a new `awk', it was invariably called +`nawk', and few systems had it. The best way to get a new `awk' was to +`ftp' the source code for `gawk' from `prep.ai.mit.edu'. `gawk' was a +version of new `awk' written by David Trueman and Arnold, and available +under the GNU General Public License. + + (Incidentally, it's no longer difficult to find a new `awk'. `gawk' +ships with Linux, and you can download binaries or source code for +almost any system; my wife uses `gawk' on her VMS box.) + + My Unix system started out unplugged from the wall; it certainly was +not plugged into a network. So, oblivious to the existence of `gawk' +and the Unix community in general, and desiring a new `awk', I wrote my +own, called `mawk'. Before I was finished I knew about `gawk', but it +was too late to stop, so I eventually posted to a `comp.sources' +newsgroup. + + A few days after my posting, I got a friendly email from Arnold +introducing himself. He suggested we share design and algorithms and +attached a draft of the POSIX standard so that I could update `mawk' to +support language extensions added after publication of the AWK book. + + Frankly, if our roles had been reversed, I would not have been so +open and we probably would have never met. I'm glad we did meet. He +is an AWK expert's AWK expert and a genuinely nice person. Arnold +contributes significant amounts of his expertise and time to the Free +Software Foundation. + + This book is the `gawk' reference manual, but at its core it is a +book about AWK programming that will appeal to a wide audience. It is +a definitive reference to the AWK language as defined by the 1987 Bell +Labs release and codified in the 1992 POSIX Utilities standard. + + On the other hand, the novice AWK programmer can study a wealth of +practical programs that emphasize the power of AWK's basic idioms: data +driven control-flow, pattern matching with regular expressions, and +associative arrays. Those looking for something new can try out +`gawk''s interface to network protocols via special `/inet' files. + + The programs in this book make clear that an AWK program is +typically much smaller and faster to develop than a counterpart written +in C. Consequently, there is often a payoff to prototype an algorithm +or design in AWK to get it running quickly and expose problems early. +Often, the interpreted performance is adequate and the AWK prototype +becomes the product. + + The new `pgawk' (profiling `gawk'), produces program execution +counts. I recently experimented with an algorithm that for n lines of +input, exhibited ~ C n^2 performance, while theory predicted ~ C n log n +behavior. A few minutes poring over the `awkprof.out' profile +pinpointed the problem to a single line of code. `pgawk' is a welcome +addition to my programmer's toolbox. + + Arnold has distilled over a decade of experience writing and using +AWK programs, and developing `gawk', into this book. If you use AWK or +want to learn how, then read this book. + + Michael Brennan + Author of `mawk' + + +File: gawk.info, Node: Preface, Next: Getting Started, Prev: Foreword, Up: Top + +Preface +******* + +Several kinds of tasks occur repeatedly when working with text files. +You might want to extract certain lines and discard the rest. Or you +may need to make changes wherever certain patterns appear, but leave +the rest of the file alone. Writing single-use programs for these +tasks in languages such as C, C++, or Pascal is time-consuming and +inconvenient. Such jobs are often easier with `awk'. The `awk' +utility interprets a special-purpose programming language that makes it +easy to handle simple data-reformatting jobs. + + The GNU implementation of `awk' is called `gawk'; it is fully +compatible with the System V Release 4 version of `awk'. `gawk' is +also compatible with the POSIX specification of the `awk' language. +This means that all properly written `awk' programs should work with +`gawk'. Thus, we usually don't distinguish between `gawk' and other +`awk' implementations. + + Using `awk' allows you to: + + * Manage small, personal databases + + * Generate reports + + * Validate data + + * Produce indexes and perform other document preparation tasks + + * Experiment with algorithms that you can adapt later to other + computer languages + + In addition, `gawk' provides facilities that make it easy to: + + * Extract bits and pieces of data for processing + + * Sort data + + * Perform simple network communications + + This Info file teaches you about the `awk' language and how you can +use it effectively. You should already be familiar with basic system +commands, such as `cat' and `ls',(1) as well as basic shell facilities, +such as input/output (I/O) redirection and pipes. + + Implementations of the `awk' language are available for many +different computing environments. This Info file, while describing the +`awk' language in general, also describes the particular implementation +of `awk' called `gawk' (which stands for "GNU awk"). `gawk' runs on a +broad range of Unix systems, ranging from 80386 PC-based computers up +through large-scale systems, such as Crays. `gawk' has also been ported +to Mac OS X, MS-DOS, Microsoft Windows (all versions) and OS/2 PCs, +Atari and Amiga microcomputers, BeOS, Tandem D20, and VMS. + +* Menu: + +* History:: The history of `gawk' and + `awk'. +* Names:: What name to use to find `awk'. +* This Manual:: Using this Info file. Includes sample + input files that you can use. +* Conventions:: Typographical Conventions. +* Manual History:: Brief history of the GNU project and this + Info file. +* How To Contribute:: Helping to save the world. +* Acknowledgments:: Acknowledgments. + + ---------- Footnotes ---------- + + (1) These commands are available on POSIX-compliant systems, as well +as on traditional Unix-based systems. If you are using some other +operating system, you still need to be familiar with the ideas of I/O +redirection and pipes. + + +File: gawk.info, Node: History, Next: Names, Up: Preface + +History of `awk' and `gawk' +=========================== + + Recipe For A Programming Language + + 1 part `egrep' 1 part `snobol' + 2 parts `ed' 3 parts C + + Blend all parts well using `lex' and `yacc'. Document minimally + and release. + + After eight years, add another part `egrep' and two more parts C. + Document very well and release. + + The name `awk' comes from the initials of its designers: Alfred V. +Aho, Peter J. Weinberger and Brian W. Kernighan. The original version +of `awk' was written in 1977 at AT&T Bell Laboratories. In 1985, a new +version made the programming language more powerful, introducing +user-defined functions, multiple input streams, and computed regular +expressions. This new version became widely available with Unix System +V Release 3.1 (SVR3.1). The version in SVR4 added some new features +and cleaned up the behavior in some of the "dark corners" of the +language. The specification for `awk' in the POSIX Command Language +and Utilities standard further clarified the language. Both the `gawk' +designers and the original Bell Laboratories `awk' designers provided +feedback for the POSIX specification. + + Paul Rubin wrote the GNU implementation, `gawk', in 1986. Jay +Fenlason completed it, with advice from Richard Stallman. John Woods +contributed parts of the code as well. In 1988 and 1989, David +Trueman, with help from me, thoroughly reworked `gawk' for compatibility +with the newer `awk'. Circa 1995, I became the primary maintainer. +Current development focuses on bug fixes, performance improvements, +standards compliance, and occasionally, new features. + + In May of 1997, Ju"rgen Kahrs felt the need for network access from +`awk', and with a little help from me, set about adding features to do +this for `gawk'. At that time, he also wrote the bulk of `TCP/IP +Internetworking with `gawk'' (a separate document, available as part of +the `gawk' distribution). His code finally became part of the main +`gawk' distribution with `gawk' version 3.1. + + *Note Contributors::, for a complete list of those who made +important contributions to `gawk'. + + +File: gawk.info, Node: Names, Next: This Manual, Prev: History, Up: Preface + +A Rose by Any Other Name +======================== + +The `awk' language has evolved over the years. Full details are +provided in *note Language History::. The language described in this +Info file is often referred to as "new `awk'" (`nawk'). + + Because of this, many systems have multiple versions of `awk'. Some +systems have an `awk' utility that implements the original version of +the `awk' language and a `nawk' utility for the new version. Others +have an `oawk' version for the "old `awk'" language and plain `awk' for +the new one. Still others only have one version, which is usually the +new one.(1) + + All in all, this makes it difficult for you to know which version of +`awk' you should run when writing your programs. The best advice I can +give here is to check your local documentation. Look for `awk', `oawk', +and `nawk', as well as for `gawk'. It is likely that you already have +some version of new `awk' on your system, which is what you should use +when running your programs. (Of course, if you're reading this Info +file, chances are good that you have `gawk'!) + + Throughout this Info file, whenever we refer to a language feature +that should be available in any complete implementation of POSIX `awk', +we simply use the term `awk'. When referring to a feature that is +specific to the GNU implementation, we use the term `gawk'. + + ---------- Footnotes ---------- + + (1) Often, these systems use `gawk' for their `awk' implementation! + + +File: gawk.info, Node: This Manual, Next: Conventions, Prev: Names, Up: Preface + +Using This Book +=============== + +The term `awk' refers to a particular program as well as to the +language you use to tell this program what to do. When we need to be +careful, we call the language "the `awk' language," and the program +"the `awk' utility." This Info file explains both the `awk' language +and how to run the `awk' utility. The term "`awk' program" refers to a +program written by you in the `awk' programming language. + + Primarily, this Info file explains the features of `awk', as defined +in the POSIX standard. It does so in the context of the `gawk' +implementation. While doing so, it also attempts to describe important +differences between `gawk' and other `awk' implementations.(1) Finally, +any `gawk' features that are not in the POSIX standard for `awk' are +noted. + + There are subsections labelled as *Advanced Notes* scattered +throughout the Info file. They add a more complete explanation of +points that are relevant, but not likely to be of interest on first +reading. All appear in the index, under the heading "advanced +features." + + Most of the time, the examples use complete `awk' programs. In some +of the more advanced sections, only the part of the `awk' program that +illustrates the concept currently being described is shown. + + While this Info file is aimed principally at people who have not been +exposed to `awk', there is a lot of information here that even the `awk' +expert should find useful. In particular, the description of POSIX +`awk' and the example programs in *note Library Functions::, and in +*note Sample Programs::, should be of interest. + + *note Getting Started::, provides the essentials you need to know to +begin using `awk'. + + *note Regexp::, introduces regular expressions in general, and in +particular the flavors supported by POSIX `awk' and `gawk'. + + *note Reading Files::, describes how `awk' reads your data. It +introduces the concepts of records and fields, as well as the `getline' +command. I/O redirection is first described here. + + *note Printing::, describes how `awk' programs can produce output +with `print' and `printf'. + + *note Expressions::, describes expressions, which are the basic +building blocks for getting most things done in a program. + + *note Patterns and Actions::, describes how to write patterns for +matching records, actions for doing something when a record is matched, +and the built-in variables `awk' and `gawk' use. + + *note Arrays::, covers `awk''s one-and-only data structure: +associative arrays. Deleting array elements and whole arrays is also +described, as well as sorting arrays in `gawk'. + + *note Functions::, describes the built-in functions `awk' and `gawk' +provide, as well as how to define your own functions. + + *note Internationalization::, describes special features in `gawk' +for translating program messages into different languages at runtime. + + *note Advanced Features::, describes a number of `gawk'-specific +advanced features. Of particular note are the abilities to have +two-way communications with another process, perform TCP/IP networking, +and profile your `awk' programs. + + *note Invoking Gawk::, describes how to run `gawk', the meaning of +its command-line options, and how it finds `awk' program source files. + + *note Library Functions::, and *note Sample Programs::, provide many +sample `awk' programs. Reading them allows you to see `awk' solving +real problems. + + *note Language History::, describes how the `awk' language has +evolved since first release to present. It also describes how `gawk' +has acquired features over time. + + *note Installation::, describes how to get `gawk', how to compile it +under Unix, and how to compile and use it on different non-Unix +systems. It also describes how to report bugs in `gawk' and where to +get three other freely available implementations of `awk'. + + *note Notes::, describes how to disable `gawk''s extensions, as well +as how to contribute new code to `gawk', how to write extension +libraries, and some possible future directions for `gawk' development. + + *note Basic Concepts::, provides some very cursory background +material for those who are completely unfamiliar with computer +programming. Also centralized there is a discussion of some of the +issues surrounding floating-point numbers. + + The *note Glossary::, defines most, if not all, the significant +terms used throughout the book. If you find terms that you aren't +familiar with, try looking them up here. + + *note Copying::, and *note GNU Free Documentation License::, present +the licenses that cover the `gawk' source code and this Info file, +respectively. + + ---------- Footnotes ---------- + + (1) All such differences appear in the index under the entry +"differences in `awk' and `gawk'." + + +File: gawk.info, Node: Conventions, Next: Manual History, Prev: This Manual, Up: Preface + +Typographical Conventions +========================= + +This Info file is written using Texinfo, the GNU documentation +formatting language. A single Texinfo source file is used to produce +both the printed and online versions of the documentation. This minor +node briefly documents the typographical conventions used in Texinfo. + + Examples you would type at the command-line are preceded by the +common shell primary and secondary prompts, `$' and `>'. Output from +the command is preceded by the glyph "-|". This typically represents +the command's standard output. Error messages, and other output on the +command's standard error, are preceded by the glyph "error-->". For +example: + + $ echo hi on stdout + -| hi on stdout + $ echo hello on stderr 1>&2 + error--> hello on stderr + + Characters that you type at the keyboard look `like this'. In +particular, there are special characters called "control characters." +These are characters that you type by holding down both the `CONTROL' +key and another key, at the same time. For example, a `Ctrl-d' is typed +by first pressing and holding the `CONTROL' key, next pressing the `d' +key and finally releasing both keys. + +Dark Corners +............ + + Dark corners are basically fractal -- no matter how much you + illuminate, there's always a smaller but darker one. + Brian Kernighan + + Until the POSIX standard (and `The Gawk Manual'), many features of +`awk' were either poorly documented or not documented at all. +Descriptions of such features (often called "dark corners") are noted +in this Info file with "(d.c.)". They also appear in the index under +the heading "dark corner." + + As noted by the opening quote, though, any coverage of dark corners +is, by definition, something that is incomplete. + + +File: gawk.info, Node: Manual History, Next: How To Contribute, Prev: Conventions, Up: Preface + +The GNU Project and This Book +============================= + +The Free Software Foundation (FSF) is a nonprofit organization dedicated +to the production and distribution of freely distributable software. +It was founded by Richard M. Stallman, the author of the original Emacs +editor. GNU Emacs is the most widely used version of Emacs today. + + The GNU(1) Project is an ongoing effort on the part of the Free +Software Foundation to create a complete, freely distributable, +POSIX-compliant computing environment. The FSF uses the "GNU General +Public License" (GPL) to ensure that their software's source code is +always available to the end user. A copy of the GPL is included for +your reference (*note Copying::). The GPL applies to the C language +source code for `gawk'. To find out more about the FSF and the GNU +Project online, see the GNU Project's home page (http://www.gnu.org). +This Info file may also be read from their web site +(http://www.gnu.org/software/gawk/manual/). + + A shell, an editor (Emacs), highly portable optimizing C, C++, and +Objective-C compilers, a symbolic debugger and dozens of large and +small utilities (such as `gawk'), have all been completed and are +freely available. The GNU operating system kernel (the HURD), has been +released but is still in an early stage of development. + + Until the GNU operating system is more fully developed, you should +consider using GNU/Linux, a freely distributable, Unix-like operating +system for Intel 80386, DEC Alpha, Sun SPARC, IBM S/390, and other +systems.(2) There are many books on GNU/Linux. One that is freely +available is `Linux Installation and Getting Started', by Matt Welsh. +Many GNU/Linux distributions are often available in computer stores or +bundled on CD-ROMs with books about Linux. (There are three other +freely available, Unix-like operating systems for 80386 and other +systems: NetBSD, FreeBSD, and OpenBSD. All are based on the 4.4-Lite +Berkeley Software Distribution, and they use recent versions of `gawk' +for their versions of `awk'.) + + The Info file itself has gone through a number of previous editions. +Paul Rubin wrote the very first draft of `The GAWK Manual'; it was +around 40 pages in size. Diane Close and Richard Stallman improved it, +yielding a version that was around 90 pages long and barely described +the original, "old" version of `awk'. + + I started working with that version in the fall of 1988. As work on +it progressed, the FSF published several preliminary versions (numbered +0.X). In 1996, Edition 1.0 was released with `gawk' 3.0.0. The FSF +published the first two editions under the title `The GNU Awk User's +Guide'. + + This edition maintains the basic structure of Edition 1.0, but with +significant additional material, reflecting the host of new features in +`gawk' version 3.1. Of particular note is *note Array Sorting::, as +well as *note Bitwise Functions::, *note Internationalization::, and +also *note Advanced Features::, and *note Dynamic Extensions::. + + `GAWK: Effective AWK Programming' will undoubtedly continue to +evolve. An electronic version comes with the `gawk' distribution from +the FSF. If you find an error in this Info file, please report it! +*Note Bugs::, for information on submitting problem reports +electronically, or write to me in care of the publisher. + + ---------- Footnotes ---------- + + (1) GNU stands for "GNU's not Unix." + + (2) The terminology "GNU/Linux" is explained in the *note Glossary::. + + +File: gawk.info, Node: How To Contribute, Next: Acknowledgments, Prev: Manual History, Up: Preface + +How to Contribute +================= + +As the maintainer of GNU `awk', I am starting a collection of publicly +available `awk' programs. For more information, see +`ftp://ftp.freefriends.org/arnold/Awkstuff'. If you have written an +interesting `awk' program, or have written a `gawk' extension that you +would like to share with the rest of the world, please contact me +(<arnold@skeeve.com>). Making things available on the Internet helps +keep the `gawk' distribution down to manageable size. + + +File: gawk.info, Node: Acknowledgments, Prev: How To Contribute, Up: Preface + +Acknowledgments +=============== + +The initial draft of `The GAWK Manual' had the following +acknowledgments: + + Many people need to be thanked for their assistance in producing + this manual. Jay Fenlason contributed many ideas and sample + programs. Richard Mlynarik and Robert Chassell gave helpful + comments on drafts of this manual. The paper `A Supplemental + Document for `awk'' by John W. Pierce of the Chemistry Department + at UC San Diego, pinpointed several issues relevant both to `awk' + implementation and to this manual, that would otherwise have + escaped us. + + I would like to acknowledge Richard M. Stallman, for his vision of a +better world and for his courage in founding the FSF and starting the +GNU Project. + + The following people (in alphabetical order) provided helpful +comments on various versions of this book, up to and including this +edition. Rick Adams, Nelson H.F. Beebe, Karl Berry, Dr. Michael +Brennan, Rich Burridge, Claire Cloutier, Diane Close, Scott Deifik, +Christopher ("Topher") Eliot, Jeffrey Friedl, Dr. Darrel Hankerson, +Michal Jaegermann, Dr. Richard J. LeBlanc, Michael Lijewski, Pat Rankin, +Miriam Robbins, Mary Sheehan, and Chuck Toporek. + + Robert J. Chassell provided much valuable advice on the use of +Texinfo. He also deserves special thanks for convincing me _not_ to +title this Info file `How To Gawk Politely'. Karl Berry helped +significantly with the TeX part of Texinfo. + + I would like to thank Marshall and Elaine Hartholz of Seattle and +Dr. Bert and Rita Schreiber of Detroit for large amounts of quiet +vacation time in their homes, which allowed me to make significant +progress on this Info file and on `gawk' itself. + + Phil Hughes of SSC contributed in a very important way by loaning me +his laptop GNU/Linux system, not once, but twice, which allowed me to +do a lot of work while away from home. + + David Trueman deserves special credit; he has done a yeoman job of +evolving `gawk' so that it performs well and without bugs. Although he +is no longer involved with `gawk', working with him on this project was +a significant pleasure. + + The intrepid members of the GNITS mailing list, and most notably +Ulrich Drepper, provided invaluable help and feedback for the design of +the internationalization features. + + Nelson Beebe, Martin Brown, Andreas Buening, Scott Deifik, Darrel +Hankerson, Isamu Hasegawa, Michal Jaegermann, Ju"rgen Kahrs, Pat Rankin, +Kai Uwe Rommel, and Eli Zaretskii (in alphabetical order) make up the +`gawk' "crack portability team." Without their hard work and help, +`gawk' would not be nearly the fine program it is today. It has been +and continues to be a pleasure working with this team of fine people. + + David and I would like to thank Brian Kernighan of Bell Laboratories +for invaluable assistance during the testing and debugging of `gawk', +and for help in clarifying numerous points about the language. We +could not have done nearly as good a job on either `gawk' or its +documentation without his help. + + Chuck Toporek, Mary Sheehan, and Claire Coutier of O'Reilly & +Associates contributed significant editorial help for this Info file +for the 3.1 release of `gawk'. + + I must thank my wonderful wife, Miriam, for her patience through the +many versions of this project, for her proofreading, and for sharing me +with the computer. I would like to thank my parents for their love, +and for the grace with which they raised and educated me. Finally, I +also must acknowledge my gratitude to G-d, for the many opportunities +He has sent my way, as well as for the gifts He has given me with which +to take advantage of those opportunities. + + +Arnold Robbins +Nof Ayalon +ISRAEL +March, 2001 + + +File: gawk.info, Node: Getting Started, Next: Regexp, Prev: Preface, Up: Top + +1 Getting Started with `awk' +**************************** + +The basic function of `awk' is to search files for lines (or other +units of text) that contain certain patterns. When a line matches one +of the patterns, `awk' performs specified actions on that line. `awk' +keeps processing input lines in this way until it reaches the end of +the input files. + + Programs in `awk' are different from programs in most other +languages, because `awk' programs are "data-driven"; that is, you +describe the data you want to work with and then what to do when you +find it. Most other languages are "procedural"; you have to describe, +in great detail, every step the program is to take. When working with +procedural languages, it is usually much harder to clearly describe the +data your program will process. For this reason, `awk' programs are +often refreshingly easy to read and write. + + When you run `awk', you specify an `awk' "program" that tells `awk' +what to do. The program consists of a series of "rules". (It may also +contain "function definitions", an advanced feature that we will ignore +for now. *Note User-defined::.) Each rule specifies one pattern to +search for and one action to perform upon finding the pattern. + + Syntactically, a rule consists of a pattern followed by an action. +The action is enclosed in curly braces to separate it from the pattern. +Newlines usually separate rules. Therefore, an `awk' program looks +like this: + + PATTERN { ACTION } + PATTERN { ACTION } + ... + +* Menu: + +* Running gawk:: How to run `gawk' programs; includes + command-line syntax. +* Sample Data Files:: Sample data files for use in the `awk' + programs illustrated in this Info file. +* Very Simple:: A very simple example. +* Two Rules:: A less simple one-line example using two + rules. +* More Complex:: A more complex example. +* Statements/Lines:: Subdividing or combining statements into + lines. +* Other Features:: Other Features of `awk'. +* When:: When to use `gawk' and when to use + other things. + + +File: gawk.info, Node: Running gawk, Next: Sample Data Files, Up: Getting Started + +1.1 How to Run `awk' Programs +============================= + +There are several ways to run an `awk' program. If the program is +short, it is easiest to include it in the command that runs `awk', like +this: + + awk 'PROGRAM' INPUT-FILE1 INPUT-FILE2 ... + + When the program is long, it is usually more convenient to put it in +a file and run it with a command like this: + + awk -f PROGRAM-FILE INPUT-FILE1 INPUT-FILE2 ... + + This minor node discusses both mechanisms, along with several +variations of each. + +* Menu: + +* One-shot:: Running a short throwaway `awk' + program. +* Read Terminal:: Using no input files (input from terminal + instead). +* Long:: Putting permanent `awk' programs in + files. +* Executable Scripts:: Making self-contained `awk' programs. +* Comments:: Adding documentation to `gawk' + programs. +* Quoting:: More discussion of shell quoting issues. + + +File: gawk.info, Node: One-shot, Next: Read Terminal, Up: Running gawk + +1.1.1 One-Shot Throwaway `awk' Programs +--------------------------------------- + +Once you are familiar with `awk', you will often type in simple +programs the moment you want to use them. Then you can write the +program as the first argument of the `awk' command, like this: + + awk 'PROGRAM' INPUT-FILE1 INPUT-FILE2 ... + +where PROGRAM consists of a series of PATTERNS and ACTIONS, as +described earlier. + + This command format instructs the "shell", or command interpreter, +to start `awk' and use the PROGRAM to process records in the input +file(s). There are single quotes around PROGRAM so the shell won't +interpret any `awk' characters as special shell characters. The quotes +also cause the shell to treat all of PROGRAM as a single argument for +`awk', and allow PROGRAM to be more than one line long. + + This format is also useful for running short or medium-sized `awk' +programs from shell scripts, because it avoids the need for a separate +file for the `awk' program. A self-contained shell script is more +reliable because there are no other files to misplace. + + *note Very Simple::, presents several short, self-contained programs. + + +File: gawk.info, Node: Read Terminal, Next: Long, Prev: One-shot, Up: Running gawk + +1.1.2 Running `awk' Without Input Files +--------------------------------------- + +You can also run `awk' without any input files. If you type the +following command line: + + awk 'PROGRAM' + +`awk' applies the PROGRAM to the "standard input", which usually means +whatever you type on the terminal. This continues until you indicate +end-of-file by typing `Ctrl-d'. (On other operating systems, the +end-of-file character may be different. For example, on OS/2 and +MS-DOS, it is `Ctrl-z'.) + + As an example, the following program prints a friendly piece of +advice (from Douglas Adams's `The Hitchhiker's Guide to the Galaxy'), +to keep you from worrying about the complexities of computer programming +(`BEGIN' is a feature we haven't discussed yet): + + $ awk "BEGIN { print \"Don't Panic!\" }" + -| Don't Panic! + + This program does not read any input. The `\' before each of the +inner double quotes is necessary because of the shell's quoting +rules--in particular because it mixes both single quotes and double +quotes.(1) + + This next simple `awk' program emulates the `cat' utility; it copies +whatever you type on the keyboard to its standard output (why this +works is explained shortly). + + $ awk '{ print }' + Now is the time for all good men + -| Now is the time for all good men + to come to the aid of their country. + -| to come to the aid of their country. + Four score and seven years ago, ... + -| Four score and seven years ago, ... + What, me worry? + -| What, me worry? + Ctrl-d + + ---------- Footnotes ---------- + + (1) Although we generally recommend the use of single quotes around +the program text, double quotes are needed here in order to put the +single quote into the message. + + +File: gawk.info, Node: Long, Next: Executable Scripts, Prev: Read Terminal, Up: Running gawk + +1.1.3 Running Long Programs +--------------------------- + +Sometimes your `awk' programs can be very long. In this case, it is +more convenient to put the program into a separate file. In order to +tell `awk' to use that file for its program, you type: + + awk -f SOURCE-FILE INPUT-FILE1 INPUT-FILE2 ... + + The `-f' instructs the `awk' utility to get the `awk' program from +the file SOURCE-FILE. Any file name can be used for SOURCE-FILE. For +example, you could put the program: + + BEGIN { print "Don't Panic!" } + +into the file `advice'. Then this command: + + awk -f advice + +does the same thing as this one: + + awk "BEGIN { print \"Don't Panic!\" }" + +This was explained earlier (*note Read Terminal::). Note that you +don't usually need single quotes around the file name that you specify +with `-f', because most file names don't contain any of the shell's +special characters. Notice that in `advice', the `awk' program did not +have single quotes around it. The quotes are only needed for programs +that are provided on the `awk' command line. + + If you want to identify your `awk' program files clearly as such, +you can add the extension `.awk' to the file name. This doesn't affect +the execution of the `awk' program but it does make "housekeeping" +easier. + + +File: gawk.info, Node: Executable Scripts, Next: Comments, Prev: Long, Up: Running gawk + +1.1.4 Executable `awk' Programs +------------------------------- + +Once you have learned `awk', you may want to write self-contained `awk' +scripts, using the `#!' script mechanism. You can do this on many Unix +systems(1) as well as on the GNU system. For example, you could update +the file `advice' to look like this: + + #! /bin/awk -f + + BEGIN { print "Don't Panic!" } + +After making this file executable (with the `chmod' utility), simply +type `advice' at the shell and the system arranges to run `awk'(2) as +if you had typed `awk -f advice': + + $ chmod +x advice + $ advice + -| Don't Panic! + +(We assume you have the current directory in your shell's search path +variable (typically `$PATH'). If not, you may need to type `./advice' +at the shell.) + + Self-contained `awk' scripts are useful when you want to write a +program that users can invoke without their having to know that the +program is written in `awk'. + +Advanced Notes: Portability Issues with `#!' +-------------------------------------------- + +Some systems limit the length of the interpreter name to 32 characters. +Often, this can be dealt with by using a symbolic link. + + You should not put more than one argument on the `#!' line after the +path to `awk'. It does not work. The operating system treats the rest +of the line as a single argument and passes it to `awk'. Doing this +leads to confusing behavior--most likely a usage diagnostic of some +sort from `awk'. + + Finally, the value of `ARGV[0]' (*note Built-in Variables::) varies +depending upon your operating system. Some systems put `awk' there, +some put the full pathname of `awk' (such as `/bin/awk'), and some put +the name of your script (`advice'). Don't rely on the value of +`ARGV[0]' to provide your script name. + + ---------- Footnotes ---------- + + (1) The `#!' mechanism works on Linux systems, systems derived from +the 4.4-Lite Berkeley Software Distribution, and most commercial Unix +systems. + + (2) The line beginning with `#!' lists the full file name of an +interpreter to run and an optional initial command-line argument to +pass to that interpreter. The operating system then runs the +interpreter with the given argument and the full argument list of the +executed program. The first argument in the list is the full file name +of the `awk' program. The rest of the argument list contains either +options to `awk', or data files, or both. + + +File: gawk.info, Node: Comments, Next: Quoting, Prev: Executable Scripts, Up: Running gawk + +1.1.5 Comments in `awk' Programs +-------------------------------- + +A "comment" is some text that is included in a program for the sake of +human readers; it is not really an executable part of the program. +Comments can explain what the program does and how it works. Nearly all +programming languages have provisions for comments, as programs are +typically hard to understand without them. + + In the `awk' language, a comment starts with the sharp sign +character (`#') and continues to the end of the line. The `#' does not +have to be the first character on the line. The `awk' language ignores +the rest of a line following a sharp sign. For example, we could have +put the following into `advice': + + # This program prints a nice friendly message. It helps + # keep novice users from being afraid of the computer. + BEGIN { print "Don't Panic!" } + + You can put comment lines into keyboard-composed throwaway `awk' +programs, but this usually isn't very useful; the purpose of a comment +is to help you or another person understand the program when reading it +at a later time. + + *Caution:* As mentioned in *note One-shot::, you can enclose small +to medium programs in single quotes, in order to keep your shell +scripts self-contained. When doing so, _don't_ put an apostrophe +(i.e., a single quote) into a comment (or anywhere else in your +program). The shell interprets the quote as the closing quote for the +entire program. As a result, usually the shell prints a message about +mismatched quotes, and if `awk' actually runs, it will probably print +strange messages about syntax errors. For example, look at the +following: + + $ awk '{ print "hello" } # let's be cute' + > + + The shell sees that the first two quotes match, and that a new +quoted object begins at the end of the command line. It therefore +prompts with the secondary prompt, waiting for more input. With Unix +`awk', closing the quoted string produces this result: + + $ awk '{ print "hello" } # let's be cute' + > ' + error--> awk: can't open file be + error--> source line number 1 + + Putting a backslash before the single quote in `let's' wouldn't help, +since backslashes are not special inside single quotes. The next +node describes the shell's quoting rules. + + +File: gawk.info, Node: Quoting, Prev: Comments, Up: Running gawk + +1.1.6 Shell-Quoting Issues +-------------------------- + +For short to medium length `awk' programs, it is most convenient to +enter the program on the `awk' command line. This is best done by +enclosing the entire program in single quotes. This is true whether +you are entering the program interactively at the shell prompt, or +writing it as part of a larger shell script: + + awk 'PROGRAM TEXT' INPUT-FILE1 INPUT-FILE2 ... + + Once you are working with the shell, it is helpful to have a basic +knowledge of shell quoting rules. The following rules apply only to +POSIX-compliant, Bourne-style shells (such as `bash', the GNU +Bourne-Again Shell). If you use `csh', you're on your own. + + * Quoted items can be concatenated with nonquoted items as well as + with other quoted items. The shell turns everything into one + argument for the command. + + * Preceding any single character with a backslash (`\') quotes that + character. The shell removes the backslash and passes the quoted + character on to the command. + + * Single quotes protect everything between the opening and closing + quotes. The shell does no interpretation of the quoted text, + passing it on verbatim to the command. It is _impossible_ to + embed a single quote inside single-quoted text. Refer back to + *note Comments::, for an example of what happens if you try. + + * Double quotes protect most things between the opening and closing + quotes. The shell does at least variable and command substitution + on the quoted text. Different shells may do additional kinds of + processing on double-quoted text. + + Since certain characters within double-quoted text are processed + by the shell, they must be "escaped" within the text. Of note are + the characters `$', ``', `\', and `"', all of which must be + preceded by a backslash within double-quoted text if they are to + be passed on literally to the program. (The leading backslash is + stripped first.) Thus, the example seen in *note Read Terminal::, + is applicable: + + $ awk "BEGIN { print \"Don't Panic!\" }" + -| Don't Panic! + + Note that the single quote is not special within double quotes. + + * Null strings are removed when they occur as part of a non-null + command-line argument, while explicit non-null objects are kept. + For example, to specify that the field separator `FS' should be + set to the null string, use: + + awk -F "" 'PROGRAM' FILES # correct + + Don't use this: + + awk -F"" 'PROGRAM' FILES # wrong! + + In the second case, `awk' will attempt to use the text of the + program as the value of `FS', and the first file name as the text + of the program! This results in syntax errors at best, and + confusing behavior at worst. + + Mixing single and double quotes is difficult. You have to resort to +shell quoting tricks, like this: + + $ awk 'BEGIN { print "Here is a single quote <'"'"'>" }' + -| Here is a single quote <'> + +This program consists of three concatenated quoted strings. The first +and the third are single-quoted, the second is double-quoted. + + This can be "simplified" to: + + $ awk 'BEGIN { print "Here is a single quote <'\''>" }' + -| Here is a single quote <'> + +Judge for yourself which of these two is the more readable. + + Another option is to use double quotes, escaping the embedded, +`awk'-level double quotes: + + $ awk "BEGIN { print \"Here is a single quote <'>\" }" + -| Here is a single quote <'> + +This option is also painful, because double quotes, backslashes, and +dollar signs are very common in `awk' programs. + + A third option is to use the octal escape sequence equivalents for +the single- and double-quote characters, like so: + + $ awk 'BEGIN { print "Here is a single quote <\47>" }' + -| Here is a single quote <'> + $ awk 'BEGIN { print "Here is a double quote <\42>" }' + -| Here is a double quote <"> + +This works nicely, except that you should comment clearly what the +escapes mean. + + A fourth option is to use command-line variable assignment, like +this: + + $ awk -v sq="'" 'BEGIN { print "Here is a single quote <" sq ">" }' + -| Here is a single quote <'> + + If you really need both single and double quotes in your `awk' +program, it is probably best to move it into a separate file, where the +shell won't be part of the picture, and you can say what you mean. + + +File: gawk.info, Node: Sample Data Files, Next: Very Simple, Prev: Running gawk, Up: Getting Started + +1.2 Data Files for the Examples +=============================== + +Many of the examples in this Info file take their input from two sample +data files. The first, `BBS-list', represents a list of computer +bulletin board systems together with information about those systems. +The second data file, called `inventory-shipped', contains information +about monthly shipments. In both files, each line is considered to be +one "record". + + In the data file `BBS-list', each record contains the name of a +computer bulletin board, its phone number, the board's baud rate(s), +and a code for the number of hours it is operational. An `A' in the +last column means the board operates 24 hours a day. A `B' in the last +column means the board only operates on evening and weekend hours. A +`C' means the board operates only on weekends: + + aardvark 555-5553 1200/300 B + alpo-net 555-3412 2400/1200/300 A + barfly 555-7685 1200/300 A + bites 555-1675 2400/1200/300 A + camelot 555-0542 300 C + core 555-2912 1200/300 C + fooey 555-1234 2400/1200/300 B + foot 555-6699 1200/300 B + macfoo 555-6480 1200/300 A + sdace 555-3430 2400/1200/300 A + sabafoo 555-2127 1200/300 C + + The data file `inventory-shipped' represents information about +shipments during the year. Each record contains the month, the number +of green crates shipped, the number of red boxes shipped, the number of +orange bags shipped, and the number of blue packages shipped, +respectively. There are 16 entries, covering the 12 months of last year +and the first four months of the current year. + + Jan 13 25 15 115 + Feb 15 32 24 226 + Mar 15 24 34 228 + Apr 31 52 63 420 + May 16 34 29 208 + Jun 31 42 75 492 + Jul 24 34 67 436 + Aug 15 34 47 316 + Sep 13 55 37 277 + Oct 29 54 68 525 + Nov 20 87 82 577 + Dec 17 35 61 401 + + Jan 21 36 64 620 + Feb 26 58 80 652 + Mar 24 75 70 495 + Apr 21 70 74 514 + + If you are reading this in GNU Emacs using Info, you can copy the +regions of text showing these sample files into your own test files. +This way you can try out the examples shown in the remainder of this +document. You do this by using the command `M-x write-region' to copy +text from the Info file into a file for use with `awk' (*Note +Miscellaneous File Operations: (emacs)Misc File Ops, for more +information). Using this information, create your own `BBS-list' and +`inventory-shipped' files and practice what you learn in this Info file. + + If you are using the stand-alone version of Info, see *note Extract +Program::, for an `awk' program that extracts these data files from +`gawk.texi', the Texinfo source file for this Info file. + + +File: gawk.info, Node: Very Simple, Next: Two Rules, Prev: Sample Data Files, Up: Getting Started + +1.3 Some Simple Examples +======================== + +The following command runs a simple `awk' program that searches the +input file `BBS-list' for the character string `foo' (a grouping of +characters is usually called a "string"; the term "string" is based on +similar usage in English, such as "a string of pearls," or "a string of +cars in a train"): + + awk '/foo/ { print $0 }' BBS-list + +When lines containing `foo' are found, they are printed because +`print $0' means print the current line. (Just `print' by itself means +the same thing, so we could have written that instead.) + + You will notice that slashes (`/') surround the string `foo' in the +`awk' program. The slashes indicate that `foo' is the pattern to +search for. This type of pattern is called a "regular expression", +which is covered in more detail later (*note Regexp::). The pattern is +allowed to match parts of words. There are single quotes around the +`awk' program so that the shell won't interpret any of it as special +shell characters. + + Here is what this program prints: + + $ awk '/foo/ { print $0 }' BBS-list + -| fooey 555-1234 2400/1200/300 B + -| foot 555-6699 1200/300 B + -| macfoo 555-6480 1200/300 A + -| sabafoo 555-2127 1200/300 C + + In an `awk' rule, either the pattern or the action can be omitted, +but not both. If the pattern is omitted, then the action is performed +for _every_ input line. If the action is omitted, the default action +is to print all lines that match the pattern. + + Thus, we could leave out the action (the `print' statement and the +curly braces) in the previous example and the result would be the same: +all lines matching the pattern `foo' are printed. By comparison, +omitting the `print' statement but retaining the curly braces makes an +empty action that does nothing (i.e., no lines are printed). + + Many practical `awk' programs are just a line or two. Following is a +collection of useful, short programs to get you started. Some of these +programs contain constructs that haven't been covered yet. (The +description of the program will give you a good idea of what is going +on, but please read the rest of the Info file to become an `awk' +expert!) Most of the examples use a data file named `data'. This is +just a placeholder; if you use these programs yourself, substitute your +own file names for `data'. For future reference, note that there is +often more than one way to do things in `awk'. At some point, you may +want to look back at these examples and see if you can come up with +different ways to do the same things shown here: + + * Print the length of the longest input line: + + awk '{ if (length($0) > max) max = length($0) } + END { print max }' data + + * Print every line that is longer than 80 characters: + + awk 'length($0) > 80' data + + The sole rule has a relational expression as its pattern and it + has no action--so the default action, printing the record, is used. + + * Print the length of the longest line in `data': + + expand data | awk '{ if (x < length()) x = length() } + END { print "maximum line length is " x }' + + The input is processed by the `expand' utility to change tabs into + spaces, so the widths compared are actually the right-margin + columns. + + * Print every line that has at least one field: + + awk 'NF > 0' data + + This is an easy way to delete blank lines from a file (or rather, + to create a new file similar to the old file but from which the + blank lines have been removed). + + * Print seven random numbers from 0 to 100, inclusive: + + awk 'BEGIN { for (i = 1; i <= 7; i++) + print int(101 * rand()) }' + + * Print the total number of bytes used by FILES: + + ls -l FILES | awk '{ x += $5 } + END { print "total bytes: " x }' + + * Print the total number of kilobytes used by FILES: + + ls -l FILES | awk '{ x += $5 } + END { print "total K-bytes: " (x + 1023)/1024 }' + + * Print a sorted list of the login names of all users: + + awk -F: '{ print $1 }' /etc/passwd | sort + + * Count the lines in a file: + + awk 'END { print NR }' data + + * Print the even-numbered lines in the data file: + + awk 'NR % 2 == 0' data + + If you use the expression `NR % 2 == 1' instead, the program would + print the odd-numbered lines. + + +File: gawk.info, Node: Two Rules, Next: More Complex, Prev: Very Simple, Up: Getting Started + +1.4 An Example with Two Rules +============================= + +The `awk' utility reads the input files one line at a time. For each +line, `awk' tries the patterns of each of the rules. If several +patterns match, then several actions are run in the order in which they +appear in the `awk' program. If no patterns match, then no actions are +run. + + After processing all the rules that match the line (and perhaps +there are none), `awk' reads the next line. (However, *note Next +Statement::, and also *note Nextfile Statement::). This continues +until the program reaches the end of the file. For example, the +following `awk' program contains two rules: + + /12/ { print $0 } + /21/ { print $0 } + +The first rule has the string `12' as the pattern and `print $0' as the +action. The second rule has the string `21' as the pattern and also +has `print $0' as the action. Each rule's action is enclosed in its +own pair of braces. + + This program prints every line that contains the string `12' _or_ +the string `21'. If a line contains both strings, it is printed twice, +once by each rule. + + This is what happens if we run this program on our two sample data +files, `BBS-list' and `inventory-shipped': + + $ awk '/12/ { print $0 } + > /21/ { print $0 }' BBS-list inventory-shipped + -| aardvark 555-5553 1200/300 B + -| alpo-net 555-3412 2400/1200/300 A + -| barfly 555-7685 1200/300 A + -| bites 555-1675 2400/1200/300 A + -| core 555-2912 1200/300 C + -| fooey 555-1234 2400/1200/300 B + -| foot 555-6699 1200/300 B + -| macfoo 555-6480 1200/300 A + -| sdace 555-3430 2400/1200/300 A + -| sabafoo 555-2127 1200/300 C + -| sabafoo 555-2127 1200/300 C + -| Jan 21 36 64 620 + -| Apr 21 70 74 514 + +Note how the line beginning with `sabafoo' in `BBS-list' was printed +twice, once for each rule. + + +File: gawk.info, Node: More Complex, Next: Statements/Lines, Prev: Two Rules, Up: Getting Started + +1.5 A More Complex Example +========================== + +Now that we've mastered some simple tasks, let's look at what typical +`awk' programs do. This example shows how `awk' can be used to +summarize, select, and rearrange the output of another utility. It uses +features that haven't been covered yet, so don't worry if you don't +understand all the details: + + ls -l | awk '$6 == "Nov" { sum += $5 } + END { print sum }' + + This command prints the total number of bytes in all the files in the +current directory that were last modified in November (of any year). +(1) The `ls -l' part of this example is a system command that gives you +a listing of the files in a directory, including each file's size and +the date the file was last modified. Its output looks like this: + + -rw-r--r-- 1 arnold user 1933 Nov 7 13:05 Makefile + -rw-r--r-- 1 arnold user 10809 Nov 7 13:03 awk.h + -rw-r--r-- 1 arnold user 983 Apr 13 12:14 awk.tab.h + -rw-r--r-- 1 arnold user 31869 Jun 15 12:20 awkgram.y + -rw-r--r-- 1 arnold user 22414 Nov 7 13:03 awk1.c + -rw-r--r-- 1 arnold user 37455 Nov 7 13:03 awk2.c + -rw-r--r-- 1 arnold user 27511 Dec 9 13:07 awk3.c + -rw-r--r-- 1 arnold user 7989 Nov 7 13:03 awk4.c + +The first field contains read-write permissions, the second field +contains the number of links to the file, and the third field +identifies the owner of the file. The fourth field identifies the group +of the file. The fifth field contains the size of the file in bytes. +The sixth, seventh, and eighth fields contain the month, day, and time, +respectively, that the file was last modified. Finally, the ninth field +contains the name of the file.(2) + + The `$6 == "Nov"' in our `awk' program is an expression that tests +whether the sixth field of the output from `ls -l' matches the string +`Nov'. Each time a line has the string `Nov' for its sixth field, the +action `sum += $5' is performed. This adds the fifth field (the file's +size) to the variable `sum'. As a result, when `awk' has finished +reading all the input lines, `sum' is the total of the sizes of the +files whose lines matched the pattern. (This works because `awk' +variables are automatically initialized to zero.) + + After the last line of output from `ls' has been processed, the +`END' rule executes and prints the value of `sum'. In this example, +the value of `sum' is 80600. + + These more advanced `awk' techniques are covered in later sections +(*note Action Overview::). Before you can move on to more advanced +`awk' programming, you have to know how `awk' interprets your input and +displays your output. By manipulating fields and using `print' +statements, you can produce some very useful and impressive-looking +reports. + + ---------- Footnotes ---------- + + (1) In the C shell (`csh'), you need to type a semicolon and then a +backslash at the end of the first line; see *note Statements/Lines::, +for an explanation. In a POSIX-compliant shell, such as the Bourne +shell or `bash', you can type the example as shown. If the command +`echo $path' produces an empty output line, you are most likely using a +POSIX-compliant shell. Otherwise, you are probably using the C shell +or a shell derived from it. + + (2) On some very old systems, you may need to use `ls -lg' to get +this output. + + +File: gawk.info, Node: Statements/Lines, Next: Other Features, Prev: More Complex, Up: Getting Started + +1.6 `awk' Statements Versus Lines +================================= + +Most often, each line in an `awk' program is a separate statement or +separate rule, like this: + + awk '/12/ { print $0 } + /21/ { print $0 }' BBS-list inventory-shipped + + However, `gawk' ignores newlines after any of the following symbols +and keywords: + + , { ? : || && do else + +A newline at any other point is considered the end of the statement.(1) + + If you would like to split a single statement into two lines at a +point where a newline would terminate it, you can "continue" it by +ending the first line with a backslash character (`\'). The backslash +must be the final character on the line in order to be recognized as a +continuation character. A backslash is allowed anywhere in the +statement, even in the middle of a string or regular expression. For +example: + + awk '/This regular expression is too long, so continue it\ + on the next line/ { print $1 }' + +We have generally not used backslash continuation in the sample programs +in this Info file. In `gawk', there is no limit on the length of a +line, so backslash continuation is never strictly necessary; it just +makes programs more readable. For this same reason, as well as for +clarity, we have kept most statements short in the sample programs +presented throughout the Info file. Backslash continuation is most +useful when your `awk' program is in a separate source file instead of +entered from the command line. You should also note that many `awk' +implementations are more particular about where you may use backslash +continuation. For example, they may not allow you to split a string +constant using backslash continuation. Thus, for maximum portability +of your `awk' programs, it is best not to split your lines in the +middle of a regular expression or a string. + + *Caution:* _Backslash continuation does not work as described with +the C shell._ It works for `awk' programs in files and for one-shot +programs, _provided_ you are using a POSIX-compliant shell, such as the +Unix Bourne shell or `bash'. But the C shell behaves differently! +There, you must use two backslashes in a row, followed by a newline. +Note also that when using the C shell, _every_ newline in your awk +program must be escaped with a backslash. To illustrate: + + % awk 'BEGIN { \ + ? print \\ + ? "hello, world" \ + ? }' + -| hello, world + +Here, the `%' and `?' are the C shell's primary and secondary prompts, +analogous to the standard shell's `$' and `>'. + + Compare the previous example to how it is done with a +POSIX-compliant shell: + + $ awk 'BEGIN { + > print \ + > "hello, world" + > }' + -| hello, world + + `awk' is a line-oriented language. Each rule's action has to begin +on the same line as the pattern. To have the pattern and action on +separate lines, you _must_ use backslash continuation; there is no +other option. + + Another thing to keep in mind is that backslash continuation and +comments do not mix. As soon as `awk' sees the `#' that starts a +comment, it ignores _everything_ on the rest of the line. For example: + + $ gawk 'BEGIN { print "dont panic" # a friendly \ + > BEGIN rule + > }' + error--> gawk: cmd. line:2: BEGIN rule + error--> gawk: cmd. line:2: ^ parse error + +In this case, it looks like the backslash would continue the comment +onto the next line. However, the backslash-newline combination is never +even noticed because it is "hidden" inside the comment. Thus, the +`BEGIN' is noted as a syntax error. + + When `awk' statements within one rule are short, you might want to +put more than one of them on a line. This is accomplished by +separating the statements with a semicolon (`;'). This also applies to +the rules themselves. Thus, the program shown at the start of this +minor node could also be written this way: + + /12/ { print $0 } ; /21/ { print $0 } + + NOTE: The requirement that states that rules on the same line must + be separated with a semicolon was not in the original `awk' + language; it was added for consistency with the treatment of + statements within an action. + + ---------- Footnotes ---------- + + (1) The `?' and `:' referred to here is the three-operand +conditional expression described in *note Conditional Exp::. Splitting +lines after `?' and `:' is a minor `gawk' extension; if `--posix' is +specified (*note Options::), then this extension is disabled. + + +File: gawk.info, Node: Other Features, Next: When, Prev: Statements/Lines, Up: Getting Started + +1.7 Other Features of `awk' +=========================== + +The `awk' language provides a number of predefined, or "built-in", +variables that your programs can use to get information from `awk'. +There are other variables your program can set as well to control how +`awk' processes your data. + + In addition, `awk' provides a number of built-in functions for doing +common computational and string-related operations. `gawk' provides +built-in functions for working with timestamps, performing bit +manipulation, and for runtime string translation. + + As we develop our presentation of the `awk' language, we introduce +most of the variables and many of the functions. They are defined +systematically in *note Built-in Variables::, and *note Built-in::. + + +File: gawk.info, Node: When, Prev: Other Features, Up: Getting Started + +1.8 When to Use `awk' +===================== + +Now that you've seen some of what `awk' can do, you might wonder how +`awk' could be useful for you. By using utility programs, advanced +patterns, field separators, arithmetic statements, and other selection +criteria, you can produce much more complex output. The `awk' language +is very useful for producing reports from large amounts of raw data, +such as summarizing information from the output of other utility +programs like `ls'. (*Note More Complex::.) + + Programs written with `awk' are usually much smaller than they would +be in other languages. This makes `awk' programs easy to compose and +use. Often, `awk' programs can be quickly composed at your terminal, +used once, and thrown away. Because `awk' programs are interpreted, you +can avoid the (usually lengthy) compilation part of the typical +edit-compile-test-debug cycle of software development. + + Complex programs have been written in `awk', including a complete +retargetable assembler for eight-bit microprocessors (*note Glossary::, +for more information), and a microcode assembler for a special-purpose +Prolog computer. More recently, `gawk' was used for writing a Wiki +clone.(1) While the original `awk''s capabilities were strained by tasks +of such complexity, modern versions are more capable. Even the Bell +Labs version of `awk' has fewer predefined limits, and those that it +has are much larger than they used to be. + + If you find yourself writing `awk' scripts of more than, say, a few +hundred lines, you might consider using a different programming +language. Emacs Lisp is a good choice if you need sophisticated string +or pattern matching capabilities. The shell is also good at string and +pattern matching; in addition, it allows powerful use of the system +utilities. More conventional languages, such as C, C++, and Java, offer +better facilities for system programming and for managing the complexity +of large programs. Programs in these languages may require more lines +of source code than the equivalent `awk' programs, but they are easier +to maintain and usually run more efficiently. + + ---------- Footnotes ---------- + + (1) Yet Another Wiki Clone +(http://www.awk-scripting.de/cgi-bin/wiki.cgi/yawk/). + + +File: gawk.info, Node: Regexp, Next: Reading Files, Prev: Getting Started, Up: Top + +2 Regular Expressions +********************* + +A "regular expression", or "regexp", is a way of describing a set of +strings. Because regular expressions are such a fundamental part of +`awk' programming, their format and use deserve a separate major node. + + A regular expression enclosed in slashes (`/') is an `awk' pattern +that matches every input record whose text belongs to that set. The +simplest regular expression is a sequence of letters, numbers, or both. +Such a regexp matches any string that contains that sequence. Thus, +the regexp `foo' matches any string containing `foo'. Therefore, the +pattern `/foo/' matches any input record containing the three +characters `foo' _anywhere_ in the record. Other kinds of regexps let +you specify more complicated classes of strings. + +* Menu: + +* Regexp Usage:: How to Use Regular Expressions. +* Escape Sequences:: How to write nonprinting characters. +* Regexp Operators:: Regular Expression Operators. +* Character Lists:: What can go between `[...]'. +* GNU Regexp Operators:: Operators specific to GNU software. +* Case-sensitivity:: How to do case-insensitive matching. +* Leftmost Longest:: How much text matches. +* Computed Regexps:: Using Dynamic Regexps. +* Locales:: How the locale affects things. + + +File: gawk.info, Node: Regexp Usage, Next: Escape Sequences, Up: Regexp + +2.1 How to Use Regular Expressions +================================== + +A regular expression can be used as a pattern by enclosing it in +slashes. Then the regular expression is tested against the entire text +of each record. (Normally, it only needs to match some part of the +text in order to succeed.) For example, the following prints the +second field of each record that contains the string `foo' anywhere in +it: + + $ awk '/foo/ { print $2 }' BBS-list + -| 555-1234 + -| 555-6699 + -| 555-6480 + -| 555-2127 + + `~' (tilde), `~' operator Regular expressions can also be used in +matching expressions. These expressions allow you to specify the +string to match against; it need not be the entire current input +record. The two operators `~' and `!~' perform regular expression +comparisons. Expressions using these operators can be used as +patterns, or in `if', `while', `for', and `do' statements. (*Note +Statements::.) For example: + + EXP ~ /REGEXP/ + +is true if the expression EXP (taken as a string) matches REGEXP. The +following example matches, or selects, all input records with the +uppercase letter `J' somewhere in the first field: + + $ awk '$1 ~ /J/' inventory-shipped + -| Jan 13 25 15 115 + -| Jun 31 42 75 492 + -| Jul 24 34 67 436 + -| Jan 21 36 64 620 + + So does this: + + awk '{ if ($1 ~ /J/) print }' inventory-shipped + + This next example is true if the expression EXP (taken as a +character string) does _not_ match REGEXP: + + EXP !~ /REGEXP/ + + The following example matches, or selects, all input records whose +first field _does not_ contain the uppercase letter `J': + + $ awk '$1 !~ /J/' inventory-shipped + -| Feb 15 32 24 226 + -| Mar 15 24 34 228 + -| Apr 31 52 63 420 + -| May 16 34 29 208 + ... + + When a regexp is enclosed in slashes, such as `/foo/', we call it a +"regexp constant", much like `5.27' is a numeric constant and `"foo"' +is a string constant. + + +File: gawk.info, Node: Escape Sequences, Next: Regexp Operators, Prev: Regexp Usage, Up: Regexp + +2.2 Escape Sequences +==================== + +Some characters cannot be included literally in string constants +(`"foo"') or regexp constants (`/foo/'). Instead, they should be +represented with "escape sequences", which are character sequences +beginning with a backslash (`\'). One use of an escape sequence is to +include a double-quote character in a string constant. Because a plain +double quote ends the string, you must use `\"' to represent an actual +double-quote character as a part of the string. For example: + + $ awk 'BEGIN { print "He said \"hi!\" to her." }' + -| He said "hi!" to her. + + The backslash character itself is another character that cannot be +included normally; you must write `\\' to put one backslash in the +string or regexp. Thus, the string whose contents are the two +characters `"' and `\' must be written `"\"\\"'. + + Backslash also represents unprintable characters such as TAB or +newline. While there is nothing to stop you from entering most +unprintable characters directly in a string constant or regexp constant, +they may look ugly. + + The following table lists all the escape sequences used in `awk' and +what they represent. Unless noted otherwise, all these escape sequences +apply to both string constants and regexp constants: + +`\\' + A literal backslash, `\'. + +`\a' + The "alert" character, `Ctrl-g', ASCII code 7 (BEL). (This + usually makes some sort of audible noise.) + +`\b' + Backspace, `Ctrl-h', ASCII code 8 (BS). + +`\f' + Formfeed, `Ctrl-l', ASCII code 12 (FF). + +`\n' + Newline, `Ctrl-j', ASCII code 10 (LF). + +`\r' + Carriage return, `Ctrl-m', ASCII code 13 (CR). + +`\t' + Horizontal TAB, `Ctrl-i', ASCII code 9 (HT). + +`\v' + Vertical tab, `Ctrl-k', ASCII code 11 (VT). + +`\NNN' + The octal value NNN, where NNN stands for 1 to 3 digits between + `0' and `7'. For example, the code for the ASCII ESC (escape) + character is `\033'. + +`\xHH...' + The hexadecimal value HH, where HH stands for a sequence of + hexadecimal digits (`0'-`9', and either `A'-`F' or `a'-`f'). Like + the same construct in ISO C, the escape sequence continues until + the first nonhexadecimal digit is seen. However, using more than + two hexadecimal digits produces undefined results. (The `\x' + escape sequence is not allowed in POSIX `awk'.) + +`\/' + A literal slash (necessary for regexp constants only). This + expression is used when you want to write a regexp constant that + contains a slash. Because the regexp is delimited by slashes, you + need to escape the slash that is part of the pattern, in order to + tell `awk' to keep processing the rest of the regexp. + +`\"' + A literal double quote (necessary for string constants only). + This expression is used when you want to write a string constant + that contains a double quote. Because the string is delimited by + double quotes, you need to escape the quote that is part of the + string, in order to tell `awk' to keep processing the rest of the + string. + + In `gawk', a number of additional two-character sequences that begin +with a backslash have special meaning in regexps. *Note GNU Regexp +Operators::. + + In a regexp, a backslash before any character that is not in the +previous list and not listed in *note GNU Regexp Operators::, means +that the next character should be taken literally, even if it would +normally be a regexp operator. For example, `/a\+b/' matches the three +characters `a+b'. + + For complete portability, do not use a backslash before any +character not shown in the previous list. + + To summarize: + + * The escape sequences in the table above are always processed first, + for both string constants and regexp constants. This happens very + early, as soon as `awk' reads your program. + + * `gawk' processes both regexp constants and dynamic regexps (*note + Computed Regexps::), for the special operators listed in *note GNU + Regexp Operators::. + + * A backslash before any other character means to treat that + character literally. + +Advanced Notes: Backslash Before Regular Characters +--------------------------------------------------- + +If you place a backslash in a string constant before something that is +not one of the characters previously listed, POSIX `awk' purposely +leaves what happens as undefined. There are two choices: + +Strip the backslash out + This is what Unix `awk' and `gawk' both do. For example, `"a\qc"' + is the same as `"aqc"'. (Because this is such an easy bug both to + introduce and to miss, `gawk' warns you about it.) Consider `FS = + "[ \t]+\|[ \t]+"' to use vertical bars surrounded by whitespace as + the field separator. There should be two backslashes in the string + `FS = "[ \t]+\\|[ \t]+"'.) + +Leave the backslash alone + Some other `awk' implementations do this. In such + implementations, typing `"a\qc"' is the same as typing `"a\\qc"'. + +Advanced Notes: Escape Sequences for Metacharacters +--------------------------------------------------- + +Suppose you use an octal or hexadecimal escape to represent a regexp +metacharacter. (See *note Regexp Operators::.) Does `awk' treat the +character as a literal character or as a regexp operator? + + Historically, such characters were taken literally. (d.c.) +However, the POSIX standard indicates that they should be treated as +real metacharacters, which is what `gawk' does. In compatibility mode +(*note Options::), `gawk' treats the characters represented by octal +and hexadecimal escape sequences literally when used in regexp +constants. Thus, `/a\52b/' is equivalent to `/a\*b/'. + + +File: gawk.info, Node: Regexp Operators, Next: Character Lists, Prev: Escape Sequences, Up: Regexp + +2.3 Regular Expression Operators +================================ + +You can combine regular expressions with special characters, called +"regular expression operators" or "metacharacters", to increase the +power and versatility of regular expressions. + + The escape sequences described in *note Escape Sequences::, are +valid inside a regexp. They are introduced by a `\' and are recognized +and converted into corresponding real characters as the very first step +in processing regexps. + + Here is a list of metacharacters. All characters that are not escape +sequences and that are not listed in the table stand for themselves: + +`\' + This is used to suppress the special meaning of a character when + matching. For example, `\$' matches the character `$'. + +`^' + This matches the beginning of a string. For example, `^@chapter' + matches `@chapter' at the beginning of a string and can be used to + identify chapter beginnings in Texinfo source files. The `^' is + known as an "anchor", because it anchors the pattern to match only + at the beginning of the string. + + It is important to realize that `^' does not match the beginning of + a line embedded in a string. The condition is not true in the + following example: + + if ("line1\nLINE 2" ~ /^L/) ... + +`$' + This is similar to `^', but it matches only at the end of a string. + For example, `p$' matches a record that ends with a `p'. The `$' + is an anchor and does not match the end of a line embedded in a + string. The condition in the following example is not true: + + if ("line1\nLINE 2" ~ /1$/) ... + +`.' + This matches any single character, _including_ the newline + character. For example, `.P' matches any single character + followed by a `P' in a string. Using concatenation, we can make a + regular expression such as `U.A', which matches any + three-character sequence that begins with `U' and ends with `A'. + + In strict POSIX mode (*note Options::), `.' does not match the NUL + character, which is a character with all bits equal to zero. + Otherwise, NUL is just another character. Other versions of `awk' + may not be able to match the NUL character. + +`[...]' + This is called a "character list".(1) It matches any _one_ of the + characters that are enclosed in the square brackets. For example, + `[MVX]' matches any one of the characters `M', `V', or `X' in a + string. A full discussion of what can be inside the square + brackets of a character list is given in *note Character Lists::. + +`[^ ...]' + This is a "complemented character list". The first character after + the `[' _must_ be a `^'. It matches any characters _except_ those + in the square brackets. For example, `[^awk]' matches any + character that is not an `a', `w', or `k'. + +`|' + This is the "alternation operator" and it is used to specify + alternatives. The `|' has the lowest precedence of all the regular + expression operators. For example, `^P|[[:digit:]]' matches any + string that matches either `^P' or `[[:digit:]]'. This means it + matches any string that starts with `P' or contains a digit. + + The alternation applies to the largest possible regexps on either + side. + +`(...)' + Parentheses are used for grouping in regular expressions, as in + arithmetic. They can be used to concatenate regular expressions + containing the alternation operator, `|'. For example, + `@(samp|code)\{[^}]+\}' matches both `@code{foo}' and `@samp{bar}'. + (These are Texinfo formatting control sequences. The `+' is + explained further on in this list.) + +`*' + This symbol means that the preceding regular expression should be + repeated as many times as necessary to find a match. For example, + `ph*' applies the `*' symbol to the preceding `h' and looks for + matches of one `p' followed by any number of `h's. This also + matches just `p' if no `h's are present. + + The `*' repeats the _smallest_ possible preceding expression. + (Use parentheses if you want to repeat a larger expression.) It + finds as many repetitions as possible. For example, `awk + '/\(c[ad][ad]*r x\)/ { print }' sample' prints every record in + `sample' containing a string of the form `(car x)', `(cdr x)', + `(cadr x)', and so on. Notice the escaping of the parentheses by + preceding them with backslashes. + +`+' + This symbol is similar to `*', except that the preceding + expression must be matched at least once. This means that `wh+y' + would match `why' and `whhy', but not `wy', whereas `wh*y' would + match all three of these strings. The following is a simpler way + of writing the last `*' example: + + awk '/\(c[ad]+r x\)/ { print }' sample + +`?' + This symbol is similar to `*', except that the preceding + expression can be matched either once or not at all. For example, + `fe?d' matches `fed' and `fd', but nothing else. + +`{N}' +`{N,}' +`{N,M}' + One or two numbers inside braces denote an "interval expression". + If there is one number in the braces, the preceding regexp is + repeated N times. If there are two numbers separated by a comma, + the preceding regexp is repeated N to M times. If there is one + number followed by a comma, then the preceding regexp is repeated + at least N times: + + `wh{3}y' + Matches `whhhy', but not `why' or `whhhhy'. + + `wh{3,5}y' + Matches `whhhy', `whhhhy', or `whhhhhy', only. + + `wh{2,}y' + Matches `whhy' or `whhhy', and so on. + + Interval expressions were not traditionally available in `awk'. + They were added as part of the POSIX standard to make `awk' and + `egrep' consistent with each other. + + However, because old programs may use `{' and `}' in regexp + constants, by default `gawk' does _not_ match interval expressions + in regexps. If either `--posix' or `--re-interval' are specified + (*note Options::), then interval expressions are allowed in + regexps. + + For new programs that use `{' and `}' in regexp constants, it is + good practice to always escape them with a backslash. Then the + regexp constants are valid and work the way you want them to, using + any version of `awk'.(2) + + In regular expressions, the `*', `+', and `?' operators, as well as +the braces `{' and `}', have the highest precedence, followed by +concatenation, and finally by `|'. As in arithmetic, parentheses can +change how operators are grouped. + + In POSIX `awk' and `gawk', the `*', `+', and `?' operators stand for +themselves when there is nothing in the regexp that precedes them. For +example, `/+/' matches a literal plus sign. However, many other +versions of `awk' treat such a usage as a syntax error. + + If `gawk' is in compatibility mode (*note Options::), POSIX +character classes and interval expressions are not available in regular +expressions. + + ---------- Footnotes ---------- + + (1) In other literature, you may see a character list referred to as +either a "character set", a "character class", or a "bracket +expression". + + (2) Use two backslashes if you're using a string constant with a +regexp operator or function. + + +File: gawk.info, Node: Character Lists, Next: GNU Regexp Operators, Prev: Regexp Operators, Up: Regexp + +2.4 Using Character Lists +========================= + +Within a character list, a "range expression" consists of two +characters separated by a hyphen. It matches any single character that +sorts between the two characters, using the locale's collating sequence +and character set. For example, in the default C locale, `[a-dx-z]' is +equivalent to `[abcdxyz]'. Many locales sort characters in dictionary +order, and in these locales, `[a-dx-z]' is typically not equivalent to +`[abcdxyz]'; instead it might be equivalent to `[aBbCcDdxXyYz]', for +example. To obtain the traditional interpretation of bracket +expressions, you can use the C locale by setting the `LC_ALL' +environment variable to the value `C'. + + To include one of the characters `\', `]', `-', or `^' in a +character list, put a `\' in front of it. For example: + + [d\]] + +matches either `d' or `]'. + + This treatment of `\' in character lists is compatible with other +`awk' implementations and is also mandated by POSIX. The regular +expressions in `awk' are a superset of the POSIX specification for +Extended Regular Expressions (EREs). POSIX EREs are based on the +regular expressions accepted by the traditional `egrep' utility. + + "Character classes" are a new feature introduced in the POSIX +standard. A character class is a special notation for describing lists +of characters that have a specific attribute, but the actual characters +can vary from country to country and/or from character set to character +set. For example, the notion of what is an alphabetic character +differs between the United States and France. + + A character class is only valid in a regexp _inside_ the brackets of +a character list. Character classes consist of `[:', a keyword +denoting the class, and `:]'. *note table-char-classes:: lists the +character classes defined by the POSIX standard. + +Class Meaning +-------------------------------------------------------------------------- +`[:alnum:]' Alphanumeric characters. +`[:alpha:]' Alphabetic characters. +`[:blank:]' Space and TAB characters. +`[:cntrl:]' Control characters. +`[:digit:]' Numeric characters. +`[:graph:]' Characters that are both printable and visible. (A space is + printable but not visible, whereas an `a' is both.) +`[:lower:]' Lowercase alphabetic characters. +`[:print:]' Printable characters (characters that are not control + characters). +`[:punct:]' Punctuation characters (characters that are not letters, + digits, control characters, or space characters). +`[:space:]' Space characters (such as space, TAB, and formfeed, to name + a few). +`[:upper:]' Uppercase alphabetic characters. +`[:xdigit:]'Characters that are hexadecimal digits. + +Table 2.1: POSIX Character Classes + + For example, before the POSIX standard, you had to write +`/[A-Za-z0-9]/' to match alphanumeric characters. If your character +set had other alphabetic characters in it, this would not match them, +and if your character set collated differently from ASCII, this might +not even match the ASCII alphanumeric characters. With the POSIX +character classes, you can write `/[[:alnum:]]/' to match the alphabetic +and numeric characters in your character set. + + Two additional special sequences can appear in character lists. +These apply to non-ASCII character sets, which can have single symbols +(called "collating elements") that are represented with more than one +character. They can also have several characters that are equivalent for +"collating", or sorting, purposes. (For example, in French, a plain "e" +and a grave-accented "e`" are equivalent.) These sequences are: + +Collating symbols + Multicharacter collating elements enclosed between `[.' and `.]'. + For example, if `ch' is a collating element, then `[[.ch.]]' is a + regexp that matches this collating element, whereas `[ch]' is a + regexp that matches either `c' or `h'. + +Equivalence classes + Locale-specific names for a list of characters that are equal. The + name is enclosed between `[=' and `=]'. For example, the name `e' + might be used to represent all of "e," "e`," and "e'." In this + case, `[[=e=]]' is a regexp that matches any of `e', `e'', or `e`'. + + These features are very valuable in non-English-speaking locales. + + *Caution:* The library functions that `gawk' uses for regular +expression matching currently recognize only POSIX character classes; +they do not recognize collating symbols or equivalence classes. + + +File: gawk.info, Node: GNU Regexp Operators, Next: Case-sensitivity, Prev: Character Lists, Up: Regexp + +2.5 `gawk'-Specific Regexp Operators +==================================== + +GNU software that deals with regular expressions provides a number of +additional regexp operators. These operators are described in this +minor node and are specific to `gawk'; they are not available in other +`awk' implementations. Most of the additional operators deal with word +matching. For our purposes, a "word" is a sequence of one or more +letters, digits, or underscores (`_'): + +`\w' + Matches any word-constituent character--that is, it matches any + letter, digit, or underscore. Think of it as shorthand for + `[[:alnum:]_]'. + +`\W' + Matches any character that is not word-constituent. Think of it + as shorthand for `[^[:alnum:]_]'. + +`\<' + Matches the empty string at the beginning of a word. For example, + `/\<away/' matches `away' but not `stowaway'. + +`\>' + Matches the empty string at the end of a word. For example, + `/stow\>/' matches `stow' but not `stowaway'. + +`\y' + Matches the empty string at either the beginning or the end of a + word (i.e., the word boundar*y*). For example, `\yballs?\y' + matches either `ball' or `balls', as a separate word. + +`\B' + Matches the empty string that occurs between two word-constituent + characters. For example, `/\Brat\B/' matches `crate' but it does + not match `dirty rat'. `\B' is essentially the opposite of `\y'. + + There are two other operators that work on buffers. In Emacs, a +"buffer" is, naturally, an Emacs buffer. For other programs, `gawk''s +regexp library routines consider the entire string to match as the +buffer. The operators are: + +`\`' + Matches the empty string at the beginning of a buffer (string). + +`\'' + Matches the empty string at the end of a buffer (string). + + Because `^' and `$' always work in terms of the beginning and end of +strings, these operators don't add any new capabilities for `awk'. +They are provided for compatibility with other GNU software. + + In other GNU software, the word-boundary operator is `\b'. However, +that conflicts with the `awk' language's definition of `\b' as +backspace, so `gawk' uses a different letter. An alternative method +would have been to require two backslashes in the GNU operators, but +this was deemed too confusing. The current method of using `\y' for the +GNU `\b' appears to be the lesser of two evils. + + The various command-line options (*note Options::) control how +`gawk' interprets characters in regexps: + +No options + In the default case, `gawk' provides all the facilities of POSIX + regexps and the GNU regexp operators described in *note Regexp + Operators::. However, interval expressions are not supported. + +`--posix' + Only POSIX regexps are supported; the GNU operators are not special + (e.g., `\w' matches a literal `w'). Interval expressions are + allowed. + +`--traditional' + Traditional Unix `awk' regexps are matched. The GNU operators are + not special, interval expressions are not available, nor are the + POSIX character classes (`[[:alnum:]]', etc.). Characters + described by octal and hexadecimal escape sequences are treated + literally, even if they represent regexp metacharacters. Also, + `gawk' silently skips directories named on the command line. + +`--re-interval' + Allow interval expressions in regexps, even if `--traditional' has + been provided. (`--posix' automatically enables interval + expressions, so `--re-interval' is redundant when `--posix' is is + used.) + + +File: gawk.info, Node: Case-sensitivity, Next: Leftmost Longest, Prev: GNU Regexp Operators, Up: Regexp + +2.6 Case Sensitivity in Matching +================================ + +Case is normally significant in regular expressions, both when matching +ordinary characters (i.e., not metacharacters) and inside character +sets. Thus, a `w' in a regular expression matches only a lowercase `w' +and not an uppercase `W'. + + The simplest way to do a case-independent match is to use a character +list--for example, `[Ww]'. However, this can be cumbersome if you need +to use it often, and it can make the regular expressions harder to +read. There are two alternatives that you might prefer. + + One way to perform a case-insensitive match at a particular point in +the program is to convert the data to a single case, using the +`tolower' or `toupper' built-in string functions (which we haven't +discussed yet; *note String Functions::). For example: + + tolower($1) ~ /foo/ { ... } + +converts the first field to lowercase before matching against it. This +works in any POSIX-compliant `awk'. + + Another method, specific to `gawk', is to set the variable +`IGNORECASE' to a nonzero value (*note Built-in Variables::). When +`IGNORECASE' is not zero, _all_ regexp and string operations ignore +case. Changing the value of `IGNORECASE' dynamically controls the +case-sensitivity of the program as it runs. Case is significant by +default because `IGNORECASE' (like most variables) is initialized to +zero: + + x = "aB" + if (x ~ /ab/) ... # this test will fail + + IGNORECASE = 1 + if (x ~ /ab/) ... # now it will succeed + + In general, you cannot use `IGNORECASE' to make certain rules +case-insensitive and other rules case-sensitive, because there is no +straightforward way to set `IGNORECASE' just for the pattern of a +particular rule.(1) To do this, use either character lists or +`tolower'. However, one thing you can do with `IGNORECASE' only is +dynamically turn case-sensitivity on or off for all the rules at once. + + `IGNORECASE' can be set on the command line or in a `BEGIN' rule +(*note Other Arguments::; also *note Using BEGIN/END::). Setting +`IGNORECASE' from the command line is a way to make a program +case-insensitive without having to edit it. + + Prior to `gawk' 3.0, the value of `IGNORECASE' affected regexp +operations only. It did not affect string comparison with `==', `!=', +and so on. Beginning with version 3.0, both regexp and string +comparison operations are also affected by `IGNORECASE'. + + Beginning with `gawk' 3.0, the equivalences between upper- and +lowercase characters are based on the ISO-8859-1 (ISO Latin-1) +character set. This character set is a superset of the traditional 128 +ASCII characters, which also provides a number of characters suitable +for use with European languages. + + As of `gawk' 3.1.4, the case equivalences are fully locale-aware. +They are based on the C `<ctype.h>' facilities, such as `isalpha()' and +`toupper()'. + + The value of `IGNORECASE' has no effect if `gawk' is in +compatibility mode (*note Options::). Case is always significant in +compatibility mode. + + ---------- Footnotes ---------- + + (1) Experienced C and C++ programmers will note that it is possible, +using something like `IGNORECASE = 1 && /foObAr/ { ... }' and +`IGNORECASE = 0 || /foobar/ { ... }'. However, this is somewhat +obscure and we don't recommend it. + + +File: gawk.info, Node: Leftmost Longest, Next: Computed Regexps, Prev: Case-sensitivity, Up: Regexp + +2.7 How Much Text Matches? +========================== + +Consider the following: + + echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }' + + This example uses the `sub' function (which we haven't discussed yet; +*note String Functions::) to make a change to the input record. Here, +the regexp `/a+/' indicates "one or more `a' characters," and the +replacement text is `<A>'. + + The input contains four `a' characters. `awk' (and POSIX) regular +expressions always match the leftmost, _longest_ sequence of input +characters that can match. Thus, all four `a' characters are replaced +with `<A>' in this example: + + $ echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }' + -| <A>bcd + + For simple match/no-match tests, this is not so important. But when +doing text matching and substitutions with the `match', `sub', `gsub', +and `gensub' functions, it is very important. *Note String Functions::, +for more information on these functions. Understanding this principle +is also important for regexp-based record and field splitting (*note +Records::, and also *note Field Separators::). + + +File: gawk.info, Node: Computed Regexps, Next: Locales, Prev: Leftmost Longest, Up: Regexp + +2.8 Using Dynamic Regexps +========================= + +The righthand side of a `~' or `!~' operator need not be a regexp +constant (i.e., a string of characters between slashes). It may be any +expression. The expression is evaluated and converted to a string if +necessary; the contents of the string are used as the regexp. A regexp +that is computed in this way is called a "dynamic regexp": + + BEGIN { digits_regexp = "[[:digit:]]+" } + $0 ~ digits_regexp { print } + +This sets `digits_regexp' to a regexp that describes one or more digits, +and tests whether the input record matches this regexp. + + *Caution:* When using the `~' and `!~' operators, there is a +difference between a regexp constant enclosed in slashes and a string +constant enclosed in double quotes. If you are going to use a string +constant, you have to understand that the string is, in essence, +scanned _twice_: the first time when `awk' reads your program, and the +second time when it goes to match the string on the lefthand side of +the operator with the pattern on the right. This is true of any +string-valued expression (such as `digits_regexp', shown previously), +not just string constants. + + What difference does it make if the string is scanned twice? The +answer has to do with escape sequences, and particularly with +backslashes. To get a backslash into a regular expression inside a +string, you have to type two backslashes. + + For example, `/\*/' is a regexp constant for a literal `*'. Only +one backslash is needed. To do the same thing with a string, you have +to type `"\\*"'. The first backslash escapes the second one so that +the string actually contains the two characters `\' and `*'. + + Given that you can use both regexp and string constants to describe +regular expressions, which should you use? The answer is "regexp +constants," for several reasons: + + * String constants are more complicated to write and more difficult + to read. Using regexp constants makes your programs less + error-prone. Not understanding the difference between the two + kinds of constants is a common source of errors. + + * It is more efficient to use regexp constants. `awk' can note that + you have supplied a regexp and store it internally in a form that + makes pattern matching more efficient. When using a string + constant, `awk' must first convert the string into this internal + form and then perform the pattern matching. + + * Using regexp constants is better form; it shows clearly that you + intend a regexp match. + +Advanced Notes: Using `\n' in Character Lists of Dynamic Regexps +---------------------------------------------------------------- + +Some commercial versions of `awk' do not allow the newline character to +be used inside a character list for a dynamic regexp: + + $ awk '$0 ~ "[ \t\n]"' + error--> awk: newline in character class [ + error--> ]... + error--> source line number 1 + error--> context is + error--> >>> <<< + + But a newline in a regexp constant works with no problem: + + $ awk '$0 ~ /[ \t\n]/' + here is a sample line + -| here is a sample line + Ctrl-d + + `gawk' does not have this problem, and it isn't likely to occur +often in practice, but it's worth noting for future reference. + + +File: gawk.info, Node: Locales, Prev: Computed Regexps, Up: Regexp + +2.9 Where You Are Makes A Difference +==================================== + +Modern systems support the notion of "locales": a way to tell the +system about the local character set and language. The current locale +setting can affect the way regexp matching works, often in surprising +ways. In particular, many locales do case-insensitive matching, even +when you may have specified characters of only one particular case. + + The following example uses the `sub' function, which does text +replacement (*note String Functions::). Here, the intent is to remove +trailing uppercase characters: + + $ echo something1234abc | gawk '{ sub("[A-Z]*$", ""); print }' + -| something1234 + +This output is unexpected, since the `abc' at the end of +`something1234abc' should not normally match `[A-Z]*'. This result is +due to the locale setting (and thus you may not see it on your system). +There are two fixes. The first is to use the POSIX character class +`[[:upper:]]', instead of `[A-Z]'. (This is preferred, since then your +program will work everywhere.) The second is to change the locale +setting in the environment, before running `gawk', by using the shell +statements: + + LANG=C LC_ALL=C + export LANG LC_ALL + + The setting `C' forces `gawk' to behave in the traditional Unix +manner, where case distinctions do matter. You may wish to put these +statements into your shell startup file, e.g., `$HOME/.profile'. + + Similar considerations apply to other ranges. For example, `["-/]' +is perfectly valid in ASCII, but is not valid in many Unicode locales, +such as `en_US.UTF-8'. (In general, such ranges should be avoided; +either list the characters individually, or use a POSIX character class +such as `[[:punct:]]'.) + + For the normal case of `RS = "\n"', the locale is largely irrelevant. +For other single-character record separators, using `LC_ALL=C' will +give you much better performance when reading records. Otherwise, +`gawk' has to make several function calls, _per input character_ to +find the record terminator. + + Finally, the locale affects the value of the decimal point character +used when `gawk' parses input data. This is discussed in detail in +*note Conversion::. + + +File: gawk.info, Node: Reading Files, Next: Printing, Prev: Regexp, Up: Top + +3 Reading Input Files +********************* + +In the typical `awk' program, all input is read either from the +standard input (by default, this is the keyboard, but often it is a +pipe from another command) or from files whose names you specify on the +`awk' command line. If you specify input files, `awk' reads them in +order, processing all the data from one before going on to the next. +The name of the current input file can be found in the built-in variable +`FILENAME' (*note Built-in Variables::). + + The input is read in units called "records", and is processed by the +rules of your program one record at a time. By default, each record is +one line. Each record is automatically split into chunks called +"fields". This makes it more convenient for programs to work on the +parts of a record. + + On rare occasions, you may need to use the `getline' command. The +`getline' command is valuable, both because it can do explicit input +from any number of files, and because the files used with it do not +have to be named on the `awk' command line (*note Getline::). + +* Menu: + +* Records:: Controlling how data is split into records. +* Fields:: An introduction to fields. +* Nonconstant Fields:: Nonconstant Field Numbers. +* Changing Fields:: Changing the Contents of a Field. +* Field Separators:: The field separator and how to change it. +* Constant Size:: Reading constant width data. +* Multiple Line:: Reading multi-line records. +* Getline:: Reading files under explicit program control + using the `getline' function. + + +File: gawk.info, Node: Records, Next: Fields, Up: Reading Files + +3.1 How Input Is Split into Records +=================================== + +The `awk' utility divides the input for your `awk' program into records +and fields. `awk' keeps track of the number of records that have been +read so far from the current input file. This value is stored in a +built-in variable called `FNR'. It is reset to zero when a new file is +started. Another built-in variable, `NR', is the total number of input +records read so far from all data files. It starts at zero, but is +never automatically reset to zero. + + Records are separated by a character called the "record separator". +By default, the record separator is the newline character. This is why +records are, by default, single lines. A different character can be +used for the record separator by assigning the character to the +built-in variable `RS'. + + Like any other variable, the value of `RS' can be changed in the +`awk' program with the assignment operator, `=' (*note Assignment +Ops::). The new record-separator character should be enclosed in +quotation marks, which indicate a string constant. Often the right +time to do this is at the beginning of execution, before any input is +processed, so that the very first record is read with the proper +separator. To do this, use the special `BEGIN' pattern (*note +BEGIN/END::). For example: + + awk 'BEGIN { RS = "/" } + { print $0 }' BBS-list + +changes the value of `RS' to `"/"', before reading any input. This is +a string whose first character is a slash; as a result, records are +separated by slashes. Then the input file is read, and the second rule +in the `awk' program (the action with no pattern) prints each record. +Because each `print' statement adds a newline at the end of its output, +this `awk' program copies the input with each slash changed to a +newline. Here are the results of running the program on `BBS-list': + + $ awk 'BEGIN { RS = "/" } + > { print $0 }' BBS-list + -| aardvark 555-5553 1200 + -| 300 B + -| alpo-net 555-3412 2400 + -| 1200 + -| 300 A + -| barfly 555-7685 1200 + -| 300 A + -| bites 555-1675 2400 + -| 1200 + -| 300 A + -| camelot 555-0542 300 C + -| core 555-2912 1200 + -| 300 C + -| fooey 555-1234 2400 + -| 1200 + -| 300 B + -| foot 555-6699 1200 + -| 300 B + -| macfoo 555-6480 1200 + -| 300 A + -| sdace 555-3430 2400 + -| 1200 + -| 300 A + -| sabafoo 555-2127 1200 + -| 300 C + -| + +Note that the entry for the `camelot' BBS is not split. In the +original data file (*note Sample Data Files::), the line looks like +this: + + camelot 555-0542 300 C + +It has one baud rate only, so there are no slashes in the record, +unlike the others which have two or more baud rates. In fact, this +record is treated as part of the record for the `core' BBS; the newline +separating them in the output is the original newline in the data file, +not the one added by `awk' when it printed the record! + + Another way to change the record separator is on the command line, +using the variable-assignment feature (*note Other Arguments::): + + awk '{ print $0 }' RS="/" BBS-list + +This sets `RS' to `/' before processing `BBS-list'. + + Using an unusual character such as `/' for the record separator +produces correct behavior in the vast majority of cases. However, the +following (extreme) pipeline prints a surprising `1': + + $ echo | awk 'BEGIN { RS = "a" } ; { print NF }' + -| 1 + + There is one field, consisting of a newline. The value of the +built-in variable `NF' is the number of fields in the current record. + + Reaching the end of an input file terminates the current input +record, even if the last character in the file is not the character in +`RS'. (d.c.) + + The empty string `""' (a string without any characters) has a +special meaning as the value of `RS'. It means that records are +separated by one or more blank lines and nothing else. *Note Multiple +Line::, for more details. + + If you change the value of `RS' in the middle of an `awk' run, the +new value is used to delimit subsequent records, but the record +currently being processed, as well as records already processed, are not +affected. + + After the end of the record has been determined, `gawk' sets the +variable `RT' to the text in the input that matched `RS'. When using +`gawk', the value of `RS' is not limited to a one-character string. It +can be any regular expression (*note Regexp::). In general, each record +ends at the next string that matches the regular expression; the next +record starts at the end of the matching string. This general rule is +actually at work in the usual case, where `RS' contains just a newline: +a record ends at the beginning of the next matching string (the next +newline in the input), and the following record starts just after the +end of this string (at the first character of the following line). The +newline, because it matches `RS', is not part of either record. + + When `RS' is a single character, `RT' contains the same single +character. However, when `RS' is a regular expression, `RT' contains +the actual input text that matched the regular expression. + + The following example illustrates both of these features. It sets +`RS' equal to a regular expression that matches either a newline or a +series of one or more uppercase letters with optional leading and/or +trailing whitespace: + + $ echo record 1 AAAA record 2 BBBB record 3 | + > gawk 'BEGIN { RS = "\n|( *[[:upper:]]+ *)" } + > { print "Record =", $0, "and RT =", RT }' + -| Record = record 1 and RT = AAAA + -| Record = record 2 and RT = BBBB + -| Record = record 3 and RT = + -| + +The final line of output has an extra blank line. This is because the +value of `RT' is a newline, and the `print' statement supplies its own +terminating newline. *Note Simple Sed::, for a more useful example of +`RS' as a regexp and `RT'. + + If you set `RS' to a regular expression that allows optional +trailing text, such as `RS = "abc(XYZ)?"' it is possible, due to +implementation constraints, that `gawk' may match the leading part of +the regular expression, but not the trailing part, particularly if the +input text that could match the trailing part is fairly long. `gawk' +attempts to avoid this problem, but currently, there's no guarantee +that this will never happen. + + NOTE: Remember that in `awk', the `^' and `$' anchor + metacharacters match the beginning and end of a _string_, and not + the beginning and end of a _line_. As a result, something like + `RS = "^[[:upper:]]"' can only match at the beginning of a file. + This is because `gawk' views the input file as one long string + that happens to contain newline characters in it. It is thus best + to avoid anchor characters in the value of `RS'. + + The use of `RS' as a regular expression and the `RT' variable are +`gawk' extensions; they are not available in compatibility mode (*note +Options::). In compatibility mode, only the first character of the +value of `RS' is used to determine the end of the record. + +Advanced Notes: `RS = "\0"' Is Not Portable +------------------------------------------- + +There are times when you might want to treat an entire data file as a +single record. The only way to make this happen is to give `RS' a +value that you know doesn't occur in the input file. This is hard to +do in a general way, such that a program always works for arbitrary +input files. + + You might think that for text files, the NUL character, which +consists of a character with all bits equal to zero, is a good value to +use for `RS' in this case: + + BEGIN { RS = "\0" } # whole file becomes one record? + + `gawk' in fact accepts this, and uses the NUL character for the +record separator. However, this usage is _not_ portable to other `awk' +implementations. + + All other `awk' implementations(1) store strings internally as +C-style strings. C strings use the NUL character as the string +terminator. In effect, this means that `RS = "\0"' is the same as `RS += ""'. (d.c.) + + The best way to treat a whole file as a single record is to simply +read the file in, one record at a time, concatenating each record onto +the end of the previous ones. + + ---------- Footnotes ---------- + + (1) At least that we know about. + + +File: gawk.info, Node: Fields, Next: Nonconstant Fields, Prev: Records, Up: Reading Files + +3.2 Examining Fields +==================== + +When `awk' reads an input record, the record is automatically "parsed" +or separated by the interpreter into chunks called "fields". By +default, fields are separated by "whitespace", like words in a line. +Whitespace in `awk' means any string of one or more spaces, tabs, or +newlines;(1) other characters, such as formfeed, vertical tab, etc. +that are considered whitespace by other languages, are _not_ considered +whitespace by `awk'. + + The purpose of fields is to make it more convenient for you to refer +to these pieces of the record. You don't have to use them--you can +operate on the whole record if you want--but fields are what make +simple `awk' programs so powerful. + + A dollar-sign (`$') is used to refer to a field in an `awk' program, +followed by the number of the field you want. Thus, `$1' refers to the +first field, `$2' to the second, and so on. (Unlike the Unix shells, +the field numbers are not limited to single digits. `$127' is the one +hundred twenty-seventh field in the record.) For example, suppose the +following is a line of input: + + This seems like a pretty nice example. + +Here the first field, or `$1', is `This', the second field, or `$2', is +`seems', and so on. Note that the last field, `$7', is `example.'. +Because there is no space between the `e' and the `.', the period is +considered part of the seventh field. + + `NF' is a built-in variable whose value is the number of fields in +the current record. `awk' automatically updates the value of `NF' each +time it reads a record. No matter how many fields there are, the last +field in a record can be represented by `$NF'. So, `$NF' is the same +as `$7', which is `example.'. If you try to reference a field beyond +the last one (such as `$8' when the record has only seven fields), you +get the empty string. (If used in a numeric operation, you get zero.) + + The use of `$0', which looks like a reference to the "zero-th" +field, is a special case: it represents the whole input record when you +are not interested in specific fields. Here are some more examples: + + $ awk '$1 ~ /foo/ { print $0 }' BBS-list + -| fooey 555-1234 2400/1200/300 B + -| foot 555-6699 1200/300 B + -| macfoo 555-6480 1200/300 A + -| sabafoo 555-2127 1200/300 C + +This example prints each record in the file `BBS-list' whose first +field contains the string `foo'. The operator `~' is called a +"matching operator" (*note Regexp Usage::); it tests whether a string +(here, the field `$1') matches a given regular expression. + + By contrast, the following example looks for `foo' in _the entire +record_ and prints the first field and the last field for each matching +input record: + + $ awk '/foo/ { print $1, $NF }' BBS-list + -| fooey B + -| foot B + -| macfoo A + -| sabafoo C + + ---------- Footnotes ---------- + + (1) In POSIX `awk', newlines are not considered whitespace for +separating fields. + + +File: gawk.info, Node: Nonconstant Fields, Next: Changing Fields, Prev: Fields, Up: Reading Files + +3.3 Nonconstant Field Numbers +============================= + +The number of a field does not need to be a constant. Any expression in +the `awk' language can be used after a `$' to refer to a field. The +value of the expression specifies the field number. If the value is a +string, rather than a number, it is converted to a number. Consider +this example: + + awk '{ print $NR }' + +Recall that `NR' is the number of records read so far: one in the first +record, two in the second, etc. So this example prints the first field +of the first record, the second field of the second record, and so on. +For the twentieth record, field number 20 is printed; most likely, the +record has fewer than 20 fields, so this prints a blank line. Here is +another example of using expressions as field numbers: + + awk '{ print $(2*2) }' BBS-list + + `awk' evaluates the expression `(2*2)' and uses its value as the +number of the field to print. The `*' sign represents multiplication, +so the expression `2*2' evaluates to four. The parentheses are used so +that the multiplication is done before the `$' operation; they are +necessary whenever there is a binary operator in the field-number +expression. This example, then, prints the hours of operation (the +fourth field) for every line of the file `BBS-list'. (All of the `awk' +operators are listed, in order of decreasing precedence, in *note +Precedence::.) + + If the field number you compute is zero, you get the entire record. +Thus, `$(2-2)' has the same value as `$0'. Negative field numbers are +not allowed; trying to reference one usually terminates the program. +(The POSIX standard does not define what happens when you reference a +negative field number. `gawk' notices this and terminates your +program. Other `awk' implementations may behave differently.) + + As mentioned in *note Fields::, `awk' stores the current record's +number of fields in the built-in variable `NF' (also *note Built-in +Variables::). The expression `$NF' is not a special feature--it is the +direct consequence of evaluating `NF' and using its value as a field +number. + + +File: gawk.info, Node: Changing Fields, Next: Field Separators, Prev: Nonconstant Fields, Up: Reading Files + +3.4 Changing the Contents of a Field +==================================== + +The contents of a field, as seen by `awk', can be changed within an +`awk' program; this changes what `awk' perceives as the current input +record. (The actual input is untouched; `awk' _never_ modifies the +input file.) Consider the following example and its output: + + $ awk '{ nboxes = $3 ; $3 = $3 - 10 + > print nboxes, $3 }' inventory-shipped + -| 25 15 + -| 32 22 + -| 24 14 + ... + +The program first saves the original value of field three in the +variable `nboxes'. The `-' sign represents subtraction, so this +program reassigns field three, `$3', as the original value of field +three minus ten: `$3 - 10'. (*Note Arithmetic Ops::.) Then it prints +the original and new values for field three. (Someone in the warehouse +made a consistent mistake while inventorying the red boxes.) + + For this to work, the text in field `$3' must make sense as a +number; the string of characters must be converted to a number for the +computer to do arithmetic on it. The number resulting from the +subtraction is converted back to a string of characters that then +becomes field three. *Note Conversion::. + + When the value of a field is changed (as perceived by `awk'), the +text of the input record is recalculated to contain the new field where +the old one was. In other words, `$0' changes to reflect the altered +field. Thus, this program prints a copy of the input file, with 10 +subtracted from the second field of each line: + + $ awk '{ $2 = $2 - 10; print $0 }' inventory-shipped + -| Jan 3 25 15 115 + -| Feb 5 32 24 226 + -| Mar 5 24 34 228 + ... + + It is also possible to also assign contents to fields that are out +of range. For example: + + $ awk '{ $6 = ($5 + $4 + $3 + $2) + > print $6 }' inventory-shipped + -| 168 + -| 297 + -| 301 + ... + +We've just created `$6', whose value is the sum of fields `$2', `$3', +`$4', and `$5'. The `+' sign represents addition. For the file +`inventory-shipped', `$6' represents the total number of parcels +shipped for a particular month. + + Creating a new field changes `awk''s internal copy of the current +input record, which is the value of `$0'. Thus, if you do `print $0' +after adding a field, the record printed includes the new field, with +the appropriate number of field separators between it and the previously +existing fields. + + This recomputation affects and is affected by `NF' (the number of +fields; *note Fields::). For example, the value of `NF' is set to the +number of the highest field you create. The exact format of `$0' is +also affected by a feature that has not been discussed yet: the "output +field separator", `OFS', used to separate the fields (*note Output +Separators::). + + Note, however, that merely _referencing_ an out-of-range field does +_not_ change the value of either `$0' or `NF'. Referencing an +out-of-range field only produces an empty string. For example: + + if ($(NF+1) != "") + print "can't happen" + else + print "everything is normal" + +should print `everything is normal', because `NF+1' is certain to be +out of range. (*Note If Statement::, for more information about +`awk''s `if-else' statements. *Note Typing and Comparison::, for more +information about the `!=' operator.) + + It is important to note that making an assignment to an existing +field changes the value of `$0' but does not change the value of `NF', +even when you assign the empty string to a field. For example: + + $ echo a b c d | awk '{ OFS = ":"; $2 = "" + > print $0; print NF }' + -| a::c:d + -| 4 + +The field is still there; it just has an empty value, denoted by the +two colons between `a' and `c'. This example shows what happens if you +create a new field: + + $ echo a b c d | awk '{ OFS = ":"; $2 = ""; $6 = "new" + > print $0; print NF }' + -| a::c:d::new + -| 6 + +The intervening field, `$5', is created with an empty value (indicated +by the second pair of adjacent colons), and `NF' is updated with the +value six. + + Decrementing `NF' throws away the values of the fields after the new +value of `NF' and recomputes `$0'. (d.c.) Here is an example: + + $ echo a b c d e f | awk '{ print "NF =", NF; + > NF = 3; print $0 }' + -| NF = 6 + -| a b c + + *Caution:* Some versions of `awk' don't rebuild `$0' when `NF' is +decremented. Caveat emptor. + + Finally, there are times when it is convenient to force `awk' to +rebuild the entire record, using the current value of the fields and +`OFS'. To do this, use the seemingly innocuous assignment: + + $1 = $1 # force record to be reconstituted + print $0 # or whatever else with $0 + +This forces `awk' rebuild the record. It does help to add a comment, +as we've shown here. + + There is a flip side to the relationship between `$0' and the +fields. Any assignment to `$0' causes the record to be reparsed into +fields using the _current_ value of `FS'. This also applies to any +built-in function that updates `$0', such as `sub' and `gsub' (*note +String Functions::). + + +File: gawk.info, Node: Field Separators, Next: Constant Size, Prev: Changing Fields, Up: Reading Files + +3.5 Specifying How Fields Are Separated +======================================= + +* Menu: + +* Regexp Field Splitting:: Using regexps as the field separator. +* Single Character Fields:: Making each character a separate field. +* Command Line Field Separator:: Setting `FS' from the command-line. +* Field Splitting Summary:: Some final points and a summary table. + + The "field separator", which is either a single character or a +regular expression, controls the way `awk' splits an input record into +fields. `awk' scans the input record for character sequences that +match the separator; the fields themselves are the text between the +matches. + + In the examples that follow, we use the bullet symbol (*) to +represent spaces in the output. If the field separator is `oo', then +the following line: + + moo goo gai pan + +is split into three fields: `m', `*g', and `*gai*pan'. Note the +leading spaces in the values of the second and third fields. + + The field separator is represented by the built-in variable `FS'. +Shell programmers take note: `awk' does _not_ use the name `IFS' that +is used by the POSIX-compliant shells (such as the Unix Bourne shell, +`sh', or `bash'). + + The value of `FS' can be changed in the `awk' program with the +assignment operator, `=' (*note Assignment Ops::). Often the right +time to do this is at the beginning of execution before any input has +been processed, so that the very first record is read with the proper +separator. To do this, use the special `BEGIN' pattern (*note +BEGIN/END::). For example, here we set the value of `FS' to the string +`","': + + awk 'BEGIN { FS = "," } ; { print $2 }' + +Given the input line: + + John Q. Smith, 29 Oak St., Walamazoo, MI 42139 + +this `awk' program extracts and prints the string `*29*Oak*St.'. + + Sometimes the input data contains separator characters that don't +separate fields the way you thought they would. For instance, the +person's name in the example we just used might have a title or suffix +attached, such as: + + John Q. Smith, LXIX, 29 Oak St., Walamazoo, MI 42139 + +The same program would extract `*LXIX', instead of `*29*Oak*St.'. If +you were expecting the program to print the address, you would be +surprised. The moral is to choose your data layout and separator +characters carefully to prevent such problems. (If the data is not in +a form that is easy to process, perhaps you can massage it first with a +separate `awk' program.) + + Fields are normally separated by whitespace sequences (spaces, tabs, +and newlines), not by single spaces. Two spaces in a row do not +delimit an empty field. The default value of the field separator `FS' +is a string containing a single space, `" "'. If `awk' interpreted +this value in the usual way, each space character would separate +fields, so two spaces in a row would make an empty field between them. +The reason this does not happen is that a single space as the value of +`FS' is a special case--it is taken to specify the default manner of +delimiting fields. + + If `FS' is any other single character, such as `","', then each +occurrence of that character separates two fields. Two consecutive +occurrences delimit an empty field. If the character occurs at the +beginning or the end of the line, that too delimits an empty field. The +space character is the only single character that does not follow these +rules. + + +File: gawk.info, Node: Regexp Field Splitting, Next: Single Character Fields, Up: Field Separators + +3.5.1 Using Regular Expressions to Separate Fields +-------------------------------------------------- + +The previous node discussed the use of single characters or simple +strings as the value of `FS'. More generally, the value of `FS' may be +a string containing any regular expression. In this case, each match +in the record for the regular expression separates fields. For +example, the assignment: + + FS = ", \t" + +makes every area of an input line that consists of a comma followed by a +space and a TAB into a field separator. (`\t' is an "escape sequence" +that stands for a TAB; *note Escape Sequences::, for the complete list +of similar escape sequences.) + + For a less trivial example of a regular expression, try using single +spaces to separate fields the way single commas are used. `FS' can be +set to `"[ ]"' (left bracket, space, right bracket). This regular +expression matches a single space and nothing else (*note Regexp::). + + There is an important difference between the two cases of `FS = " "' +(a single space) and `FS = "[ \t\n]+"' (a regular expression matching +one or more spaces, tabs, or newlines). For both values of `FS', +fields are separated by "runs" (multiple adjacent occurrences) of +spaces, tabs, and/or newlines. However, when the value of `FS' is +`" "', `awk' first strips leading and trailing whitespace from the +record and then decides where the fields are. For example, the +following pipeline prints `b': + + $ echo ' a b c d ' | awk '{ print $2 }' + -| b + +However, this pipeline prints `a' (note the extra spaces around each +letter): + + $ echo ' a b c d ' | awk 'BEGIN { FS = "[ \t\n]+" } + > { print $2 }' + -| a + +In this case, the first field is "null" or empty. + + The stripping of leading and trailing whitespace also comes into +play whenever `$0' is recomputed. For instance, study this pipeline: + + $ echo ' a b c d' | awk '{ print; $2 = $2; print }' + -| a b c d + -| a b c d + +The first `print' statement prints the record as it was read, with +leading whitespace intact. The assignment to `$2' rebuilds `$0' by +concatenating `$1' through `$NF' together, separated by the value of +`OFS'. Because the leading whitespace was ignored when finding `$1', +it is not part of the new `$0'. Finally, the last `print' statement +prints the new `$0'. + + +File: gawk.info, Node: Single Character Fields, Next: Command Line Field Separator, Prev: Regexp Field Splitting, Up: Field Separators + +3.5.2 Making Each Character a Separate Field +-------------------------------------------- + +There are times when you may want to examine each character of a record +separately. This can be done in `gawk' by simply assigning the null +string (`""') to `FS'. In this case, each individual character in the +record becomes a separate field. For example: + + $ echo a b | gawk 'BEGIN { FS = "" } + > { + > for (i = 1; i <= NF; i = i + 1) + > print "Field", i, "is", $i + > }' + -| Field 1 is a + -| Field 2 is + -| Field 3 is b + + Traditionally, the behavior of `FS' equal to `""' was not defined. +In this case, most versions of Unix `awk' simply treat the entire record +as only having one field. (d.c.) In compatibility mode (*note +Options::), if `FS' is the null string, then `gawk' also behaves this +way. + + +File: gawk.info, Node: Command Line Field Separator, Next: Field Splitting Summary, Prev: Single Character Fields, Up: Field Separators + +3.5.3 Setting `FS' from the Command Line +---------------------------------------- + +`FS' can be set on the command line. Use the `-F' option to do so. +For example: + + awk -F, 'PROGRAM' INPUT-FILES + +sets `FS' to the `,' character. Notice that the option uses an +uppercase `F' instead of a lowercase `f'. The latter option (`-f') +specifies a file containing an `awk' program. Case is significant in +command-line options: the `-F' and `-f' options have nothing to do with +each other. You can use both options at the same time to set the `FS' +variable _and_ get an `awk' program from a file. + + The value used for the argument to `-F' is processed in exactly the +same way as assignments to the built-in variable `FS'. Any special +characters in the field separator must be escaped appropriately. For +example, to use a `\' as the field separator on the command line, you +would have to type: + + # same as FS = "\\" + awk -F\\\\ '...' files ... + +Because `\' is used for quoting in the shell, `awk' sees `-F\\'. Then +`awk' processes the `\\' for escape characters (*note Escape +Sequences::), finally yielding a single `\' to use for the field +separator. + + As a special case, in compatibility mode (*note Options::), if the +argument to `-F' is `t', then `FS' is set to the TAB character. If you +type `-F\t' at the shell, without any quotes, the `\' gets deleted, so +`awk' figures that you really want your fields to be separated with +tabs and not `t's. Use `-v FS="t"' or `-F"[t]"' on the command line if +you really do want to separate your fields with `t's. + + For example, let's use an `awk' program file called `baud.awk' that +contains the pattern `/300/' and the action `print $1': + + /300/ { print $1 } + + Let's also set `FS' to be the `-' character and run the program on +the file `BBS-list'. The following command prints a list of the names +of the bulletin boards that operate at 300 baud and the first three +digits of their phone numbers: + + $ awk -F- -f baud.awk BBS-list + -| aardvark 555 + -| alpo + -| barfly 555 + -| bites 555 + -| camelot 555 + -| core 555 + -| fooey 555 + -| foot 555 + -| macfoo 555 + -| sdace 555 + -| sabafoo 555 + +Note the second line of output. The second line in the original file +looked like this: + + alpo-net 555-3412 2400/1200/300 A + + The `-' as part of the system's name was used as the field +separator, instead of the `-' in the phone number that was originally +intended. This demonstrates why you have to be careful in choosing +your field and record separators. + + Perhaps the most common use of a single character as the field +separator occurs when processing the Unix system password file. On +many Unix systems, each user has a separate entry in the system password +file, one line per user. The information in these lines is separated +by colons. The first field is the user's login name and the second is +the user's (encrypted or shadow) password. A password file entry might +look like this: + + arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/bash + + The following program searches the system password file and prints +the entries for users who have no password: + + awk -F: '$2 == ""' /etc/passwd + + +File: gawk.info, Node: Field Splitting Summary, Prev: Command Line Field Separator, Up: Field Separators + +3.5.4 Field-Splitting Summary +----------------------------- + +It is important to remember that when you assign a string constant as +the value of `FS', it undergoes normal `awk' string processing. For +example, with Unix `awk' and `gawk', the assignment `FS = "\.."' +assigns the character string `".."' to `FS' (the backslash is +stripped). This creates a regexp meaning "fields are separated by +occurrences of any two characters." If instead you want fields to be +separated by a literal period followed by any single character, use `FS += "\\.."'. + + The following table summarizes how fields are split, based on the +value of `FS' (`==' means "is equal to"): + +`FS == " "' + Fields are separated by runs of whitespace. Leading and trailing + whitespace are ignored. This is the default. + +`FS == ANY OTHER SINGLE CHARACTER' + Fields are separated by each occurrence of the character. Multiple + successive occurrences delimit empty fields, as do leading and + trailing occurrences. The character can even be a regexp + metacharacter; it does not need to be escaped. + +`FS == REGEXP' + Fields are separated by occurrences of characters that match + REGEXP. Leading and trailing matches of REGEXP delimit empty + fields. + +`FS == ""' + Each individual character in the record becomes a separate field. + (This is a `gawk' extension; it is not specified by the POSIX + standard.) + +Advanced Notes: Changing `FS' Does Not Affect the Fields +-------------------------------------------------------- + +According to the POSIX standard, `awk' is supposed to behave as if each +record is split into fields at the time it is read. In particular, +this means that if you change the value of `FS' after a record is read, +the value of the fields (i.e., how they were split) should reflect the +old value of `FS', not the new one. + + However, many implementations of `awk' do not work this way. +Instead, they defer splitting the fields until a field is actually +referenced. The fields are split using the _current_ value of `FS'! +(d.c.) This behavior can be difficult to diagnose. The following +example illustrates the difference between the two methods. (The +`sed'(1) command prints just the first line of `/etc/passwd'.) + + sed 1q /etc/passwd | awk '{ FS = ":" ; print $1 }' + +which usually prints: + + root + +on an incorrect implementation of `awk', while `gawk' prints something +like: + + root:nSijPlPhZZwgE:0:0:Root:/: + +Advanced Notes: `FS' and `IGNORECASE' +------------------------------------- + +The `IGNORECASE' variable (*note User-modified::) affects field +splitting _only_ when the value of `FS' is a regexp. It has no effect +when `FS' is a single character, even if that character is a letter. +Thus, in the following code: + + FS = "c" + IGNORECASE = 1 + $0 = "aCa" + print $1 + +The output is `aCa'. If you really want to split fields on an +alphabetic character while ignoring case, use a regexp that will do it +for you. E.g., `FS = "[c]"'. In this case, `IGNORECASE' will take +effect. + + ---------- Footnotes ---------- + + (1) The `sed' utility is a "stream editor." Its behavior is also +defined by the POSIX standard. + + +File: gawk.info, Node: Constant Size, Next: Multiple Line, Prev: Field Separators, Up: Reading Files + +3.6 Reading Fixed-Width Data +============================ + +(This minor node discusses an advanced feature of `awk'. If you are a +novice `awk' user, you might want to skip it on the first reading.) + +`gawk' version 2.13 introduced a facility for dealing with fixed-width +fields with no distinctive field separator. For example, data of this +nature arises in the input for old Fortran programs where numbers are +run together, or in the output of programs that did not anticipate the +use of their output as input for other programs. + + An example of the latter is a table where all the columns are lined +up by the use of a variable number of spaces and _empty fields are just +spaces_. Clearly, `awk''s normal field splitting based on `FS' does +not work well in this case. Although a portable `awk' program can use +a series of `substr' calls on `$0' (*note String Functions::), this is +awkward and inefficient for a large number of fields. + + The splitting of an input record into fixed-width fields is +specified by assigning a string containing space-separated numbers to +the built-in variable `FIELDWIDTHS'. Each number specifies the width +of the field, _including_ columns between fields. If you want to +ignore the columns between fields, you can specify the width as a +separate field that is subsequently ignored. It is a fatal error to +supply a field width that is not a positive number. The following data +is the output of the Unix `w' utility. It is useful to illustrate the +use of `FIELDWIDTHS': + + 10:06pm up 21 days, 14:04, 23 users + User tty login idle JCPU PCPU what + hzuo ttyV0 8:58pm 9 5 vi p24.tex + hzang ttyV3 6:37pm 50 -csh + eklye ttyV5 9:53pm 7 1 em thes.tex + dportein ttyV6 8:17pm 1:47 -csh + gierd ttyD3 10:00pm 1 elm + dave ttyD4 9:47pm 4 4 w + brent ttyp0 26Jun91 4:46 26:46 4:41 bash + dave ttyq4 26Jun9115days 46 46 wnewmail + + The following program takes the above input, converts the idle time +to number of seconds, and prints out the first two fields and the +calculated idle time: + + NOTE: This program uses a number of `awk' features that haven't + been introduced yet. + + BEGIN { FIELDWIDTHS = "9 6 10 6 7 7 35" } + NR > 2 { + idle = $4 + sub(/^ */, "", idle) # strip leading spaces + if (idle == "") + idle = 0 + if (idle ~ /:/) { + split(idle, t, ":") + idle = t[1] * 60 + t[2] + } + if (idle ~ /days/) + idle *= 24 * 60 * 60 + + print $1, $2, idle + } + + Running the program on the data produces the following results: + + hzuo ttyV0 0 + hzang ttyV3 50 + eklye ttyV5 0 + dportein ttyV6 107 + gierd ttyD3 1 + dave ttyD4 0 + brent ttyp0 286 + dave ttyq4 1296000 + + Another (possibly more practical) example of fixed-width input data +is the input from a deck of balloting cards. In some parts of the +United States, voters mark their choices by punching holes in computer +cards. These cards are then processed to count the votes for any +particular candidate or on any particular issue. Because a voter may +choose not to vote on some issue, any column on the card may be empty. +An `awk' program for processing such data could use the `FIELDWIDTHS' +feature to simplify reading the data. (Of course, getting `gawk' to +run on a system with card readers is another story!) + + Assigning a value to `FS' causes `gawk' to use `FS' for field +splitting again. Use `FS = FS' to make this happen, without having to +know the current value of `FS'. In order to tell which kind of field +splitting is in effect, use `PROCINFO["FS"]' (*note Auto-set::). The +value is `"FS"' if regular field splitting is being used, or it is +`"FIELDWIDTHS"' if fixed-width field splitting is being used: + + if (PROCINFO["FS"] == "FS") + REGULAR FIELD SPLITTING ... + else + FIXED-WIDTH FIELD SPLITTING ... + + This information is useful when writing a function that needs to +temporarily change `FS' or `FIELDWIDTHS', read some records, and then +restore the original settings (*note Passwd Functions::, for an example +of such a function). + + +File: gawk.info, Node: Multiple Line, Next: Getline, Prev: Constant Size, Up: Reading Files + +3.7 Multiple-Line Records +========================= + +In some databases, a single line cannot conveniently hold all the +information in one entry. In such cases, you can use multiline +records. The first step in doing this is to choose your data format. + + One technique is to use an unusual character or string to separate +records. For example, you could use the formfeed character (written +`\f' in `awk', as in C) to separate them, making each record a page of +the file. To do this, just set the variable `RS' to `"\f"' (a string +containing the formfeed character). Any other character could equally +well be used, as long as it won't be part of the data in a record. + + Another technique is to have blank lines separate records. By a +special dispensation, an empty string as the value of `RS' indicates +that records are separated by one or more blank lines. When `RS' is set +to the empty string, each record always ends at the first blank line +encountered. The next record doesn't start until the first nonblank +line that follows. No matter how many blank lines appear in a row, they +all act as one record separator. (Blank lines must be completely +empty; lines that contain only whitespace do not count.) + + You can achieve the same effect as `RS = ""' by assigning the string +`"\n\n+"' to `RS'. This regexp matches the newline at the end of the +record and one or more blank lines after the record. In addition, a +regular expression always matches the longest possible sequence when +there is a choice (*note Leftmost Longest::). So the next record +doesn't start until the first nonblank line that follows--no matter how +many blank lines appear in a row, they are considered one record +separator. + + There is an important difference between `RS = ""' and `RS = +"\n\n+"'. In the first case, leading newlines in the input data file +are ignored, and if a file ends without extra blank lines after the +last record, the final newline is removed from the record. In the +second case, this special processing is not done. (d.c.) + + Now that the input is separated into records, the second step is to +separate the fields in the record. One way to do this is to divide each +of the lines into fields in the normal manner. This happens by default +as the result of a special feature. When `RS' is set to the empty +string, _and_ `FS' is set to a single character, the newline character +_always_ acts as a field separator. This is in addition to whatever +field separations result from `FS'.(1) + + The original motivation for this special exception was probably to +provide useful behavior in the default case (i.e., `FS' is equal to +`" "'). This feature can be a problem if you really don't want the +newline character to separate fields, because there is no way to +prevent it. However, you can work around this by using the `split' +function to break up the record manually (*note String Functions::). +If you have a single character field separator, you can work around the +special feature in a different way, by making `FS' into a regexp for +that single character. For example, if the field separator is a +percent character, instead of `FS = "%"', use `FS = "[%]"'. + + Another way to separate fields is to put each field on a separate +line: to do this, just set the variable `FS' to the string `"\n"'. +(This single character separator matches a single newline.) A +practical example of a data file organized this way might be a mailing +list, where each entry is separated by blank lines. Consider a mailing +list in a file named `addresses', which looks like this: + + Jane Doe + 123 Main Street + Anywhere, SE 12345-6789 + + John Smith + 456 Tree-lined Avenue + Smallville, MW 98765-4321 + ... + +A simple program to process this file is as follows: + + # addrs.awk --- simple mailing list program + + # Records are separated by blank lines. + # Each line is one field. + BEGIN { RS = "" ; FS = "\n" } + + { + print "Name is:", $1 + print "Address is:", $2 + print "City and State are:", $3 + print "" + } + + Running the program produces the following output: + + $ awk -f addrs.awk addresses + -| Name is: Jane Doe + -| Address is: 123 Main Street + -| City and State are: Anywhere, SE 12345-6789 + -| + -| Name is: John Smith + -| Address is: 456 Tree-lined Avenue + -| City and State are: Smallville, MW 98765-4321 + -| + ... + + *Note Labels Program::, for a more realistic program that deals with +address lists. The following table summarizes how records are split, +based on the value of `RS'. (`==' means "is equal to.") + +`RS == "\n"' + Records are separated by the newline character (`\n'). In effect, + every line in the data file is a separate record, including blank + lines. This is the default. + +`RS == ANY SINGLE CHARACTER' + Records are separated by each occurrence of the character. + Multiple successive occurrences delimit empty records. + +`RS == ""' + Records are separated by runs of blank lines. When `FS' is a + single character, then the newline character always serves as a + field separator, in addition to whatever value `FS' may have. + Leading and trailing newlines in a file are ignored. + +`RS == REGEXP' + Records are separated by occurrences of characters that match + REGEXP. Leading and trailing matches of REGEXP delimit empty + records. (This is a `gawk' extension; it is not specified by the + POSIX standard.) + + In all cases, `gawk' sets `RT' to the input text that matched the +value specified by `RS'. + + ---------- Footnotes ---------- + + (1) When `FS' is the null string (`""') or a regexp, this special +feature of `RS' does not apply. It does apply to the default field +separator of a single space: `FS = " "'. + + +File: gawk.info, Node: Getline, Prev: Multiple Line, Up: Reading Files + +3.8 Explicit Input with `getline' +================================= + +So far we have been getting our input data from `awk''s main input +stream--either the standard input (usually your terminal, sometimes the +output from another program) or from the files specified on the command +line. The `awk' language has a special built-in command called +`getline' that can be used to read input under your explicit control. + + The `getline' command is used in several different ways and should +_not_ be used by beginners. The examples that follow the explanation +of the `getline' command include material that has not been covered +yet. Therefore, come back and study the `getline' command _after_ you +have reviewed the rest of this Info file and have a good knowledge of +how `awk' works. + + The `getline' command returns one if it finds a record and zero if +it encounters the end of the file. If there is some error in getting a +record, such as a file that cannot be opened, then `getline' returns +-1. In this case, `gawk' sets the variable `ERRNO' to a string +describing the error that occurred. + + In the following examples, COMMAND stands for a string value that +represents a shell command. + +* Menu: + +* Plain Getline:: Using `getline' with no arguments. +* Getline/Variable:: Using `getline' into a variable. +* Getline/File:: Using `getline' from a file. +* Getline/Variable/File:: Using `getline' into a variable from a + file. +* Getline/Pipe:: Using `getline' from a pipe. +* Getline/Variable/Pipe:: Using `getline' into a variable from a + pipe. +* Getline/Coprocess:: Using `getline' from a coprocess. +* Getline/Variable/Coprocess:: Using `getline' into a variable from a + coprocess. +* Getline Notes:: Important things to know about `getline'. +* Getline Summary:: Summary of `getline' Variants. + + +File: gawk.info, Node: Plain Getline, Next: Getline/Variable, Up: Getline + +3.8.1 Using `getline' with No Arguments +--------------------------------------- + +The `getline' command can be used without arguments to read input from +the current input file. All it does in this case is read the next +input record and split it up into fields. This is useful if you've +finished processing the current record, but want to do some special +processing on the next record _right now_. For example: + + { + if ((t = index($0, "/*")) != 0) { + # value of `tmp' will be "" if t is 1 + tmp = substr($0, 1, t - 1) + u = index(substr($0, t + 2), "*/") + while (u == 0) { + if (getline <= 0) { + m = "unexpected EOF or error" + m = (m ": " ERRNO) + print m > "/dev/stderr" + exit + } + u = index($0, "*/") + } + # substr expression will be "" if */ + # occurred at end of line + $0 = tmp substr($0, u + 2) + } + print $0 + } + + This `awk' program deletes C-style comments (`/* ... */') from the +input. By replacing the `print $0' with other statements, you could +perform more complicated processing on the decommented input, such as +searching for matches of a regular expression. (This program has a +subtle problem--it does not work if one comment ends and another begins +on the same line.) + + This form of the `getline' command sets `NF', `NR', `FNR', and the +value of `$0'. + + NOTE: The new value of `$0' is used to test the patterns of any + subsequent rules. The original value of `$0' that triggered the + rule that executed `getline' is lost. By contrast, the `next' + statement reads a new record but immediately begins processing it + normally, starting with the first rule in the program. *Note Next + Statement::. + + +File: gawk.info, Node: Getline/Variable, Next: Getline/File, Prev: Plain Getline, Up: Getline + +3.8.2 Using `getline' into a Variable +------------------------------------- + +You can use `getline VAR' to read the next record from `awk''s input +into the variable VAR. No other processing is done. For example, +suppose the next line is a comment or a special string, and you want to +read it without triggering any rules. This form of `getline' allows +you to read that line and store it in a variable so that the main +read-a-line-and-check-each-rule loop of `awk' never sees it. The +following example swaps every two lines of input: + + { + if ((getline tmp) > 0) { + print tmp + print $0 + } else + print $0 + } + +It takes the following list: + + wan + tew + free + phore + +and produces these results: + + tew + wan + phore + free + + The `getline' command used in this way sets only the variables `NR' +and `FNR' (and of course, VAR). The record is not split into fields, +so the values of the fields (including `$0') and the value of `NF' do +not change. + + +File: gawk.info, Node: Getline/File, Next: Getline/Variable/File, Prev: Getline/Variable, Up: Getline + +3.8.3 Using `getline' from a File +--------------------------------- + +Use `getline < FILE' to read the next record from FILE. Here FILE is a +string-valued expression that specifies the file name. `< FILE' is +called a "redirection" because it directs input to come from a +different place. For example, the following program reads its input +record from the file `secondary.input' when it encounters a first field +with a value equal to 10 in the current input file: + + { + if ($1 == 10) { + getline < "secondary.input" + print + } else + print + } + + Because the main input stream is not used, the values of `NR' and +`FNR' are not changed. However, the record it reads is split into +fields in the normal manner, so the values of `$0' and the other fields +are changed, resulting in a new value of `NF'. + + According to POSIX, `getline < EXPRESSION' is ambiguous if +EXPRESSION contains unparenthesized operators other than `$'; for +example, `getline < dir "/" file' is ambiguous because the +concatenation operator is not parenthesized. You should write it as +`getline < (dir "/" file)' if you want your program to be portable to +other `awk' implementations. + + +File: gawk.info, Node: Getline/Variable/File, Next: Getline/Pipe, Prev: Getline/File, Up: Getline + +3.8.4 Using `getline' into a Variable from a File +------------------------------------------------- + +Use `getline VAR < FILE' to read input from the file FILE, and put it +in the variable VAR. As above, FILE is a string-valued expression that +specifies the file from which to read. + + In this version of `getline', none of the built-in variables are +changed and the record is not split into fields. The only variable +changed is VAR. For example, the following program copies all the +input files to the output, except for records that say +`@include FILENAME'. Such a record is replaced by the contents of the +file FILENAME: + + { + if (NF == 2 && $1 == "@include") { + while ((getline line < $2) > 0) + print line + close($2) + } else + print + } + + Note here how the name of the extra input file is not built into the +program; it is taken directly from the data, specifically from the +second field on the `@include' line. + + The `close' function is called to ensure that if two identical +`@include' lines appear in the input, the entire specified file is +included twice. *Note Close Files And Pipes::. + + One deficiency of this program is that it does not process nested +`@include' statements (i.e., `@include' statements in included files) +the way a true macro preprocessor would. *Note Igawk Program::, for a +program that does handle nested `@include' statements. + + +File: gawk.info, Node: Getline/Pipe, Next: Getline/Variable/Pipe, Prev: Getline/Variable/File, Up: Getline + +3.8.5 Using `getline' from a Pipe +--------------------------------- + +The output of a command can also be piped into `getline', using +`COMMAND | getline'. In this case, the string COMMAND is run as a +shell command and its output is piped into `awk' to be used as input. +This form of `getline' reads one record at a time from the pipe. For +example, the following program copies its input to its output, except +for lines that begin with `@execute', which are replaced by the output +produced by running the rest of the line as a shell command: + + { + if ($1 == "@execute") { + tmp = substr($0, 10) + while ((tmp | getline) > 0) + print + close(tmp) + } else + print + } + +The `close' function is called to ensure that if two identical +`@execute' lines appear in the input, the command is run for each one. +*Note Close Files And Pipes::. Given the input: + + foo + bar + baz + @execute who + bletch + +the program might produce: + + foo + bar + baz + arnold ttyv0 Jul 13 14:22 + miriam ttyp0 Jul 13 14:23 (murphy:0) + bill ttyp1 Jul 13 14:23 (murphy:0) + bletch + +Notice that this program ran the command `who' and printed the previous +result. (If you try this program yourself, you will of course get +different results, depending upon who is logged in on your system.) + + This variation of `getline' splits the record into fields, sets the +value of `NF', and recomputes the value of `$0'. The values of `NR' +and `FNR' are not changed. + + According to POSIX, `EXPRESSION | getline' is ambiguous if +EXPRESSION contains unparenthesized operators other than `$'--for +example, `"echo " "date" | getline' is ambiguous because the +concatenation operator is not parenthesized. You should write it as +`("echo " "date") | getline' if you want your program to be portable to +other `awk' implementations. + + NOTE: Unfortunately, `gawk' has not been consistent in its + treatment of a construct like `"echo " "date" | getline'. Up to + and including version 3.1.1 of `gawk', it was treated as `("echo " + "date") | getline'. (This how Unix `awk' behaves.) From 3.1.2 + through 3.1.5, it was treated as `"echo " ("date" | getline)'. + (This is how `mawk' behaves.) Starting with version 3.1.6, the + earlier behavior was reinstated. In short, _always_ use explicit + parentheses, and then you won't have to worry. + + +File: gawk.info, Node: Getline/Variable/Pipe, Next: Getline/Coprocess, Prev: Getline/Pipe, Up: Getline + +3.8.6 Using `getline' into a Variable from a Pipe +------------------------------------------------- + +When you use `COMMAND | getline VAR', the output of COMMAND is sent +through a pipe to `getline' and into the variable VAR. For example, the +following program reads the current date and time into the variable +`current_time', using the `date' utility, and then prints it: + + BEGIN { + "date" | getline current_time + close("date") + print "Report printed on " current_time + } + + In this version of `getline', none of the built-in variables are +changed and the record is not split into fields. + + According to POSIX, `EXPRESSION | getline VAR' is ambiguous if +EXPRESSION contains unparenthesized operators other than `$'; for +example, `"echo " "date" | getline VAR' is ambiguous because the +concatenation operator is not parenthesized. You should write it as +`("echo " "date") | getline VAR' if you want your program to be +portable to other `awk' implementations. + + +File: gawk.info, Node: Getline/Coprocess, Next: Getline/Variable/Coprocess, Prev: Getline/Variable/Pipe, Up: Getline + +3.8.7 Using `getline' from a Coprocess +-------------------------------------- + +Input into `getline' from a pipe is a one-way operation. The command +that is started with `COMMAND | getline' only sends data _to_ your +`awk' program. + + On occasion, you might want to send data to another program for +processing and then read the results back. `gawk' allows you to start +a "coprocess", with which two-way communications are possible. This is +done with the `|&' operator. Typically, you write data to the +coprocess first and then read results back, as shown in the following: + + print "SOME QUERY" |& "db_server" + "db_server" |& getline + +which sends a query to `db_server' and then reads the results. + + The values of `NR' and `FNR' are not changed, because the main input +stream is not used. However, the record is split into fields in the +normal manner, thus changing the values of `$0', of the other fields, +and of `NF'. + + Coprocesses are an advanced feature. They are discussed here only +because this is the minor node on `getline'. *Note Two-way I/O::, +where coprocesses are discussed in more detail. + + +File: gawk.info, Node: Getline/Variable/Coprocess, Next: Getline Notes, Prev: Getline/Coprocess, Up: Getline + +3.8.8 Using `getline' into a Variable from a Coprocess +------------------------------------------------------ + +When you use `COMMAND |& getline VAR', the output from the coprocess +COMMAND is sent through a two-way pipe to `getline' and into the +variable VAR. + + In this version of `getline', none of the built-in variables are +changed and the record is not split into fields. The only variable +changed is VAR. + + Coprocesses are an advanced feature. They are discussed here only +because this is the minor node on `getline'. *Note Two-way I/O::, +where coprocesses are discussed in more detail. + + +File: gawk.info, Node: Getline Notes, Next: Getline Summary, Prev: Getline/Variable/Coprocess, Up: Getline + +3.8.9 Points to Remember About `getline' +---------------------------------------- + +Here are some miscellaneous points about `getline' that you should bear +in mind: + + * When `getline' changes the value of `$0' and `NF', `awk' does + _not_ automatically jump to the start of the program and start + testing the new record against every pattern. However, the new + record is tested against any subsequent rules. + + * Many `awk' implementations limit the number of pipelines that an + `awk' program may have open to just one. In `gawk', there is no + such limit. You can open as many pipelines (and coprocesses) as + the underlying operating system permits. + + * An interesting side effect occurs if you use `getline' without a + redirection inside a `BEGIN' rule. Because an unredirected + `getline' reads from the command-line data files, the first + `getline' command causes `awk' to set the value of `FILENAME'. + Normally, `FILENAME' does not have a value inside `BEGIN' rules, + because you have not yet started to process the command-line data + files. (d.c.) (*Note BEGIN/END::, also *note Auto-set::.) + + * Using `FILENAME' with `getline' (`getline < FILENAME') is likely + to be a source for confusion. `awk' opens a separate input stream + from the current input file. However, by not using a variable, + `$0' and `NR' are still updated. If you're doing this, it's + probably by accident, and you should reconsider what it is you're + trying to accomplish. + + +File: gawk.info, Node: Getline Summary, Prev: Getline Notes, Up: Getline + +3.8.10 Summary of `getline' Variants +------------------------------------ + +*note table-getline-variants:: summarizes the eight variants of +`getline', listing which built-in variables are set by each one. + +Variant Effect +-------------------------------------------------------------------------- +`getline' Sets `$0', `NF', `FNR', and `NR' +`getline' VAR Sets VAR, `FNR', and `NR' +`getline <' FILE Sets `$0' and `NF' +`getline VAR < FILE' Sets VAR +COMMAND `| getline' Sets `$0' and `NF' +COMMAND `| getline' VAR Sets VAR +COMMAND `|& getline' Sets `$0' and `NF'. This is a `gawk' extension +COMMAND `|& getline' VAR Sets VAR. This is a `gawk' extension + +Table 3.1: getline Variants and What They Set + + +File: gawk.info, Node: Printing, Next: Expressions, Prev: Reading Files, Up: Top + +4 Printing Output +***************** + +One of the most common programming actions is to "print", or output, +some or all of the input. Use the `print' statement for simple output, +and the `printf' statement for fancier formatting. The `print' +statement is not limited when computing _which_ values to print. +However, with two exceptions, you cannot specify _how_ to print +them--how many columns, whether to use exponential notation or not, and +so on. (For the exceptions, *note Output Separators::, and *note +OFMT::.) For printing with specifications, you need the `printf' +statement (*note Printf::). + + Besides basic and formatted printing, this major node also covers +I/O redirections to files and pipes, introduces the special file names +that `gawk' processes internally, and discusses the `close' built-in +function. + +* Menu: + +* Print:: The `print' statement. +* Print Examples:: Simple examples of `print' statements. +* Output Separators:: The output separators and how to change them. +* OFMT:: Controlling Numeric Output With `print'. +* Printf:: The `printf' statement. +* Redirection:: How to redirect output to multiple files and + pipes. +* Special Files:: File name interpretation in `gawk'. + `gawk' allows access to inherited file + descriptors. +* Close Files And Pipes:: Closing Input and Output Files and Pipes. + + +File: gawk.info, Node: Print, Next: Print Examples, Up: Printing + +4.1 The `print' Statement +========================= + +The `print' statement is used to produce output with simple, +standardized formatting. Specify only the strings or numbers to print, +in a list separated by commas. They are output, separated by single +spaces, followed by a newline. The statement looks like this: + + print ITEM1, ITEM2, ... + +The entire list of items may be optionally enclosed in parentheses. The +parentheses are necessary if any of the item expressions uses the `>' +relational operator; otherwise it could be confused with a redirection +(*note Redirection::). + + The items to print can be constant strings or numbers, fields of the +current record (such as `$1'), variables, or any `awk' expression. +Numeric values are converted to strings and then printed. + + The simple statement `print' with no items is equivalent to `print +$0': it prints the entire current record. To print a blank line, use +`print ""', where `""' is the empty string. To print a fixed piece of +text, use a string constant, such as `"Don't Panic"', as one item. If +you forget to use the double-quote characters, your text is taken as an +`awk' expression, and you will probably get an error. Keep in mind +that a space is printed between any two items. + + +File: gawk.info, Node: Print Examples, Next: Output Separators, Prev: Print, Up: Printing + +4.2 Examples of `print' Statements +================================== + +Each `print' statement makes at least one line of output. However, it +isn't limited to only one line. If an item value is a string that +contains a newline, the newline is output along with the rest of the +string. A single `print' statement can make any number of lines this +way. + + The following is an example of printing a string that contains +embedded newlines (the `\n' is an escape sequence, used to represent +the newline character; *note Escape Sequences::): + + $ awk 'BEGIN { print "line one\nline two\nline three" }' + -| line one + -| line two + -| line three + + The next example, which is run on the `inventory-shipped' file, +prints the first two fields of each input record, with a space between +them: + + $ awk '{ print $1, $2 }' inventory-shipped + -| Jan 13 + -| Feb 15 + -| Mar 15 + ... + + A common mistake in using the `print' statement is to omit the comma +between two items. This often has the effect of making the items run +together in the output, with no space. The reason for this is that +juxtaposing two string expressions in `awk' means to concatenate them. +Here is the same program, without the comma: + + $ awk '{ print $1 $2 }' inventory-shipped + -| Jan13 + -| Feb15 + -| Mar15 + ... + + To someone unfamiliar with the `inventory-shipped' file, neither +example's output makes much sense. A heading line at the beginning +would make it clearer. Let's add some headings to our table of months +(`$1') and green crates shipped (`$2'). We do this using the `BEGIN' +pattern (*note BEGIN/END::) so that the headings are only printed once: + + awk 'BEGIN { print "Month Crates" + print "----- ------" } + { print $1, $2 }' inventory-shipped + +When run, the program prints the following: + + Month Crates + ----- ------ + Jan 13 + Feb 15 + Mar 15 + ... + +The only problem, however, is that the headings and the table data +don't line up! We can fix this by printing some spaces between the two +fields: + + awk 'BEGIN { print "Month Crates" + print "----- ------" } + { print $1, " ", $2 }' inventory-shipped + + Lining up columns this way can get pretty complicated when there are +many columns to fix. Counting spaces for two or three columns is +simple, but any more than this can take up a lot of time. This is why +the `printf' statement was created (*note Printf::); one of its +specialties is lining up columns of data. + + NOTE: You can continue either a `print' or `printf' statement + simply by putting a newline after any comma (*note + Statements/Lines::). + + +File: gawk.info, Node: Output Separators, Next: OFMT, Prev: Print Examples, Up: Printing + +4.3 Output Separators +===================== + +As mentioned previously, a `print' statement contains a list of items +separated by commas. In the output, the items are normally separated +by single spaces. However, this doesn't need to be the case; a single +space is only the default. Any string of characters may be used as the +"output field separator" by setting the built-in variable `OFS'. The +initial value of this variable is the string `" "'--that is, a single +space. + + The output from an entire `print' statement is called an "output +record". Each `print' statement outputs one output record, and then +outputs a string called the "output record separator" (or `ORS'). The +initial value of `ORS' is the string `"\n"'; i.e., a newline character. +Thus, each `print' statement normally makes a separate line. + + In order to change how output fields and records are separated, +assign new values to the variables `OFS' and `ORS'. The usual place to +do this is in the `BEGIN' rule (*note BEGIN/END::), so that it happens +before any input is processed. It can also be done with assignments on +the command line, before the names of the input files, or using the +`-v' command-line option (*note Options::). The following example +prints the first and second fields of each input record, separated by a +semicolon, with a blank line added after each newline: + + $ awk 'BEGIN { OFS = ";"; ORS = "\n\n" } + > { print $1, $2 }' BBS-list + -| aardvark;555-5553 + -| + -| alpo-net;555-3412 + -| + -| barfly;555-7685 + ... + + If the value of `ORS' does not contain a newline, the program's +output is run together on a single line. + + +File: gawk.info, Node: OFMT, Next: Printf, Prev: Output Separators, Up: Printing + +4.4 Controlling Numeric Output with `print' +=========================================== + +When the `print' statement is used to print numeric values, `awk' +internally converts the number to a string of characters and prints +that string. `awk' uses the `sprintf' function to do this conversion +(*note String Functions::). For now, it suffices to say that the +`sprintf' function accepts a "format specification" that tells it how +to format numbers (or strings), and that there are a number of +different ways in which numbers can be formatted. The different format +specifications are discussed more fully in *note Control Letters::. + + The built-in variable `OFMT' contains the default format +specification that `print' uses with `sprintf' when it wants to convert +a number to a string for printing. The default value of `OFMT' is +`"%.6g"'. The way `print' prints numbers can be changed by supplying +different format specifications as the value of `OFMT', as shown in the +following example: + + $ awk 'BEGIN { + > OFMT = "%.0f" # print numbers as integers (rounds) + > print 17.23, 17.54 }' + -| 17 18 + +According to the POSIX standard, `awk''s behavior is undefined if +`OFMT' contains anything but a floating-point conversion specification. +(d.c.) + + +File: gawk.info, Node: Printf, Next: Redirection, Prev: OFMT, Up: Printing + +4.5 Using `printf' Statements for Fancier Printing +================================================== + +For more precise control over the output format than what is normally +provided by `print', use `printf'. `printf' can be used to specify the +width to use for each item, as well as various formatting choices for +numbers (such as what output base to use, whether to print an exponent, +whether to print a sign, and how many digits to print after the decimal +point). This is done by supplying a string, called the "format +string", that controls how and where to print the other arguments. + +* Menu: + +* Basic Printf:: Syntax of the `printf' statement. +* Control Letters:: Format-control letters. +* Format Modifiers:: Format-specification modifiers. +* Printf Examples:: Several examples. + + +File: gawk.info, Node: Basic Printf, Next: Control Letters, Up: Printf + +4.5.1 Introduction to the `printf' Statement +-------------------------------------------- + +A simple `printf' statement looks like this: + + printf FORMAT, ITEM1, ITEM2, ... + +The entire list of arguments may optionally be enclosed in parentheses. +The parentheses are necessary if any of the item expressions use the `>' +relational operator; otherwise, it can be confused with a redirection +(*note Redirection::). + + The difference between `printf' and `print' is the FORMAT argument. +This is an expression whose value is taken as a string; it specifies +how to output each of the other arguments. It is called the "format +string". + + The format string is very similar to that in the ISO C library +function `printf'. Most of FORMAT is text to output verbatim. +Scattered among this text are "format specifiers"--one per item. Each +format specifier says to output the next item in the argument list at +that place in the format. + + The `printf' statement does not automatically append a newline to +its output. It outputs only what the format string specifies. So if a +newline is needed, you must include one in the format string. The +output separator variables `OFS' and `ORS' have no effect on `printf' +statements. For example: + + $ awk 'BEGIN { + > ORS = "\nOUCH!\n"; OFS = "+" + > msg = "Dont Panic!" + > printf "%s\n", msg + > }' + -| Dont Panic! + +Here, neither the `+' nor the `OUCH' appear when the message is printed. + + +File: gawk.info, Node: Control Letters, Next: Format Modifiers, Prev: Basic Printf, Up: Printf + +4.5.2 Format-Control Letters +---------------------------- + +A format specifier starts with the character `%' and ends with a +"format-control letter"--it tells the `printf' statement how to output +one item. The format-control letter specifies what _kind_ of value to +print. The rest of the format specifier is made up of optional +"modifiers" that control _how_ to print the value, such as the field +width. Here is a list of the format-control letters: + +`%c' + This prints a number as an ASCII character; thus, `printf "%c", + 65' outputs the letter `A'. (The output for a string value is the + first character of the string.) + +`%d, %i' + These are equivalent; they both print a decimal integer. (The + `%i' specification is for compatibility with ISO C.) + +`%e, %E' + These print a number in scientific (exponential) notation; for + example: + + printf "%4.3e\n", 1950 + + prints `1.950e+03', with a total of four significant figures, + three of which follow the decimal point. (The `4.3' represents + two modifiers, discussed in the next node.) `%E' uses `E' instead + of `e' in the output. + +`%f' + This prints a number in floating-point notation. For example: + + printf "%4.3f", 1950 + + prints `1950.000', with a total of four significant figures, three + of which follow the decimal point. (The `4.3' represents two + modifiers, discussed in the next node.) + + On systems supporting IEEE 754 floating point format, values + representing negative infinity are formatted as `-inf' or + `-infinity', and positive infinity as `inf' and `infinity'. The + special "not a number" value formats as `-nan' or `nan'. + +`%F' + Like `%f' but the infinity and "not a number" values are spelled + using uppercase letters. + + The `%F' format is a POSIX extension to ISO C; not all systems + support it. On those that don't, `gawk' uses `%f' instead. + +`%g, %G' + These print a number in either scientific notation or in + floating-point notation, whichever uses fewer characters; if the + result is printed in scientific notation, `%G' uses `E' instead of + `e'. + +`%o' + This prints an unsigned octal integer. + +`%s' + This prints a string. + +`%u' + This prints an unsigned decimal integer. (This format is of + marginal use, because all numbers in `awk' are floating-point; it + is provided primarily for compatibility with C.) + +`%x, %X' + These print an unsigned hexadecimal integer; `%X' uses the letters + `A' through `F' instead of `a' through `f'. + +`%%' + This isn't a format-control letter, but it does have meaning--the + sequence `%%' outputs one `%'; it does not consume an argument and + it ignores any modifiers. + + NOTE: When using the integer format-control letters for values + that are outside the range of the widest C integer type, `gawk' + switches to the `%g' format specifier. If `--lint' is provided on + the command line (*note Options::), `gawk' warns about this. + Other versions of `awk' may print invalid values or do something + else entirely. (d.c.) + + +File: gawk.info, Node: Format Modifiers, Next: Printf Examples, Prev: Control Letters, Up: Printf + +4.5.3 Modifiers for `printf' Formats +------------------------------------ + +A format specification can also include "modifiers" that can control +how much of the item's value is printed, as well as how much space it +gets. The modifiers come between the `%' and the format-control letter. +We will use the bullet symbol "*" in the following examples to represent +spaces in the output. Here are the possible modifiers, in the order in +which they may appear: + +`N$' + An integer constant followed by a `$' is a "positional specifier". + Normally, format specifications are applied to arguments in the + order given in the format string. With a positional specifier, + the format specification is applied to a specific argument, + instead of what would be the next argument in the list. + Positional specifiers begin counting with one. Thus: + + printf "%s %s\n", "don't", "panic" + printf "%2$s %1$s\n", "panic", "don't" + + prints the famous friendly message twice. + + At first glance, this feature doesn't seem to be of much use. It + is in fact a `gawk' extension, intended for use in translating + messages at runtime. *Note Printf Ordering::, which describes how + and why to use positional specifiers. For now, we will not use + them. + +`-' + The minus sign, used before the width modifier (see later on in + this table), says to left-justify the argument within its + specified width. Normally, the argument is printed + right-justified in the specified width. Thus: + + printf "%-4s", "foo" + + prints `foo*'. + +`SPACE' + For numeric conversions, prefix positive values with a space and + negative values with a minus sign. + +`+' + The plus sign, used before the width modifier (see later on in + this table), says to always supply a sign for numeric conversions, + even if the data to format is positive. The `+' overrides the + space modifier. + +`#' + Use an "alternate form" for certain control letters. For `%o', + supply a leading zero. For `%x' and `%X', supply a leading `0x' + or `0X' for a nonzero result. For `%e', `%E', and `%f', the + result always contains a decimal point. For `%g' and `%G', + trailing zeros are not removed from the result. + +`0' + A leading `0' (zero) acts as a flag that indicates that output + should be padded with zeros instead of spaces. This applies even + to non-numeric output formats. (d.c.) This flag only has an + effect when the field width is wider than the value to print. + +`'' + A single quote or apostrophe character is a POSIX extension to ISO + C. It indicates that the integer part of a floating point value, + or the entire part of an integer decimal value, should have a + thousands-separator character in it. This only works in locales + that support such characters. For example: + + $ cat thousands.awk Show source program + -| BEGIN { printf "%'d\n", 1234567 } + $ LC_ALL=C gawk -f thousands.awk + -| 1234567 Results in "C" locale + $ LC_ALL=en_US.UTF-8 gawk -f thousands.awk + -| 1,234,567 Results in US English UTF locale + + For more information about locales and internationalization issues, + see *note Locales::. + + NOTE: The `'' flag is a nice feature, but its use complicates + things: it becomes difficult to use it in command-line + programs. For information on appropriate quoting tricks, see + *note Quoting::. + +`WIDTH' + This is a number specifying the desired minimum width of a field. + Inserting any number between the `%' sign and the format-control + character forces the field to expand to this width. The default + way to do this is to pad with spaces on the left. For example: + + printf "%4s", "foo" + + prints `*foo'. + + The value of WIDTH is a minimum width, not a maximum. If the item + value requires more than WIDTH characters, it can be as wide as + necessary. Thus, the following: + + printf "%4s", "foobar" + + prints `foobar'. + + Preceding the WIDTH with a minus sign causes the output to be + padded with spaces on the right, instead of on the left. + +`.PREC' + A period followed by an integer constant specifies the precision + to use when printing. The meaning of the precision varies by + control letter: + + `%e', `%E', `%f' + Number of digits to the right of the decimal point. + + `%g', `%G' + Maximum number of significant digits. + + `%d', `%i', `%o', `%u', `%x', `%X' + Minimum number of digits to print. + + `%s' + Maximum number of characters from the string that should + print. + + Thus, the following: + + printf "%.4s", "foobar" + + prints `foob'. + + The C library `printf''s dynamic WIDTH and PREC capability (for +example, `"%*.*s"') is supported. Instead of supplying explicit WIDTH +and/or PREC values in the format string, they are passed in the +argument list. For example: + + w = 5 + p = 3 + s = "abcdefg" + printf "%*.*s\n", w, p, s + +is exactly equivalent to: + + s = "abcdefg" + printf "%5.3s\n", s + +Both programs output `**abc'. Earlier versions of `awk' did not +support this capability. If you must use such a version, you may +simulate this feature by using concatenation to build up the format +string, like so: + + w = 5 + p = 3 + s = "abcdefg" + printf "%" w "." p "s\n", s + +This is not particularly easy to read but it does work. + + C programmers may be used to supplying additional `l', `L', and `h' +modifiers in `printf' format strings. These are not valid in `awk'. +Most `awk' implementations silently ignore these modifiers. If +`--lint' is provided on the command line (*note Options::), `gawk' +warns about their use. If `--posix' is supplied, their use is a fatal +error. + + +File: gawk.info, Node: Printf Examples, Prev: Format Modifiers, Up: Printf + +4.5.4 Examples Using `printf' +----------------------------- + +The following is a simple example of how to use `printf' to make an +aligned table: + + awk '{ printf "%-10s %s\n", $1, $2 }' BBS-list + +This command prints the names of the bulletin boards (`$1') in the file +`BBS-list' as a string of 10 characters that are left-justified. It +also prints the phone numbers (`$2') next on the line. This produces +an aligned two-column table of names and phone numbers, as shown here: + + $ awk '{ printf "%-10s %s\n", $1, $2 }' BBS-list + -| aardvark 555-5553 + -| alpo-net 555-3412 + -| barfly 555-7685 + -| bites 555-1675 + -| camelot 555-0542 + -| core 555-2912 + -| fooey 555-1234 + -| foot 555-6699 + -| macfoo 555-6480 + -| sdace 555-3430 + -| sabafoo 555-2127 + + In this case, the phone numbers had to be printed as strings because +the numbers are separated by a dash. Printing the phone numbers as +numbers would have produced just the first three digits: `555'. This +would have been pretty confusing. + + It wasn't necessary to specify a width for the phone numbers because +they are last on their lines. They don't need to have spaces after +them. + + The table could be made to look even nicer by adding headings to the +tops of the columns. This is done using the `BEGIN' pattern (*note +BEGIN/END::) so that the headers are only printed once, at the +beginning of the `awk' program: + + awk 'BEGIN { print "Name Number" + print "---- ------" } + { printf "%-10s %s\n", $1, $2 }' BBS-list + + The above example mixed `print' and `printf' statements in the same +program. Using just `printf' statements can produce the same results: + + awk 'BEGIN { printf "%-10s %s\n", "Name", "Number" + printf "%-10s %s\n", "----", "------" } + { printf "%-10s %s\n", $1, $2 }' BBS-list + +Printing each column heading with the same format specification used +for the column elements ensures that the headings are aligned just like +the columns. + + The fact that the same format specification is used three times can +be emphasized by storing it in a variable, like this: + + awk 'BEGIN { format = "%-10s %s\n" + printf format, "Name", "Number" + printf format, "----", "------" } + { printf format, $1, $2 }' BBS-list + + At this point, it would be a worthwhile exercise to use the `printf' +statement to line up the headings and table data for the +`inventory-shipped' example that was covered earlier in the minor node +on the `print' statement (*note Print::). + + +File: gawk.info, Node: Redirection, Next: Special Files, Prev: Printf, Up: Printing + +4.6 Redirecting Output of `print' and `printf' +============================================== + +So far, the output from `print' and `printf' has gone to the standard +output, usually the terminal. Both `print' and `printf' can also send +their output to other places. This is called "redirection". + + A redirection appears after the `print' or `printf' statement. +Redirections in `awk' are written just like redirections in shell +commands, except that they are written inside the `awk' program. + + There are four forms of output redirection: output to a file, output +appended to a file, output through a pipe to another command, and output +to a coprocess. They are all shown for the `print' statement, but they +work identically for `printf': + +`print ITEMS > OUTPUT-FILE' + This type of redirection prints the items into the output file + named OUTPUT-FILE. The file name OUTPUT-FILE can be any + expression. Its value is changed to a string and then used as a + file name (*note Expressions::). + + When this type of redirection is used, the OUTPUT-FILE is erased + before the first output is written to it. Subsequent writes to + the same OUTPUT-FILE do not erase OUTPUT-FILE, but append to it. + (This is different from how you use redirections in shell scripts.) + If OUTPUT-FILE does not exist, it is created. For example, here + is how an `awk' program can write a list of BBS names to one file + named `name-list', and a list of phone numbers to another file + named `phone-list': + + $ awk '{ print $2 > "phone-list" + > print $1 > "name-list" }' BBS-list + $ cat phone-list + -| 555-5553 + -| 555-3412 + ... + $ cat name-list + -| aardvark + -| alpo-net + ... + + Each output file contains one name or number per line. + +`print ITEMS >> OUTPUT-FILE' + This type of redirection prints the items into the pre-existing + output file named OUTPUT-FILE. The difference between this and the + single-`>' redirection is that the old contents (if any) of + OUTPUT-FILE are not erased. Instead, the `awk' output is appended + to the file. If OUTPUT-FILE does not exist, then it is created. + +`print ITEMS | COMMAND' + It is also possible to send output to another program through a + pipe instead of into a file. This type of redirection opens a + pipe to COMMAND, and writes the values of ITEMS through this pipe + to another process created to execute COMMAND. + + The redirection argument COMMAND is actually an `awk' expression. + Its value is converted to a string whose contents give the shell + command to be run. For example, the following produces two files, + one unsorted list of BBS names, and one list sorted in reverse + alphabetical order: + + awk '{ print $1 > "names.unsorted" + command = "sort -r > names.sorted" + print $1 | command }' BBS-list + + The unsorted list is written with an ordinary redirection, while + the sorted list is written by piping through the `sort' utility. + + The next example uses redirection to mail a message to the mailing + list `bug-system'. This might be useful when trouble is + encountered in an `awk' script run periodically for system + maintenance: + + report = "mail bug-system" + print "Awk script failed:", $0 | report + m = ("at record number " FNR " of " FILENAME) + print m | report + close(report) + + The message is built using string concatenation and saved in the + variable `m'. It's then sent down the pipeline to the `mail' + program. (The parentheses group the items to concatenate--see + *note Concatenation::.) + + The `close' function is called here because it's a good idea to + close the pipe as soon as all the intended output has been sent to + it. *Note Close Files And Pipes::, for more information. + + This example also illustrates the use of a variable to represent a + FILE or COMMAND--it is not necessary to always use a string + constant. Using a variable is generally a good idea, because (if + you mean to refer to that same file or command) `awk' requires + that the string value be spelled identically every time. + +`print ITEMS |& COMMAND' + This type of redirection prints the items to the input of COMMAND. + The difference between this and the single-`|' redirection is that + the output from COMMAND can be read with `getline'. Thus COMMAND + is a "coprocess", which works together with, but subsidiary to, + the `awk' program. + + This feature is a `gawk' extension, and is not available in POSIX + `awk'. *Note Getline/Coprocess::, for a brief discussion. *Note + Two-way I/O::, for a more complete discussion. + + Redirecting output using `>', `>>', `|', or `|&' asks the system to +open a file, pipe, or coprocess only if the particular FILE or COMMAND +you specify has not already been written to by your program or if it +has been closed since it was last written to. + + It is a common error to use `>' redirection for the first `print' to +a file, and then to use `>>' for subsequent output: + + # clear the file + print "Don't panic" > "guide.txt" + ... + # append + print "Avoid improbability generators" >> "guide.txt" + +This is indeed how redirections must be used from the shell. But in +`awk', it isn't necessary. In this kind of case, a program should use +`>' for all the `print' statements, since the output file is only +opened once. (It happens that if you mix `>' and `>>' that output is +produced in the expected order. However, mixing the operators for the +same file is definitely poor style, and is confusing to readers of your +program.) + + Many `awk' implementations limit the number of pipelines that an +`awk' program may have open to just one! In `gawk', there is no such +limit. `gawk' allows a program to open as many pipelines as the +underlying operating system permits. + +Advanced Notes: Piping into `sh' +-------------------------------- + +A particularly powerful way to use redirection is to build command lines +and pipe them into the shell, `sh'. For example, suppose you have a +list of files brought over from a system where all the file names are +stored in uppercase, and you wish to rename them to have names in all +lowercase. The following program is both simple and efficient: + + { printf("mv %s %s\n", $0, tolower($0)) | "sh" } + + END { close("sh") } + + The `tolower' function returns its argument string with all +uppercase characters converted to lowercase (*note String Functions::). +The program builds up a list of command lines, using the `mv' utility +to rename the files. It then sends the list to the shell for execution. + + +File: gawk.info, Node: Special Files, Next: Close Files And Pipes, Prev: Redirection, Up: Printing + +4.7 Special File Names in `gawk' +================================ + +`gawk' provides a number of special file names that it interprets +internally. These file names provide access to standard file +descriptors, process-related information, and TCP/IP networking. + +* Menu: + +* Special FD:: Special files for I/O. +* Special Process:: Special files for process information. +* Special Network:: Special files for network communications. +* Special Caveats:: Things to watch out for. + + +File: gawk.info, Node: Special FD, Next: Special Process, Up: Special Files + +4.7.1 Special Files for Standard Descriptors +-------------------------------------------- + +Running programs conventionally have three input and output streams +already available to them for reading and writing. These are known as +the "standard input", "standard output", and "standard error output". +These streams are, by default, connected to your terminal, but they are +often redirected with the shell, via the `<', `<<', `>', `>>', `>&', +and `|' operators. Standard error is typically used for writing error +messages; the reason there are two separate streams, standard output +and standard error, is so that they can be redirected separately. + + In other implementations of `awk', the only way to write an error +message to standard error in an `awk' program is as follows: + + print "Serious error detected!" | "cat 1>&2" + +This works by opening a pipeline to a shell command that can access the +standard error stream that it inherits from the `awk' process. This is +far from elegant, and it is also inefficient, because it requires a +separate process. So people writing `awk' programs often don't do +this. Instead, they send the error messages to the terminal, like this: + + print "Serious error detected!" > "/dev/tty" + +This usually has the same effect but not always: although the standard +error stream is usually the terminal, it can be redirected; when that +happens, writing to the terminal is not correct. In fact, if `awk' is +run from a background job, it may not have a terminal at all. Then +opening `/dev/tty' fails. + + `gawk' provides special file names for accessing the three standard +streams, as well as any other inherited open files. If the file name +matches one of these special names when `gawk' redirects input or +output, then it directly uses the stream that the file name stands for. +These special file names work for all operating systems that `gawk' has +been ported to, not just those that are POSIX-compliant: + +`/dev/stdin' + The standard input (file descriptor 0). + +`/dev/stdout' + The standard output (file descriptor 1). + +`/dev/stderr' + The standard error output (file descriptor 2). + +`/dev/fd/N' + The file associated with file descriptor N. Such a file must be + opened by the program initiating the `awk' execution (typically + the shell). Unless special pains are taken in the shell from which + `gawk' is invoked, only descriptors 0, 1, and 2 are available. + + The file names `/dev/stdin', `/dev/stdout', and `/dev/stderr' are +aliases for `/dev/fd/0', `/dev/fd/1', and `/dev/fd/2', respectively. +However, they are more self-explanatory. The proper way to write an +error message in a `gawk' program is to use `/dev/stderr', like this: + + print "Serious error detected!" > "/dev/stderr" + + Note the use of quotes around the file name. Like any other +redirection, the value must be a string. It is a common error to omit +the quotes, which leads to confusing results. + + +File: gawk.info, Node: Special Process, Next: Special Network, Prev: Special FD, Up: Special Files + +4.7.2 Special Files for Process-Related Information +--------------------------------------------------- + +`gawk' also provides special file names that give access to information +about the running `gawk' process. Each of these "files" provides a +single record of information. To read them more than once, they must +first be closed with the `close' function (*note Close Files And +Pipes::). The file names are: + +`/dev/pid' + Reading this file returns the process ID of the current process, + in decimal form, terminated with a newline. + +`/dev/ppid' + Reading this file returns the parent process ID of the current + process, in decimal form, terminated with a newline. + +`/dev/pgrpid' + Reading this file returns the process group ID of the current + process, in decimal form, terminated with a newline. + +`/dev/user' + Reading this file returns a single record terminated with a + newline. The fields are separated with spaces. The fields + represent the following information: + + `$1' + The return value of the `getuid' system call (the real user + ID number). + + `$2' + The return value of the `geteuid' system call (the effective + user ID number). + + `$3' + The return value of the `getgid' system call (the real group + ID number). + + `$4' + The return value of the `getegid' system call (the effective + group ID number). + + If there are any additional fields, they are the group IDs + returned by the `getgroups' system call. (Multiple groups may not + be supported on all systems.) + + These special file names may be used on the command line as data +files, as well as for I/O redirections within an `awk' program. They +may not be used as source files with the `-f' option. + + NOTE: The special files that provide process-related information + are now considered obsolete and will disappear entirely in the + next release of `gawk'. `gawk' prints a warning message every + time you use one of these files. To obtain process-related + information, use the `PROCINFO' array. *Note Auto-set::. + + +File: gawk.info, Node: Special Network, Next: Special Caveats, Prev: Special Process, Up: Special Files + +4.7.3 Special Files for Network Communications +---------------------------------------------- + +Starting with version 3.1 of `gawk', `awk' programs can open a two-way +TCP/IP connection, acting as either a client or a server. This is done +using a special file name of the form: + + `/inet/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT' + + The PROTOCOL is one of `tcp', `udp', or `raw', and the other fields +represent the other essential pieces of information for making a +networking connection. These file names are used with the `|&' +operator for communicating with a coprocess (*note Two-way I/O::). +This is an advanced feature, mentioned here only for completeness. +Full discussion is delayed until *note TCP/IP Networking::. + + +File: gawk.info, Node: Special Caveats, Prev: Special Network, Up: Special Files + +4.7.4 Special File Name Caveats +------------------------------- + +Here is a list of things to bear in mind when using the special file +names that `gawk' provides: + + * Recognition of these special file names is disabled if `gawk' is in + compatibility mode (*note Options::). + + * The special files that provide process-related information are now + considered obsolete and will disappear entirely in the next + release of `gawk'. `gawk' prints a warning message every time you + use one of these files. To obtain process-related information, + use the `PROCINFO' array. *Note Built-in Variables::. + + * Starting with version 3.1, `gawk' _always_ interprets these + special file names.(1) For example, using `/dev/fd/4' for output + actually writes on file descriptor 4, and not on a new file + descriptor that is `dup''ed from file descriptor 4. Most of the + time this does not matter; however, it is important to _not_ close + any of the files related to file descriptors 0, 1, and 2. Doing + so results in unpredictable behavior. + + ---------- Footnotes ---------- + + (1) Older versions of `gawk' would interpret these names internally +only if the system did not actually have a `/dev/fd' directory or any +of the other special files listed earlier. Usually this didn't make a +difference, but sometimes it did; thus, it was decided to make `gawk''s +behavior consistent on all systems and to have it always interpret the +special file names itself. + + +File: gawk.info, Node: Close Files And Pipes, Prev: Special Files, Up: Printing + +4.8 Closing Input and Output Redirections +========================================= + +If the same file name or the same shell command is used with `getline' +more than once during the execution of an `awk' program (*note +Getline::), the file is opened (or the command is executed) the first +time only. At that time, the first record of input is read from that +file or command. The next time the same file or command is used with +`getline', another record is read from it, and so on. + + Similarly, when a file or pipe is opened for output, the file name or +command associated with it is remembered by `awk', and subsequent +writes to the same file or command are appended to the previous writes. +The file or pipe stays open until `awk' exits. + + This implies that special steps are necessary in order to read the +same file again from the beginning, or to rerun a shell command (rather +than reading more output from the same command). The `close' function +makes these things possible: + + close(FILENAME) + +or: + + close(COMMAND) + + The argument FILENAME or COMMAND can be any expression. Its value +must _exactly_ match the string that was used to open the file or start +the command (spaces and other "irrelevant" characters included). For +example, if you open a pipe with this: + + "sort -r names" | getline foo + +then you must close it with this: + + close("sort -r names") + + Once this function call is executed, the next `getline' from that +file or command, or the next `print' or `printf' to that file or +command, reopens the file or reruns the command. Because the +expression that you use to close a file or pipeline must exactly match +the expression used to open the file or run the command, it is good +practice to use a variable to store the file name or command. The +previous example becomes the following: + + sortcom = "sort -r names" + sortcom | getline foo + ... + close(sortcom) + +This helps avoid hard-to-find typographical errors in your `awk' +programs. Here are some of the reasons for closing an output file: + + * To write a file and read it back later on in the same `awk' + program. Close the file after writing it, then begin reading it + with `getline'. + + * To write numerous files, successively, in the same `awk' program. + If the files aren't closed, eventually `awk' may exceed a system + limit on the number of open files in one process. It is best to + close each one when the program has finished writing it. + + * To make a command finish. When output is redirected through a + pipe, the command reading the pipe normally continues to try to + read input as long as the pipe is open. Often this means the + command cannot really do its work until the pipe is closed. For + example, if output is redirected to the `mail' program, the + message is not actually sent until the pipe is closed. + + * To run the same program a second time, with the same arguments. + This is not the same thing as giving more input to the first run! + + For example, suppose a program pipes output to the `mail' program. + If it outputs several lines redirected to this pipe without closing + it, they make a single message of several lines. By contrast, if + the program closes the pipe after each line of output, then each + line makes a separate message. + + If you use more files than the system allows you to have open, +`gawk' attempts to multiplex the available open files among your data +files. `gawk''s ability to do this depends upon the facilities of your +operating system, so it may not always work. It is therefore both good +practice and good portability advice to always use `close' on your +files when you are done with them. In fact, if you are using a lot of +pipes, it is essential that you close commands when done. For example, +consider something like this: + + { + ... + command = ("grep " $1 " /some/file | my_prog -q " $3) + while ((command | getline) > 0) { + PROCESS OUTPUT OF command + } + # need close(command) here + } + + This example creates a new pipeline based on data in _each_ record. +Without the call to `close' indicated in the comment, `awk' creates +child processes to run the commands, until it eventually runs out of +file descriptors for more pipelines. + + Even though each command has finished (as indicated by the +end-of-file return status from `getline'), the child process is not +terminated;(1) more importantly, the file descriptor for the pipe is +not closed and released until `close' is called or `awk' exits. + + `close' will silently do nothing if given an argument that does not +represent a file, pipe or coprocess that was opened with a redirection. + + Note also that `close(FILENAME)' has no "magic" effects on the +implicit loop that reads through the files named on the command line. +It is, more likely, a close of a file that was never opened, so `awk' +silently does nothing. + + When using the `|&' operator to communicate with a coprocess, it is +occasionally useful to be able to close one end of the two-way pipe +without closing the other. This is done by supplying a second argument +to `close'. As in any other call to `close', the first argument is the +name of the command or special file used to start the coprocess. The +second argument should be a string, with either of the values `"to"' or +`"from"'. Case does not matter. As this is an advanced feature, a +more complete discussion is delayed until *note Two-way I/O::, which +discusses it in more detail and gives an example. + +Advanced Notes: Using `close''s Return Value +-------------------------------------------- + +In many versions of Unix `awk', the `close' function is actually a +statement. It is a syntax error to try and use the return value from +`close': (d.c.) + + command = "..." + command | getline info + retval = close(command) # syntax error in most Unix awks + + `gawk' treats `close' as a function. The return value is -1 if the +argument names something that was never opened with a redirection, or +if there is a system problem closing the file or process. In these +cases, `gawk' sets the built-in variable `ERRNO' to a string describing +the problem. + + In `gawk', when closing a pipe or coprocess (input or output), the +return value is the exit status of the command.(2) Otherwise, it is the +return value from the system's `close' or `fclose' C functions when +closing input or output files, respectively. This value is zero if the +close succeeds, or -1 if it fails. + + The POSIX standard is very vague; it says that `close' returns zero +on success and non-zero otherwise. In general, different +implementations vary in what they report when closing pipes; thus the +return value cannot be used portably. (d.c.) + + ---------- Footnotes ---------- + + (1) The technical terminology is rather morbid. The finished child +is called a "zombie," and cleaning up after it is referred to as +"reaping." + + (2) This is a full 16-bit value as returned by the `wait' system +call. See the system manual pages for information on how to decode this +value. + + +File: gawk.info, Node: Expressions, Next: Patterns and Actions, Prev: Printing, Up: Top + +5 Expressions +************* + +Expressions are the basic building blocks of `awk' patterns and +actions. An expression evaluates to a value that you can print, test, +or pass to a function. Additionally, an expression can assign a new +value to a variable or a field by using an assignment operator. + + An expression can serve as a pattern or action statement on its own. +Most other kinds of statements contain one or more expressions that +specify the data on which to operate. As in other languages, +expressions in `awk' include variables, array references, constants, +and function calls, as well as combinations of these with various +operators. + +* Menu: + +* Constants:: String, numeric and regexp constants. +* Using Constant Regexps:: When and how to use a regexp constant. +* Variables:: Variables give names to values for later use. +* Conversion:: The conversion of strings to numbers and vice + versa. +* Arithmetic Ops:: Arithmetic operations (`+', `-', + etc.) +* Concatenation:: Concatenating strings. +* Assignment Ops:: Changing the value of a variable or a field. +* Increment Ops:: Incrementing the numeric value of a variable. +* Truth Values:: What is ``true'' and what is ``false''. +* Typing and Comparison:: How variables acquire types and how this + affects comparison of numbers and strings with + `<', etc. +* Boolean Ops:: Combining comparison expressions using boolean + operators `||' (``or''), `&&' + (``and'') and `!' (``not''). +* Conditional Exp:: Conditional expressions select between two + subexpressions under control of a third + subexpression. +* Function Calls:: A function call is an expression. +* Precedence:: How various operators nest. + + +File: gawk.info, Node: Constants, Next: Using Constant Regexps, Up: Expressions + +5.1 Constant Expressions +======================== + +The simplest type of expression is the "constant", which always has the +same value. There are three types of constants: numeric, string, and +regular expression. + + Each is used in the appropriate context when you need a data value +that isn't going to change. Numeric constants can have different +forms, but are stored identically internally. + +* Menu: + +* Scalar Constants:: Numeric and string constants. +* Nondecimal-numbers:: What are octal and hex numbers. +* Regexp Constants:: Regular Expression constants. + + +File: gawk.info, Node: Scalar Constants, Next: Nondecimal-numbers, Up: Constants + +5.1.1 Numeric and String Constants +---------------------------------- + +A "numeric constant" stands for a number. This number can be an +integer, a decimal fraction, or a number in scientific (exponential) +notation.(1) Here are some examples of numeric constants that all have +the same value: + + 105 + 1.05e+2 + 1050e-1 + + A string constant consists of a sequence of characters enclosed in +double-quotation marks. For example: + + "parrot" + +represents the string whose contents are `parrot'. Strings in `gawk' +can be of any length, and they can contain any of the possible +eight-bit ASCII characters including ASCII NUL (character code zero). +Other `awk' implementations may have difficulty with some character +codes. + + ---------- Footnotes ---------- + + (1) The internal representation of all numbers, including integers, +uses double-precision floating-point numbers. On most modern systems, +these are in IEEE 754 standard format. + + +File: gawk.info, Node: Nondecimal-numbers, Next: Regexp Constants, Prev: Scalar Constants, Up: Constants + +5.1.2 Octal and Hexadecimal Numbers +----------------------------------- + +In `awk', all numbers are in decimal; i.e., base 10. Many other +programming languages allow you to specify numbers in other bases, often +octal (base 8) and hexadecimal (base 16). In octal, the numbers go 0, +1, 2, 3, 4, 5, 6, 7, 10, 11, 12, etc. Just as `11', in decimal, is 1 +times 10 plus 1, so `11', in octal, is 1 times 8, plus 1. This equals 9 +in decimal. In hexadecimal, there are 16 digits. Since the everyday +decimal number system only has ten digits (`0'-`9'), the letters `a' +through `f' are used to represent the rest. (Case in the letters is +usually irrelevant; hexadecimal `a' and `A' have the same value.) +Thus, `11', in hexadecimal, is 1 times 16 plus 1, which equals 17 in +decimal. + + Just by looking at plain `11', you can't tell what base it's in. +So, in C, C++, and other languages derived from C, there is a special +notation to help signify the base. Octal numbers start with a leading +`0', and hexadecimal numbers start with a leading `0x' or `0X': + +`11' + Decimal value 11. + +`011' + Octal 11, decimal value 9. + +`0x11' + Hexadecimal 11, decimal value 17. + + This example shows the difference: + + $ gawk 'BEGIN { printf "%d, %d, %d\n", 011, 11, 0x11 }' + -| 9, 11, 17 + + Being able to use octal and hexadecimal constants in your programs +is most useful when working with data that cannot be represented +conveniently as characters or as regular numbers, such as binary data +of various sorts. + + `gawk' allows the use of octal and hexadecimal constants in your +program text. However, such numbers in the input data are not treated +differently; doing so by default would break old programs. (If you +really need to do this, use the `--non-decimal-data' command-line +option; *note Nondecimal Data::.) If you have octal or hexadecimal +data, you can use the `strtonum' function (*note String Functions::) to +convert the data into a number. Most of the time, you will want to use +octal or hexadecimal constants when working with the built-in bit +manipulation functions; see *note Bitwise Functions::, for more +information. + + Unlike some early C implementations, `8' and `9' are not valid in +octal constants; e.g., `gawk' treats `018' as decimal 18: + + $ gawk 'BEGIN { print "021 is", 021 ; print 018 }' + -| 021 is 17 + -| 18 + + Octal and hexadecimal source code constants are a `gawk' extension. +If `gawk' is in compatibility mode (*note Options::), they are not +available. + +Advanced Notes: A Constant's Base Does Not Affect Its Value +----------------------------------------------------------- + +Once a numeric constant has been converted internally into a number, +`gawk' no longer remembers what the original form of the constant was; +the internal value is always used. This has particular consequences +for conversion of numbers to strings: + + $ gawk 'BEGIN { printf "0x11 is <%s>\n", 0x11 }' + -| 0x11 is <17> + + +File: gawk.info, Node: Regexp Constants, Prev: Nondecimal-numbers, Up: Constants + +5.1.3 Regular Expression Constants +---------------------------------- + +A regexp constant is a regular expression description enclosed in +slashes, such as `/^beginning and end$/'. Most regexps used in `awk' +programs are constant, but the `~' and `!~' matching operators can also +match computed or "dynamic" regexps (which are just ordinary strings or +variables that contain a regexp). + + +File: gawk.info, Node: Using Constant Regexps, Next: Variables, Prev: Constants, Up: Expressions + +5.2 Using Regular Expression Constants +====================================== + +When used on the righthand side of the `~' or `!~' operators, a regexp +constant merely stands for the regexp that is to be matched. However, +regexp constants (such as `/foo/') may be used like simple expressions. +When a regexp constant appears by itself, it has the same meaning as if +it appeared in a pattern, i.e., `($0 ~ /foo/)' (d.c.) *Note Expression +Patterns::. This means that the following two code segments: + + if ($0 ~ /barfly/ || $0 ~ /camelot/) + print "found" + +and: + + if (/barfly/ || /camelot/) + print "found" + +are exactly equivalent. One rather bizarre consequence of this rule is +that the following Boolean expression is valid, but does not do what +the user probably intended: + + # note that /foo/ is on the left of the ~ + if (/foo/ ~ $1) print "found foo" + +This code is "obviously" testing `$1' for a match against the regexp +`/foo/'. But in fact, the expression `/foo/ ~ $1' actually means `($0 +~ /foo/) ~ $1'. In other words, first match the input record against +the regexp `/foo/'. The result is either zero or one, depending upon +the success or failure of the match. That result is then matched +against the first field in the record. Because it is unlikely that you +would ever really want to make this kind of test, `gawk' issues a +warning when it sees this construct in a program. Another consequence +of this rule is that the assignment statement: + + matches = /foo/ + +assigns either zero or one to the variable `matches', depending upon +the contents of the current input record. This feature of the language +has never been well documented until the POSIX specification. + + Constant regular expressions are also used as the first argument for +the `gensub', `sub', and `gsub' functions, and as the second argument +of the `match' function (*note String Functions::). Modern +implementations of `awk', including `gawk', allow the third argument of +`split' to be a regexp constant, but some older implementations do not. +(d.c.) This can lead to confusion when attempting to use regexp +constants as arguments to user-defined functions (*note User-defined::). +For example: + + function mysub(pat, repl, str, global) + { + if (global) + gsub(pat, repl, str) + else + sub(pat, repl, str) + return str + } + + { + ... + text = "hi! hi yourself!" + mysub(/hi/, "howdy", text, 1) + ... + } + + In this example, the programmer wants to pass a regexp constant to +the user-defined function `mysub', which in turn passes it on to either +`sub' or `gsub'. However, what really happens is that the `pat' +parameter is either one or zero, depending upon whether or not `$0' +matches `/hi/'. `gawk' issues a warning when it sees a regexp constant +used as a parameter to a user-defined function, since passing a truth +value in this way is probably not what was intended. + + +File: gawk.info, Node: Variables, Next: Conversion, Prev: Using Constant Regexps, Up: Expressions + +5.3 Variables +============= + +Variables are ways of storing values at one point in your program for +use later in another part of your program. They can be manipulated +entirely within the program text, and they can also be assigned values +on the `awk' command line. + +* Menu: + +* Using Variables:: Using variables in your programs. +* Assignment Options:: Setting variables on the command-line and a + summary of command-line syntax. This is an + advanced method of input. + + +File: gawk.info, Node: Using Variables, Next: Assignment Options, Up: Variables + +5.3.1 Using Variables in a Program +---------------------------------- + +Variables let you give names to values and refer to them later. +Variables have already been used in many of the examples. The name of +a variable must be a sequence of letters, digits, or underscores, and +it may not begin with a digit. Case is significant in variable names; +`a' and `A' are distinct variables. + + A variable name is a valid expression by itself; it represents the +variable's current value. Variables are given new values with +"assignment operators", "increment operators", and "decrement +operators". *Note Assignment Ops::. + + A few variables have special built-in meanings, such as `FS' (the +field separator), and `NF' (the number of fields in the current input +record). *Note Built-in Variables::, for a list of the built-in +variables. These built-in variables can be used and assigned just like +all other variables, but their values are also used or changed +automatically by `awk'. All built-in variables' names are entirely +uppercase. + + Variables in `awk' can be assigned either numeric or string values. +The kind of value a variable holds can change over the life of a +program. By default, variables are initialized to the empty string, +which is zero if converted to a number. There is no need to +"initialize" each variable explicitly in `awk', which is what you would +do in C and in most other traditional languages. + + +File: gawk.info, Node: Assignment Options, Prev: Using Variables, Up: Variables + +5.3.2 Assigning Variables on the Command Line +--------------------------------------------- + +Any `awk' variable can be set by including a "variable assignment" +among the arguments on the command line when `awk' is invoked (*note +Other Arguments::). Such an assignment has the following form: + + VARIABLE=TEXT + +With it, a variable is set either at the beginning of the `awk' run or +in between input files. When the assignment is preceded with the `-v' +option, as in the following: + + -v VARIABLE=TEXT + +the variable is set at the very beginning, even before the `BEGIN' +rules are run. The `-v' option and its assignment must precede all the +file name arguments, as well as the program text. (*Note Options::, +for more information about the `-v' option.) Otherwise, the variable +assignment is performed at a time determined by its position among the +input file arguments--after the processing of the preceding input file +argument. For example: + + awk '{ print $n }' n=4 inventory-shipped n=2 BBS-list + +prints the value of field number `n' for all input records. Before the +first file is read, the command line sets the variable `n' equal to +four. This causes the fourth field to be printed in lines from the +file `inventory-shipped'. After the first file has finished, but +before the second file is started, `n' is set to two, so that the +second field is printed in lines from `BBS-list': + + $ awk '{ print $n }' n=4 inventory-shipped n=2 BBS-list + -| 15 + -| 24 + ... + -| 555-5553 + -| 555-3412 + ... + + Command-line arguments are made available for explicit examination by +the `awk' program in the `ARGV' array (*note ARGC and ARGV::). `awk' +processes the values of command-line assignments for escape sequences +(*note Escape Sequences::). (d.c.) + + +File: gawk.info, Node: Conversion, Next: Arithmetic Ops, Prev: Variables, Up: Expressions + +5.4 Conversion of Strings and Numbers +===================================== + +Strings are converted to numbers and numbers are converted to strings, +if the context of the `awk' program demands it. For example, if the +value of either `foo' or `bar' in the expression `foo + bar' happens to +be a string, it is converted to a number before the addition is +performed. If numeric values appear in string concatenation, they are +converted to strings. Consider the following: + + two = 2; three = 3 + print (two three) + 4 + +This prints the (numeric) value 27. The numeric values of the +variables `two' and `three' are converted to strings and concatenated +together. The resulting string is converted back to the number 23, to +which 4 is then added. + + If, for some reason, you need to force a number to be converted to a +string, concatenate the empty string, `""', with that number. To force +a string to be converted to a number, add zero to that string. A +string is converted to a number by interpreting any numeric prefix of +the string as numerals: `"2.5"' converts to 2.5, `"1e3"' converts to +1000, and `"25fix"' has a numeric value of 25. Strings that can't be +interpreted as valid numbers convert to zero. + + The exact manner in which numbers are converted into strings is +controlled by the `awk' built-in variable `CONVFMT' (*note Built-in +Variables::). Numbers are converted using the `sprintf' function with +`CONVFMT' as the format specifier (*note String Functions::). + + `CONVFMT''s default value is `"%.6g"', which prints a value with at +least six significant digits. For some applications, you might want to +change it to specify more precision. On most modern machines, 17 +digits is enough to capture a floating-point number's value exactly, +most of the time.(1) + + Strange results can occur if you set `CONVFMT' to a string that +doesn't tell `sprintf' how to format floating-point numbers in a useful +way. For example, if you forget the `%' in the format, `awk' converts +all numbers to the same constant string. As a special case, if a +number is an integer, then the result of converting it to a string is +_always_ an integer, no matter what the value of `CONVFMT' may be. +Given the following code fragment: + + CONVFMT = "%2.2f" + a = 12 + b = a "" + +`b' has the value `"12"', not `"12.00"'. (d.c.) + + Prior to the POSIX standard, `awk' used the value of `OFMT' for +converting numbers to strings. `OFMT' specifies the output format to +use when printing numbers with `print'. `CONVFMT' was introduced in +order to separate the semantics of conversion from the semantics of +printing. Both `CONVFMT' and `OFMT' have the same default value: +`"%.6g"'. In the vast majority of cases, old `awk' programs do not +change their behavior. However, these semantics for `OFMT' are +something to keep in mind if you must port your new style program to +older implementations of `awk'. We recommend that instead of changing +your programs, just port `gawk' itself. *Note Print::, for more +information on the `print' statement. + + And, once again, where you are can matter when it comes to converting +between numbers and strings. In *note Locales::, we mentioned that the +local character set and language (the locale) can affect how `gawk' +matches characters. The locale also affects numeric formats. In +particular, for `awk' programs, it affects the decimal point character. +The `"C"' locale, and most English-language locales, use the period +character (`.') as the decimal point. However, many (if not most) +European and non-English locales use the comma (`,') as the decimal +point character. + + The POSIX standard says that `awk' always uses the period as the +decimal point when reading the `awk' program source code, and for +command-line variable assignments (*note Other Arguments::). However, +when interpreting input data, for `print' and `printf' output, and for +number to string conversion, the local decimal point character is used. +Here are some examples indicating the difference in behavior, on a +GNU/Linux system: + + $ gawk 'BEGIN { printf "%g\n", 3.1415927 }' + -| 3.14159 + $ LC_ALL=en_DK gawk 'BEGIN { printf "%g\n", 3.1415927 }' + -| 3,14159 + $ echo 4,321 | gawk '{ print $1 + 1 }' + -| 5 + $ echo 4,321 | LC_ALL=en_DK gawk '{ print $1 + 1 }' + -| 5,321 + +The `en_DK' locale is for English in Denmark, where the comma acts as +the decimal point separator. In the normal `"C"' locale, `gawk' treats +`4,321' as `4', while in the Danish locale, it's treated as the full +number, `4.321'. + + For version 3.1.3 through 3.1.5, `gawk' fully complied with this +aspect of the standard. However, many users in non-English locales +complained about this behavior, since their data used a period as the +decimal point. Beginning in version 3.1.6, the default behavior was +restored to use a period as the decimal point character. You can use +the `--use-lc-numeric' option (*note Options::) to force `gawk' to use +the locale's decimal point character. (`gawk' also uses the locale's +decimal point character when in POSIX mode, either via `--posix', or +the `POSIXLY_CORRECT' environment variable.) + + The following table describes the cases in which the locale's decimal +point character is used and when a period is used. Some of these +features have not been described yet. + +Feature Default `--posix' or `--use-lc-numeric' +------------------------------------------------------------ +`%'g' Use locale Use locale +`%g' Use period Use locale +Input Use period Use locale +`strtonum' Use period Use locale + +Table 5.1: Locale Decimal Point versus A Period + + Finally, modern day formal standards and IEEE standard floating point +representation can have an unusual but important effect on the way +`gawk' converts some special string values to numbers. The details are +presented in *note POSIX Floating Point Problems::. + + ---------- Footnotes ---------- + + (1) Pathological cases can require up to 752 digits (!), but we +doubt that you need to worry about this. + + +File: gawk.info, Node: Arithmetic Ops, Next: Concatenation, Prev: Conversion, Up: Expressions + +5.5 Arithmetic Operators +======================== + +The `awk' language uses the common arithmetic operators when evaluating +expressions. All of these arithmetic operators follow normal +precedence rules and work as you would expect them to. + + The following example uses a file named `grades', which contains a +list of student names as well as three test scores per student (it's a +small class): + + Pat 100 97 58 + Sandy 84 72 93 + Chris 72 92 89 + +This programs takes the file `grades' and prints the average of the +scores: + + $ awk '{ sum = $2 + $3 + $4 ; avg = sum / 3 + > print $1, avg }' grades + -| Pat 85 + -| Sandy 83 + -| Chris 84.3333 + + The following list provides the arithmetic operators in `awk', in +order from the highest precedence to the lowest: + +`- X' + Negation. + +`+ X' + Unary plus; the expression is converted to a number. + +`X ^ Y' +`X ** Y' + Exponentiation; X raised to the Y power. `2 ^ 3' has the value + eight; the character sequence `**' is equivalent to `^'. + +`X * Y' + Multiplication. + +`X / Y' + Division; because all numbers in `awk' are floating-point + numbers, the result is _not_ rounded to an integer--`3 / 4' has + the value 0.75. (It is a common mistake, especially for C + programmers, to forget that _all_ numbers in `awk' are + floating-point, and that division of integer-looking constants + produces a real number, not an integer.) + +`X % Y' + Remainder; further discussion is provided in the text, just after + this list. + +`X + Y' + Addition. + +`X - Y' + Subtraction. + + Unary plus and minus have the same precedence, the multiplication +operators all have the same precedence, and addition and subtraction +have the same precedence. + + When computing the remainder of `X % Y', the quotient is rounded +toward zero to an integer and multiplied by Y. This result is +subtracted from X; this operation is sometimes known as "trunc-mod." +The following relation always holds: + + b * int(a / b) + (a % b) == a + + One possibly undesirable effect of this definition of remainder is +that `X % Y' is negative if X is negative. Thus: + + -17 % 8 = -1 + + In other `awk' implementations, the signedness of the remainder may +be machine-dependent. + + NOTE: The POSIX standard only specifies the use of `^' for + exponentiation. For maximum portability, do not use the `**' + operator. + + +File: gawk.info, Node: Concatenation, Next: Assignment Ops, Prev: Arithmetic Ops, Up: Expressions + +5.6 String Concatenation +======================== + + It seemed like a good idea at the time. + Brian Kernighan + + There is only one string operation: concatenation. It does not have +a specific operator to represent it. Instead, concatenation is +performed by writing expressions next to one another, with no operator. +For example: + + $ awk '{ print "Field number one: " $1 }' BBS-list + -| Field number one: aardvark + -| Field number one: alpo-net + ... + + Without the space in the string constant after the `:', the line +runs together. For example: + + $ awk '{ print "Field number one:" $1 }' BBS-list + -| Field number one:aardvark + -| Field number one:alpo-net + ... + + Because string concatenation does not have an explicit operator, it +is often necessary to insure that it happens at the right time by using +parentheses to enclose the items to concatenate. For example, you +might expect that the following code fragment concatenates `file' and +`name': + + file = "file" + name = "name" + print "something meaningful" > file name + +This produces a syntax error with Unix `awk'.(1) It is necessary to use +the following: + + print "something meaningful" > (file name) + + Parentheses should be used around concatenation in all but the most +common contexts, such as on the righthand side of `='. Be careful +about the kinds of expressions used in string concatenation. In +particular, the order of evaluation of expressions used for +concatenation is undefined in the `awk' language. Consider this +example: + + BEGIN { + a = "don't" + print (a " " (a = "panic")) + } + +It is not defined whether the assignment to `a' happens before or after +the value of `a' is retrieved for producing the concatenated value. +The result could be either `don't panic', or `panic panic'. The +precedence of concatenation, when mixed with other operators, is often +counter-intuitive. Consider this example: + + $ awk 'BEGIN { print -12 " " -24 }' + -| -12-24 + + This "obviously" is concatenating -12, a space, and -24. But where +did the space disappear to? The answer lies in the combination of +operator precedences and `awk''s automatic conversion rules. To get +the desired result, write the program in the following manner: + + $ awk 'BEGIN { print -12 " " (-24) }' + -| -12 -24 + + This forces `awk' to treat the `-' on the `-24' as unary. +Otherwise, it's parsed as follows: + + -12 (`" "' - 24) + => -12 (0 - 24) + => -12 (-24) + => -12-24 + + As mentioned earlier, when doing concatenation, _parenthesize_. +Otherwise, you're never quite sure what you'll get. + + ---------- Footnotes ---------- + + (1) It happens that `gawk' and `mawk' "get it right," but you should +not rely on this. + + +File: gawk.info, Node: Assignment Ops, Next: Increment Ops, Prev: Concatenation, Up: Expressions + +5.7 Assignment Expressions +========================== + +An "assignment" is an expression that stores a (usually different) +value into a variable. For example, let's assign the value one to the +variable `z': + + z = 1 + + After this expression is executed, the variable `z' has the value +one. Whatever old value `z' had before the assignment is forgotten. + + Assignments can also store string values. For example, the +following stores the value `"this food is good"' in the variable +`message': + + thing = "food" + predicate = "good" + message = "this " thing " is " predicate + +This also illustrates string concatenation. The `=' sign is called an +"assignment operator". It is the simplest assignment operator because +the value of the righthand operand is stored unchanged. Most operators +(addition, concatenation, and so on) have no effect except to compute a +value. If the value isn't used, there's no reason to use the operator. +An assignment operator is different; it does produce a value, but even +if you ignore it, the assignment still makes itself felt through the +alteration of the variable. We call this a "side effect". + + The lefthand operand of an assignment need not be a variable (*note +Variables::); it can also be a field (*note Changing Fields::) or an +array element (*note Arrays::). These are all called "lvalues", which +means they can appear on the lefthand side of an assignment operator. +The righthand operand may be any expression; it produces the new value +that the assignment stores in the specified variable, field, or array +element. (Such values are called "rvalues".) + + It is important to note that variables do _not_ have permanent types. +A variable's type is simply the type of whatever value it happens to +hold at the moment. In the following program fragment, the variable +`foo' has a numeric value at first, and a string value later on: + + foo = 1 + print foo + foo = "bar" + print foo + +When the second assignment gives `foo' a string value, the fact that it +previously had a numeric value is forgotten. + + String values that do not begin with a digit have a numeric value of +zero. After executing the following code, the value of `foo' is five: + + foo = "a string" + foo = foo + 5 + + NOTE: Using a variable as a number and then later as a string can + be confusing and is poor programming style. The previous two + examples illustrate how `awk' works, _not_ how you should write + your programs! + + An assignment is an expression, so it has a value--the same value +that is assigned. Thus, `z = 1' is an expression with the value one. +One consequence of this is that you can write multiple assignments +together, such as: + + x = y = z = 5 + +This example stores the value five in all three variables (`x', `y', +and `z'). It does so because the value of `z = 5', which is five, is +stored into `y' and then the value of `y = z = 5', which is five, is +stored into `x'. + + Assignments may be used anywhere an expression is called for. For +example, it is valid to write `x != (y = 1)' to set `y' to one, and +then test whether `x' equals one. But this style tends to make +programs hard to read; such nesting of assignments should be avoided, +except perhaps in a one-shot program. + + Aside from `=', there are several other assignment operators that do +arithmetic with the old value of the variable. For example, the +operator `+=' computes a new value by adding the righthand value to the +old value of the variable. Thus, the following assignment adds five to +the value of `foo': + + foo += 5 + +This is equivalent to the following: + + foo = foo + 5 + +Use whichever makes the meaning of your program clearer. + + There are situations where using `+=' (or any assignment operator) +is _not_ the same as simply repeating the lefthand operand in the +righthand expression. For example: + + # Thanks to Pat Rankin for this example + BEGIN { + foo[rand()] += 5 + for (x in foo) + print x, foo[x] + + bar[rand()] = bar[rand()] + 5 + for (x in bar) + print x, bar[x] + } + +The indices of `bar' are practically guaranteed to be different, because +`rand' returns different values each time it is called. (Arrays and +the `rand' function haven't been covered yet. *Note Arrays::, and see +*note Numeric Functions::, for more information). This example +illustrates an important fact about assignment operators: the lefthand +expression is only evaluated _once_. It is up to the implementation as +to which expression is evaluated first, the lefthand or the righthand. +Consider this example: + + i = 1 + a[i += 2] = i + 1 + +The value of `a[3]' could be either two or four. + + *note table-assign-ops:: lists the arithmetic assignment operators. +In each case, the righthand operand is an expression whose value is +converted to a number. + +Operator Effect +-------------------------------------------------------------------------- +LVALUE `+=' INCREMENT Adds INCREMENT to the value of LVALUE. +LVALUE `-=' DECREMENT Subtracts DECREMENT from the value of LVALUE. +LVALUE `*=' Multiplies the value of LVALUE by COEFFICIENT. +COEFFICIENT +LVALUE `/=' DIVISOR Divides the value of LVALUE by DIVISOR. +LVALUE `%=' MODULUS Sets LVALUE to its remainder by MODULUS. +LVALUE `^=' POWER +LVALUE `**=' POWER Raises LVALUE to the power POWER. + +Table 5.2: Arithmetic Assignment Operators + + NOTE: Only the `^=' operator is specified by POSIX. For maximum + portability, do not use the `**=' operator. + +Advanced Notes: Syntactic Ambiguities Between `/=' and Regular Expressions +-------------------------------------------------------------------------- + +There is a syntactic ambiguity between the `/=' assignment operator and +regexp constants whose first character is an `='. (d.c.) This is most +notable in commercial `awk' versions. For example: + + $ awk /==/ /dev/null + error--> awk: syntax error at source line 1 + error--> context is + error--> >>> /= <<< + error--> awk: bailing out at source line 1 + +A workaround is: + + awk '/[=]=/' /dev/null + + `gawk' does not have this problem, nor do the other freely available +versions described in *note Other Versions::. + + +File: gawk.info, Node: Increment Ops, Next: Truth Values, Prev: Assignment Ops, Up: Expressions + +5.8 Increment and Decrement Operators +===================================== + +"Increment" and "decrement operators" increase or decrease the value of +a variable by one. An assignment operator can do the same thing, so +the increment operators add no power to the `awk' language; however, +they are convenient abbreviations for very common operations. + + The operator used for adding one is written `++'. It can be used to +increment a variable either before or after taking its value. To +pre-increment a variable `v', write `++v'. This adds one to the value +of `v'--that new value is also the value of the expression. (The +assignment expression `v += 1' is completely equivalent.) Writing the +`++' after the variable specifies post-increment. This increments the +variable value just the same; the difference is that the value of the +increment expression itself is the variable's _old_ value. Thus, if +`foo' has the value four, then the expression `foo++' has the value +four, but it changes the value of `foo' to five. In other words, the +operator returns the old value of the variable, but with the side +effect of incrementing it. + + The post-increment `foo++' is nearly the same as writing `(foo += 1) +- 1'. It is not perfectly equivalent because all numbers in `awk' are +floating-point--in floating-point, `foo + 1 - 1' does not necessarily +equal `foo'. But the difference is minute as long as you stick to +numbers that are fairly small (less than 10e12). + + Fields and array elements are incremented just like variables. (Use +`$(i++)' when you want to do a field reference and a variable increment +at the same time. The parentheses are necessary because of the +precedence of the field reference operator `$'.) + + The decrement operator `--' works just like `++', except that it +subtracts one instead of adding it. As with `++', it can be used before +the lvalue to pre-decrement or after it to post-decrement. Following +is a summary of increment and decrement expressions: + +`++LVALUE' + This expression increments LVALUE, and the new value becomes the + value of the expression. + +`LVALUE++' + This expression increments LVALUE, but the value of the expression + is the _old_ value of LVALUE. + +`--LVALUE' + This expression is like `++LVALUE', but instead of adding, it + subtracts. It decrements LVALUE and delivers the value that is + the result. + +`LVALUE--' + This expression is like `LVALUE++', but instead of adding, it + subtracts. It decrements LVALUE. The value of the expression is + the _old_ value of LVALUE. + +Advanced Notes: Operator Evaluation Order +----------------------------------------- + + Doctor, doctor! It hurts when I do this! + So don't do that! + Groucho Marx + +What happens for something like the following? + + b = 6 + print b += b++ + +Or something even stranger? + + b = 6 + b += ++b + b++ + print b + + In other words, when do the various side effects prescribed by the +postfix operators (`b++') take effect? When side effects happen is +"implementation defined". In other words, it is up to the particular +version of `awk'. The result for the first example may be 12 or 13, +and for the second, it may be 22 or 23. + + In short, doing things like this is not recommended and definitely +not anything that you can rely upon for portability. You should avoid +such things in your own programs. + + +File: gawk.info, Node: Truth Values, Next: Typing and Comparison, Prev: Increment Ops, Up: Expressions + +5.9 True and False in `awk' +=========================== + +Many programming languages have a special representation for the +concepts of "true" and "false." Such languages usually use the special +constants `true' and `false', or perhaps their uppercase equivalents. +However, `awk' is different. It borrows a very simple concept of true +and false from C. In `awk', any nonzero numeric value _or_ any +nonempty string value is true. Any other value (zero or the null +string `""') is false. The following program prints `A strange truth +value' three times: + + BEGIN { + if (3.1415927) + print "A strange truth value" + if ("Four Score And Seven Years Ago") + print "A strange truth value" + if (j = 57) + print "A strange truth value" + } + + There is a surprising consequence of the "nonzero or non-null" rule: +the string constant `"0"' is actually true, because it is non-null. +(d.c.) + + +File: gawk.info, Node: Typing and Comparison, Next: Boolean Ops, Prev: Truth Values, Up: Expressions + +5.10 Variable Typing and Comparison Expressions +=============================================== + + The Guide is definitive. Reality is frequently inaccurate. + The Hitchhiker's Guide to the Galaxy + + Unlike other programming languages, `awk' variables do not have a +fixed type. Instead, they can be either a number or a string, depending +upon the value that is assigned to them. We look now at how variables +are typed, and how `awk' compares variables. + +* Menu: + +* Variable Typing:: String type versus numeric type. +* Comparison Operators:: The comparison operators. + + +File: gawk.info, Node: Variable Typing, Next: Comparison Operators, Up: Typing and Comparison + +5.10.1 String Type Versus Numeric Type +-------------------------------------- + +The 1992 POSIX standard introduced the concept of a "numeric string", +which is simply a string that looks like a number--for example, +`" +2"'. This concept is used for determining the type of a variable. +The type of the variable is important because the types of two variables +determine how they are compared. In `gawk', variable typing follows +these rules: + + * A numeric constant or the result of a numeric operation has the + NUMERIC attribute. + + * A string constant or the result of a string operation has the + STRING attribute. + + * Fields, `getline' input, `FILENAME', `ARGV' elements, `ENVIRON' + elements, and the elements of an array created by `split' that are + numeric strings have the STRNUM attribute. Otherwise, they have + the STRING attribute. Uninitialized variables also have the + STRNUM attribute. + + * Attributes propagate across assignments but are not changed by any + use. + + The last rule is particularly important. In the following program, +`a' has numeric type, even though it is later used in a string +operation: + + BEGIN { + a = 12.345 + b = a " is a cute number" + print b + } + + When two operands are compared, either string comparison or numeric +comparison may be used. This depends upon the attributes of the +operands, according to the following symmetric matrix: + + +--------------------------------------------- + | STRING NUMERIC STRNUM + -------+--------------------------------------------- + | + STRING | string string string + | + NUMERIC | string numeric numeric + | + STRNUM | string numeric numeric + -------+--------------------------------------------- + + The basic idea is that user input that looks numeric--and _only_ +user input--should be treated as numeric, even though it is actually +made of characters and is therefore also a string. Thus, for example, +the string constant `" +3.14"', when it appears in program source code, +is a string--even though it looks numeric--and is _never_ treated as +number for comparison purposes. + + In short, when one operand is a "pure" string, such as a string +constant, then a string comparison is performed. Otherwise, a numeric +comparison is performed.(1) + + This point bears additional emphasis: All user input is made of +characters, and so is first and foremost of STRING type; input strings +that look numeric are additionally given the STRNUM attribute. Thus, +the six-character input string ` +3.14' receives the STRNUM attribute. +In contrast, the eight-character literal `" +3.14"' appearing in +program text is a string constant. The following examples print `1' +when the comparison between the two different constants is true, `0' +otherwise: + + $ echo ' +3.14' | gawk '{ print $0 == " +3.14" }' True + -| 1 + $ echo ' +3.14' | gawk '{ print $0 == "+3.14" }' False + -| 0 + $ echo ' +3.14' | gawk '{ print $0 == "3.14" }' False + -| 0 + $ echo ' +3.14' | gawk '{ print $0 == 3.14 }' True + -| 1 + $ echo ' +3.14' | gawk '{ print $1 == " +3.14" }' False + -| 0 + $ echo ' +3.14' | gawk '{ print $1 == "+3.14" }' True + -| 1 + $ echo ' +3.14' | gawk '{ print $1 == "3.14" }' False + -| 0 + $ echo ' +3.14' | gawk '{ print $1 == 3.14 }' True + -| 1 + + ---------- Footnotes ---------- + + (1) The POSIX standard has been revised. The revised standard's +rules for typing and comparison are the same as just described for +`gawk'. + + +File: gawk.info, Node: Comparison Operators, Prev: Variable Typing, Up: Typing and Comparison + +5.10.2 Comparison Operators +--------------------------- + +"Comparison expressions" compare strings or numbers for relationships +such as equality. They are written using "relational operators", which +are a superset of those in C. *note table-relational-ops:: describes +them. + +Expression Result +-------------------------------------------------------------------------- +X `<' Y True if X is less than Y. +X `<=' Y True if X is less than or equal to Y. +X `>' Y True if X is greater than Y. +X `>=' Y True if X is greater than or equal to Y. +X `==' Y True if X is equal to Y. +X `!=' Y True if X is not equal to Y. +X `~' Y True if the string X matches the regexp denoted by Y. +X `!~' Y True if the string X does not match the regexp + denoted by Y. +SUBSCRIPT `in' True if the array ARRAY has an element with the +ARRAY subscript SUBSCRIPT. + +Table 5.3: Relational Operators + + Comparison expressions have the value one if true and zero if false. +When comparing operands of mixed types, numeric operands are converted +to strings using the value of `CONVFMT' (*note Conversion::). + + Strings are compared by comparing the first character of each, then +the second character of each, and so on. Thus, `"10"' is less than +`"9"'. If there are two strings where one is a prefix of the other, +the shorter string is less than the longer one. Thus, `"abc"' is less +than `"abcd"'. + + It is very easy to accidentally mistype the `==' operator and leave +off one of the `=' characters. The result is still valid `awk' code, +but the program does not do what is intended: + + if (a = b) # oops! should be a == b + ... + else + ... + +Unless `b' happens to be zero or the null string, the `if' part of the +test always succeeds. Because the operators are so similar, this kind +of error is very difficult to spot when scanning the source code. + + The following table of expressions illustrates the kind of comparison +`gawk' performs, as well as what the result of the comparison is: + +`1.5 <= 2.0' + numeric comparison (true) + +`"abc" >= "xyz"' + string comparison (false) + +`1.5 != " +2"' + string comparison (true) + +`"1e2" < "3"' + string comparison (true) + +`a = 2; b = "2"' +`a == b' + string comparison (true) + +`a = 2; b = " +2"' + +`a == b' + string comparison (false) + + In the next example: + + $ echo 1e2 3 | awk '{ print ($1 < $2) ? "true" : "false" }' + -| false + +the result is `false' because both `$1' and `$2' are user input. They +are numeric strings--therefore both have the STRNUM attribute, +dictating a numeric comparison. The purpose of the comparison rules +and the use of numeric strings is to attempt to produce the behavior +that is "least surprising," while still "doing the right thing." +String comparisons and regular expression comparisons are very +different. For example: + + x == "foo" + +has the value one, or is true if the variable `x' is precisely `foo'. +By contrast: + + x ~ /foo/ + +has the value one if `x' contains `foo', such as `"Oh, what a fool am +I!"'. + + The righthand operand of the `~' and `!~' operators may be either a +regexp constant (`/.../') or an ordinary expression. In the latter +case, the value of the expression as a string is used as a dynamic +regexp (*note Regexp Usage::; also *note Computed Regexps::). + + In modern implementations of `awk', a constant regular expression in +slashes by itself is also an expression. The regexp `/REGEXP/' is an +abbreviation for the following comparison expression: + + $0 ~ /REGEXP/ + + One special place where `/foo/' is _not_ an abbreviation for `$0 ~ +/foo/' is when it is the righthand operand of `~' or `!~'. *Note Using +Constant Regexps::, where this is discussed in more detail. + + +File: gawk.info, Node: Boolean Ops, Next: Conditional Exp, Prev: Typing and Comparison, Up: Expressions + +5.11 Boolean Expressions +======================== + +A "Boolean expression" is a combination of comparison expressions or +matching expressions, using the Boolean operators "or" (`||'), "and" +(`&&'), and "not" (`!'), along with parentheses to control nesting. +The truth value of the Boolean expression is computed by combining the +truth values of the component expressions. Boolean expressions are +also referred to as "logical expressions". The terms are equivalent. + + Boolean expressions can be used wherever comparison and matching +expressions can be used. They can be used in `if', `while', `do', and +`for' statements (*note Statements::). They have numeric values (one +if true, zero if false) that come into play if the result of the +Boolean expression is stored in a variable or used in arithmetic. + + In addition, every Boolean expression is also a valid pattern, so +you can use one as a pattern to control the execution of rules. The +Boolean operators are: + +`BOOLEAN1 && BOOLEAN2' + True if both BOOLEAN1 and BOOLEAN2 are true. For example, the + following statement prints the current input record if it contains + both `2400' and `foo': + + if ($0 ~ /2400/ && $0 ~ /foo/) print + + The subexpression BOOLEAN2 is evaluated only if BOOLEAN1 is true. + This can make a difference when BOOLEAN2 contains expressions that + have side effects. In the case of `$0 ~ /foo/ && ($2 == bar++)', + the variable `bar' is not incremented if there is no substring + `foo' in the record. + +`BOOLEAN1 || BOOLEAN2' + True if at least one of BOOLEAN1 or BOOLEAN2 is true. For + example, the following statement prints all records in the input + that contain _either_ `2400' or `foo' or both: + + if ($0 ~ /2400/ || $0 ~ /foo/) print + + The subexpression BOOLEAN2 is evaluated only if BOOLEAN1 is false. + This can make a difference when BOOLEAN2 contains expressions that + have side effects. + +`! BOOLEAN' + True if BOOLEAN is false. For example, the following program + prints `no home!' in the unusual event that the `HOME' environment + variable is not defined: + + BEGIN { if (! ("HOME" in ENVIRON)) + print "no home!" } + + (The `in' operator is described in *note Reference to Elements::.) + + The `&&' and `||' operators are called "short-circuit" operators +because of the way they work. Evaluation of the full expression is +"short-circuited" if the result can be determined part way through its +evaluation. + + Statements that use `&&' or `||' can be continued simply by putting +a newline after them. But you cannot put a newline in front of either +of these operators without using backslash continuation (*note +Statements/Lines::). + + The actual value of an expression using the `!' operator is either +one or zero, depending upon the truth value of the expression it is +applied to. The `!' operator is often useful for changing the sense of +a flag variable from false to true and back again. For example, the +following program is one way to print lines in between special +bracketing lines: + + $1 == "START" { interested = ! interested; next } + interested == 1 { print } + $1 == "END" { interested = ! interested; next } + +The variable `interested', as with all `awk' variables, starts out +initialized to zero, which is also false. When a line is seen whose +first field is `START', the value of `interested' is toggled to true, +using `!'. The next rule prints lines as long as `interested' is true. +When a line is seen whose first field is `END', `interested' is toggled +back to false.(1) + + NOTE: The `next' statement is discussed in *note Next Statement::. + `next' tells `awk' to skip the rest of the rules, get the next + record, and start processing the rules over again at the top. The + reason it's there is to avoid printing the bracketing `START' and + `END' lines. + + ---------- Footnotes ---------- + + (1) This program has a bug; it prints lines starting with `END'. How +would you fix it? + + +File: gawk.info, Node: Conditional Exp, Next: Function Calls, Prev: Boolean Ops, Up: Expressions + +5.12 Conditional Expressions +============================ + +A "conditional expression" is a special kind of expression that has +three operands. It allows you to use one expression's value to select +one of two other expressions. The conditional expression is the same +as in the C language, as shown here: + + SELECTOR ? IF-TRUE-EXP : IF-FALSE-EXP + +There are three subexpressions. The first, SELECTOR, is always +computed first. If it is "true" (not zero or not null), then +IF-TRUE-EXP is computed next and its value becomes the value of the +whole expression. Otherwise, IF-FALSE-EXP is computed next and its +value becomes the value of the whole expression. For example, the +following expression produces the absolute value of `x': + + x >= 0 ? x : -x + + Each time the conditional expression is computed, only one of +IF-TRUE-EXP and IF-FALSE-EXP is used; the other is ignored. This is +important when the expressions have side effects. For example, this +conditional expression examines element `i' of either array `a' or +array `b', and increments `i': + + x == y ? a[i++] : b[i++] + +This is guaranteed to increment `i' exactly once, because each time +only one of the two increment expressions is executed and the other is +not. *Note Arrays::, for more information about arrays. + + As a minor `gawk' extension, a statement that uses `?:' can be +continued simply by putting a newline after either character. However, +putting a newline in front of either character does not work without +using backslash continuation (*note Statements/Lines::). If `--posix' +is specified (*note Options::), then this extension is disabled. + + +File: gawk.info, Node: Function Calls, Next: Precedence, Prev: Conditional Exp, Up: Expressions + +5.13 Function Calls +=================== + +A "function" is a name for a particular calculation. This enables you +to ask for it by name at any point in the program. For example, the +function `sqrt' computes the square root of a number. + + A fixed set of functions are "built-in", which means they are +available in every `awk' program. The `sqrt' function is one of these. +*Note Built-in::, for a list of built-in functions and their +descriptions. In addition, you can define functions for use in your +program. *Note User-defined::, for instructions on how to do this. + + The way to use a function is with a "function call" expression, +which consists of the function name followed immediately by a list of +"arguments" in parentheses. The arguments are expressions that provide +the raw materials for the function's calculations. When there is more +than one argument, they are separated by commas. If there are no +arguments, just write `()' after the function name. The following +examples show function calls with and without arguments: + + sqrt(x^2 + y^2) one argument + atan2(y, x) two arguments + rand() no arguments + + *Caution:* Do not put any space between the function name and the +open-parenthesis! A user-defined function name looks just like the +name of a variable--a space would make the expression look like +concatenation of a variable with an expression inside parentheses. + + With built-in functions, space before the parenthesis is harmless, +but it is best not to get into the habit of using space to avoid +mistakes with user-defined functions. Each function expects a +particular number of arguments. For example, the `sqrt' function must +be called with a single argument, the number of which to take the +square root: + + sqrt(ARGUMENT) + + Some of the built-in functions have one or more optional arguments. +If those arguments are not supplied, the functions use a reasonable +default value. *Note Built-in::, for full details. If arguments are +omitted in calls to user-defined functions, then those arguments are +treated as local variables and initialized to the empty string (*note +User-defined::). + + Like every other expression, the function call has a value, which is +computed by the function based on the arguments you give it. In this +example, the value of `sqrt(ARGUMENT)' is the square root of ARGUMENT. +The following program reads numbers, one number per line, and prints the +square root of each one: + + $ awk '{ print "The square root of", $1, "is", sqrt($1) }' + 1 + -| The square root of 1 is 1 + 3 + -| The square root of 3 is 1.73205 + 5 + -| The square root of 5 is 2.23607 + Ctrl-d + + A function can also have side effects, such as assigning values to +certain variables or doing I/O. This program shows how the `match' +function (*note String Functions::) changes the variables `RSTART' and +`RLENGTH': + + { + if (match($1, $2)) + print RSTART, RLENGTH + else + print "no match" + } + +Here is a sample run: + + $ awk -f matchit.awk + aaccdd c+ + -| 3 2 + foo bar + -| no match + abcdefg e + -| 5 1 + + +File: gawk.info, Node: Precedence, Prev: Function Calls, Up: Expressions + +5.14 Operator Precedence (How Operators Nest) +============================================= + +"Operator precedence" determines how operators are grouped when +different operators appear close by in one expression. For example, +`*' has higher precedence than `+'; thus, `a + b * c' means to multiply +`b' and `c', and then add `a' to the product (i.e., `a + (b * c)'). + + The normal precedence of the operators can be overruled by using +parentheses. Think of the precedence rules as saying where the +parentheses are assumed to be. In fact, it is wise to always use +parentheses whenever there is an unusual combination of operators, +because other people who read the program may not remember what the +precedence is in this case. Even experienced programmers occasionally +forget the exact rules, which leads to mistakes. Explicit parentheses +help prevent any such mistakes. + + When operators of equal precedence are used together, the leftmost +operator groups first, except for the assignment, conditional, and +exponentiation operators, which group in the opposite order. Thus, `a +- b + c' groups as `(a - b) + c' and `a = b = c' groups as `a = (b = +c)'. + + Normally the precedence of prefix unary operators does not matter, +because there is only one way to interpret them: innermost first. +Thus, `$++i' means `$(++i)' and `++$x' means `++($x)'. However, when +another operator follows the operand, then the precedence of the unary +operators can matter. `$x^2' means `($x)^2', but `-x^2' means +`-(x^2)', because `-' has lower precedence than `^', whereas `$' has +higher precedence. Also, operators cannot be combined in a way that +violates the precedence rules; for example, `$$0++--' is not a valid +expression because the first `$' has higher precedence than the `++'; +to avoid the problem the expression can be rewritten as `$($0++)--'. + + This table presents `awk''s operators, in order of highest to lowest +precedence: + +`(...)' + Grouping. + +`$' + Field. + +`++ --' + Increment, decrement. + +`^ **' + Exponentiation. These operators group right-to-left. + +`+ - !' + Unary plus, minus, logical "not." + +`* / %' + Multiplication, division, remainder. + +`+ -' + Addition, subtraction. + +`String Concatenation' + No special symbol is used to indicate concatenation. The operands + are simply written side by side (*note Concatenation::). + +`< <= == !=' +`> >= >> | |&' + Relational and redirection. The relational operators and the + redirections have the same precedence level. Characters such as + `>' serve both as relationals and as redirections; the context + distinguishes between the two meanings. + + Note that the I/O redirection operators in `print' and `printf' + statements belong to the statement level, not to expressions. The + redirection does not produce an expression that could be the + operand of another operator. As a result, it does not make sense + to use a redirection operator near another operator of lower + precedence without parentheses. Such combinations (for example, + `print foo > a ? b : c'), result in syntax errors. The correct + way to write this statement is `print foo > (a ? b : c)'. + +`~ !~' + Matching, nonmatching. + +`in' + Array membership. + +`&&' + Logical "and". + +`||' + Logical "or". + +`?:' + Conditional. This operator groups right-to-left. + +`= += -= *=' +`/= %= ^= **=' + Assignment. These operators group right to left. + + NOTE: The `|&', `**', and `**=' operators are not specified by + POSIX. For maximum portability, do not use them. + + +File: gawk.info, Node: Patterns and Actions, Next: Arrays, Prev: Expressions, Up: Top + +6 Patterns, Actions, and Variables +********************************** + +As you have already seen, each `awk' statement consists of a pattern +with an associated action. This major node describes how you build +patterns and actions, what kinds of things you can do within actions, +and `awk''s built-in variables. + + The pattern-action rules and the statements available for use within +actions form the core of `awk' programming. In a sense, everything +covered up to here has been the foundation that programs are built on +top of. Now it's time to start building something useful. + +* Menu: + +* Pattern Overview:: What goes into a pattern. +* Using Shell Variables:: How to use shell variables with `awk'. +* Action Overview:: What goes into an action. +* Statements:: Describes the various control statements in + detail. +* Built-in Variables:: Summarizes the built-in variables. + + +File: gawk.info, Node: Pattern Overview, Next: Using Shell Variables, Up: Patterns and Actions + +6.1 Pattern Elements +==================== + +* Menu: + +* Regexp Patterns:: Using regexps as patterns. +* Expression Patterns:: Any expression can be used as a pattern. +* Ranges:: Pairs of patterns specify record ranges. +* BEGIN/END:: Specifying initialization and cleanup rules. +* Empty:: The empty pattern, which matches every record. + + Patterns in `awk' control the execution of rules--a rule is executed +when its pattern matches the current input record. The following is a +summary of the types of `awk' patterns: + +`/REGULAR EXPRESSION/' + A regular expression. It matches when the text of the input record + fits the regular expression. (*Note Regexp::.) + +`EXPRESSION' + A single expression. It matches when its value is nonzero (if a + number) or non-null (if a string). (*Note Expression Patterns::.) + +`PAT1, PAT2' + A pair of patterns separated by a comma, specifying a range of + records. The range includes both the initial record that matches + PAT1 and the final record that matches PAT2. (*Note Ranges::.) + +`BEGIN' +`END' + Special patterns for you to supply startup or cleanup actions for + your `awk' program. (*Note BEGIN/END::.) + +`EMPTY' + The empty pattern matches every input record. (*Note Empty::.) + + +File: gawk.info, Node: Regexp Patterns, Next: Expression Patterns, Up: Pattern Overview + +6.1.1 Regular Expressions as Patterns +------------------------------------- + +Regular expressions are one of the first kinds of patterns presented in +this book. This kind of pattern is simply a regexp constant in the +pattern part of a rule. Its meaning is `$0 ~ /PATTERN/'. The pattern +matches when the input record matches the regexp. For example: + + /foo|bar|baz/ { buzzwords++ } + END { print buzzwords, "buzzwords seen" } + + +File: gawk.info, Node: Expression Patterns, Next: Ranges, Prev: Regexp Patterns, Up: Pattern Overview + +6.1.2 Expressions as Patterns +----------------------------- + +Any `awk' expression is valid as an `awk' pattern. The pattern matches +if the expression's value is nonzero (if a number) or non-null (if a +string). The expression is reevaluated each time the rule is tested +against a new input record. If the expression uses fields such as +`$1', the value depends directly on the new input record's text; +otherwise, it depends on only what has happened so far in the execution +of the `awk' program. + + Comparison expressions, using the comparison operators described in +*note Typing and Comparison::, are a very common kind of pattern. +Regexp matching and nonmatching are also very common expressions. The +left operand of the `~' and `!~' operators is a string. The right +operand is either a constant regular expression enclosed in slashes +(`/REGEXP/'), or any expression whose string value is used as a dynamic +regular expression (*note Computed Regexps::). The following example +prints the second field of each input record whose first field is +precisely `foo': + + $ awk '$1 == "foo" { print $2 }' BBS-list + +(There is no output, because there is no BBS site with the exact name +`foo'.) Contrast this with the following regular expression match, +which accepts any record with a first field that contains `foo': + + $ awk '$1 ~ /foo/ { print $2 }' BBS-list + -| 555-1234 + -| 555-6699 + -| 555-6480 + -| 555-2127 + + A regexp constant as a pattern is also a special case of an +expression pattern. The expression `/foo/' has the value one if `foo' +appears in the current input record. Thus, as a pattern, `/foo/' +matches any record containing `foo'. + + Boolean expressions are also commonly used as patterns. Whether the +pattern matches an input record depends on whether its subexpressions +match. For example, the following command prints all the records in +`BBS-list' that contain both `2400' and `foo': + + $ awk '/2400/ && /foo/' BBS-list + -| fooey 555-1234 2400/1200/300 B + + The following command prints all records in `BBS-list' that contain +_either_ `2400' or `foo' (or both, of course): + + $ awk '/2400/ || /foo/' BBS-list + -| alpo-net 555-3412 2400/1200/300 A + -| bites 555-1675 2400/1200/300 A + -| fooey 555-1234 2400/1200/300 B + -| foot 555-6699 1200/300 B + -| macfoo 555-6480 1200/300 A + -| sdace 555-3430 2400/1200/300 A + -| sabafoo 555-2127 1200/300 C + + The following command prints all records in `BBS-list' that do _not_ +contain the string `foo': + + $ awk '! /foo/' BBS-list + -| aardvark 555-5553 1200/300 B + -| alpo-net 555-3412 2400/1200/300 A + -| barfly 555-7685 1200/300 A + -| bites 555-1675 2400/1200/300 A + -| camelot 555-0542 300 C + -| core 555-2912 1200/300 C + -| sdace 555-3430 2400/1200/300 A + + The subexpressions of a Boolean operator in a pattern can be +constant regular expressions, comparisons, or any other `awk' +expressions. Range patterns are not expressions, so they cannot appear +inside Boolean patterns. Likewise, the special patterns `BEGIN' and +`END', which never match any input record, are not expressions and +cannot appear inside Boolean patterns. + + +File: gawk.info, Node: Ranges, Next: BEGIN/END, Prev: Expression Patterns, Up: Pattern Overview + +6.1.3 Specifying Record Ranges with Patterns +-------------------------------------------- + +A "range pattern" is made of two patterns separated by a comma, in the +form `BEGPAT, ENDPAT'. It is used to match ranges of consecutive input +records. The first pattern, BEGPAT, controls where the range begins, +while ENDPAT controls where the pattern ends. For example, the +following: + + awk '$1 == "on", $1 == "off"' myfile + +prints every record in `myfile' between `on'/`off' pairs, inclusive. + + A range pattern starts out by matching BEGPAT against every input +record. When a record matches BEGPAT, the range pattern is "turned on" +and the range pattern matches this record as well. As long as the +range pattern stays turned on, it automatically matches every input +record read. The range pattern also matches ENDPAT against every input +record; when this succeeds, the range pattern is turned off again for +the following record. Then the range pattern goes back to checking +BEGPAT against each record. + + The record that turns on the range pattern and the one that turns it +off both match the range pattern. If you don't want to operate on +these records, you can write `if' statements in the rule's action to +distinguish them from the records you are interested in. + + It is possible for a pattern to be turned on and off by the same +record. If the record satisfies both conditions, then the action is +executed for just that record. For example, suppose there is text +between two identical markers (e.g., the `%' symbol), each on its own +line, that should be ignored. A first attempt would be to combine a +range pattern that describes the delimited text with the `next' +statement (not discussed yet, *note Next Statement::). This causes +`awk' to skip any further processing of the current record and start +over again with the next input record. Such a program looks like this: + + /^%$/,/^%$/ { next } + { print } + +This program fails because the range pattern is both turned on and +turned off by the first line, which just has a `%' on it. To +accomplish this task, write the program in the following manner, using +a flag: + + /^%$/ { skip = ! skip; next } + skip == 1 { next } # skip lines with `skip' set + + In a range pattern, the comma (`,') has the lowest precedence of all +the operators (i.e., it is evaluated last). Thus, the following +program attempts to combine a range pattern with another, simpler test: + + echo Yes | awk '/1/,/2/ || /Yes/' + + The intent of this program is `(/1/,/2/) || /Yes/'. However, `awk' +interprets this as `/1/, (/2/ || /Yes/)'. This cannot be changed or +worked around; range patterns do not combine with other patterns: + + $ echo Yes | gawk '(/1/,/2/) || /Yes/' + error--> gawk: cmd. line:1: (/1/,/2/) || /Yes/ + error--> gawk: cmd. line:1: ^ parse error + error--> gawk: cmd. line:2: (/1/,/2/) || /Yes/ + error--> gawk: cmd. line:2: ^ unexpected newline + + +File: gawk.info, Node: BEGIN/END, Next: Empty, Prev: Ranges, Up: Pattern Overview + +6.1.4 The `BEGIN' and `END' Special Patterns +-------------------------------------------- + +All the patterns described so far are for matching input records. The +`BEGIN' and `END' special patterns are different. They supply startup +and cleanup actions for `awk' programs. `BEGIN' and `END' rules must +have actions; there is no default action for these rules because there +is no current record when they run. `BEGIN' and `END' rules are often +referred to as "`BEGIN' and `END' blocks" by long-time `awk' +programmers. + +* Menu: + +* Using BEGIN/END:: How and why to use BEGIN/END rules. +* I/O And BEGIN/END:: I/O issues in BEGIN/END rules. + + +File: gawk.info, Node: Using BEGIN/END, Next: I/O And BEGIN/END, Up: BEGIN/END + +6.1.4.1 Startup and Cleanup Actions +................................... + +A `BEGIN' rule is executed once only, before the first input record is +read. Likewise, an `END' rule is executed once only, after all the +input is read. For example: + + $ awk ' + > BEGIN { print "Analysis of \"foo\"" } + > /foo/ { ++n } + > END { print "\"foo\" appears", n, "times." }' BBS-list + -| Analysis of "foo" + -| "foo" appears 4 times. + + This program finds the number of records in the input file `BBS-list' +that contain the string `foo'. The `BEGIN' rule prints a title for the +report. There is no need to use the `BEGIN' rule to initialize the +counter `n' to zero, since `awk' does this automatically (*note +Variables::). The second rule increments the variable `n' every time a +record containing the pattern `foo' is read. The `END' rule prints the +value of `n' at the end of the run. + + The special patterns `BEGIN' and `END' cannot be used in ranges or +with Boolean operators (indeed, they cannot be used with any operators). +An `awk' program may have multiple `BEGIN' and/or `END' rules. They +are executed in the order in which they appear: all the `BEGIN' rules +at startup and all the `END' rules at termination. `BEGIN' and `END' +rules may be intermixed with other rules. This feature was added in +the 1987 version of `awk' and is included in the POSIX standard. The +original (1978) version of `awk' required the `BEGIN' rule to be placed +at the beginning of the program, the `END' rule to be placed at the +end, and only allowed one of each. This is no longer required, but it +is a good idea to follow this template in terms of program organization +and readability. + + Multiple `BEGIN' and `END' rules are useful for writing library +functions, because each library file can have its own `BEGIN' and/or +`END' rule to do its own initialization and/or cleanup. The order in +which library functions are named on the command line controls the +order in which their `BEGIN' and `END' rules are executed. Therefore, +you have to be careful when writing such rules in library files so that +the order in which they are executed doesn't matter. *Note Options::, +for more information on using library functions. *Note Library +Functions::, for a number of useful library functions. + + If an `awk' program has only a `BEGIN' rule and no other rules, then +the program exits after the `BEGIN' rule is run.(1) However, if an +`END' rule exists, then the input is read, even if there are no other +rules in the program. This is necessary in case the `END' rule checks +the `FNR' and `NR' variables. + + ---------- Footnotes ---------- + + (1) The original version of `awk' used to keep reading and ignoring +input until the end of the file was seen. + + +File: gawk.info, Node: I/O And BEGIN/END, Prev: Using BEGIN/END, Up: BEGIN/END + +6.1.4.2 Input/Output from `BEGIN' and `END' Rules +................................................. + +There are several (sometimes subtle) points to remember when doing I/O +from a `BEGIN' or `END' rule. The first has to do with the value of +`$0' in a `BEGIN' rule. Because `BEGIN' rules are executed before any +input is read, there simply is no input record, and therefore no +fields, when executing `BEGIN' rules. References to `$0' and the fields +yield a null string or zero, depending upon the context. One way to +give `$0' a real value is to execute a `getline' command without a +variable (*note Getline::). Another way is simply to assign a value to +`$0'. + + The second point is similar to the first but from the other +direction. Traditionally, due largely to implementation issues, `$0' +and `NF' were _undefined_ inside an `END' rule. The POSIX standard +specifies that `NF' is available in an `END' rule. It contains the +number of fields from the last input record. Most probably due to an +oversight, the standard does not say that `$0' is also preserved, +although logically one would think that it should be. In fact, `gawk' +does preserve the value of `$0' for use in `END' rules. Be aware, +however, that Unix `awk', and possibly other implementations, do not. + + The third point follows from the first two. The meaning of `print' +inside a `BEGIN' or `END' rule is the same as always: `print $0'. If +`$0' is the null string, then this prints an empty line. Many long +time `awk' programmers use an unadorned `print' in `BEGIN' and `END' +rules, to mean `print ""', relying on `$0' being null. Although one +might generally get away with this in `BEGIN' rules, it is a very bad +idea in `END' rules, at least in `gawk'. It is also poor style, since +if an empty line is needed in the output, the program should print one +explicitly. + + Finally, the `next' and `nextfile' statements are not allowed in a +`BEGIN' rule, because the implicit +read-a-record-and-match-against-the-rules loop has not started yet. +Similarly, those statements are not valid in an `END' rule, since all +the input has been read. (*Note Next Statement::, and see *note +Nextfile Statement::.) + + +File: gawk.info, Node: Empty, Prev: BEGIN/END, Up: Pattern Overview + +6.1.5 The Empty Pattern +----------------------- + +An empty (i.e., nonexistent) pattern is considered to match _every_ +input record. For example, the program: + + awk '{ print $1 }' BBS-list + +prints the first field of every record. + + +File: gawk.info, Node: Using Shell Variables, Next: Action Overview, Prev: Pattern Overview, Up: Patterns and Actions + +6.2 Using Shell Variables in Programs +===================================== + +`awk' programs are often used as components in larger programs written +in shell. For example, it is very common to use a shell variable to +hold a pattern that the `awk' program searches for. There are two ways +to get the value of the shell variable into the body of the `awk' +program. + + The most common method is to use shell quoting to substitute the +variable's value into the program inside the script. For example, in +the following program: + + echo -n "Enter search pattern: " + read pattern + awk "/$pattern/ "'{ nmatches++ } + END { print nmatches, "found" }' /path/to/data + +the `awk' program consists of two pieces of quoted text that are +concatenated together to form the program. The first part is +double-quoted, which allows substitution of the `pattern' variable +inside the quotes. The second part is single-quoted. + + Variable substitution via quoting works, but can be potentially +messy. It requires a good understanding of the shell's quoting rules +(*note Quoting::), and it's often difficult to correctly match up the +quotes when reading the program. + + A better method is to use `awk''s variable assignment feature (*note +Assignment Options::) to assign the shell variable's value to an `awk' +variable's value. Then use dynamic regexps to match the pattern (*note +Computed Regexps::). The following shows how to redo the previous +example using this technique: + + echo -n "Enter search pattern: " + read pattern + awk -v pat="$pattern" '$0 ~ pat { nmatches++ } + END { print nmatches, "found" }' /path/to/data + +Now, the `awk' program is just one single-quoted string. The +assignment `-v pat="$pattern"' still requires double quotes, in case +there is whitespace in the value of `$pattern'. The `awk' variable +`pat' could be named `pattern' too, but that would be more confusing. +Using a variable also provides more flexibility, since the variable can +be used anywhere inside the program--for printing, as an array +subscript, or for any other use--without requiring the quoting tricks +at every point in the program. + + +File: gawk.info, Node: Action Overview, Next: Statements, Prev: Using Shell Variables, Up: Patterns and Actions + +6.3 Actions +=========== + +An `awk' program or script consists of a series of rules and function +definitions interspersed. (Functions are described later. *Note +User-defined::.) A rule contains a pattern and an action, either of +which (but not both) may be omitted. The purpose of the "action" is to +tell `awk' what to do once a match for the pattern is found. Thus, in +outline, an `awk' program generally looks like this: + + [PATTERN] [{ ACTION }] + [PATTERN] [{ ACTION }] + ... + function NAME(ARGS) { ... } + ... + + An action consists of one or more `awk' "statements", enclosed in +curly braces (`{...}'). Each statement specifies one thing to do. The +statements are separated by newlines or semicolons. The curly braces +around an action must be used even if the action contains only one +statement, or if it contains no statements at all. However, if you +omit the action entirely, omit the curly braces as well. An omitted +action is equivalent to `{ print $0 }': + + /foo/ { } match `foo', do nothing -- empty action + /foo/ match `foo', print the record -- omitted action + + The following types of statements are supported in `awk': + +Expressions + Call functions or assign values to variables (*note + Expressions::). Executing this kind of statement simply computes + the value of the expression. This is useful when the expression + has side effects (*note Assignment Ops::). + +Control statements + Specify the control flow of `awk' programs. The `awk' language + gives you C-like constructs (`if', `for', `while', and `do') as + well as a few special ones (*note Statements::). + +Compound statements + Consist of one or more statements enclosed in curly braces. A + compound statement is used in order to put several statements + together in the body of an `if', `while', `do', or `for' statement. + +Input statements + Use the `getline' command (*note Getline::). Also supplied in + `awk' are the `next' statement (*note Next Statement::), and the + `nextfile' statement (*note Nextfile Statement::). + +Output statements + Such as `print' and `printf'. *Note Printing::. + +Deletion statements + For deleting array elements. *Note Delete::. + + +File: gawk.info, Node: Statements, Next: Built-in Variables, Prev: Action Overview, Up: Patterns and Actions + +6.4 Control Statements in Actions +================================= + +"Control statements", such as `if', `while', and so on, control the +flow of execution in `awk' programs. Most of the control statements in +`awk' are patterned on similar statements in C. + + All the control statements start with special keywords, such as `if' +and `while', to distinguish them from simple expressions. Many control +statements contain other statements. For example, the `if' statement +contains another statement that may or may not be executed. The +contained statement is called the "body". To include more than one +statement in the body, group them into a single "compound statement" +with curly braces, separating them with newlines or semicolons. + +* Menu: + +* If Statement:: Conditionally execute some `awk' + statements. +* While Statement:: Loop until some condition is satisfied. +* Do Statement:: Do specified action while looping until some + condition is satisfied. +* For Statement:: Another looping statement, that provides + initialization and increment clauses. +* Switch Statement:: Switch/case evaluation for conditional + execution of statements based on a value. +* Break Statement:: Immediately exit the innermost enclosing loop. +* Continue Statement:: Skip to the end of the innermost enclosing + loop. +* Next Statement:: Stop processing the current input record. +* Nextfile Statement:: Stop processing the current file. +* Exit Statement:: Stop execution of `awk'. + + +File: gawk.info, Node: If Statement, Next: While Statement, Up: Statements + +6.4.1 The `if'-`else' Statement +------------------------------- + +The `if'-`else' statement is `awk''s decision-making statement. It +looks like this: + + if (CONDITION) THEN-BODY [else ELSE-BODY] + +The CONDITION is an expression that controls what the rest of the +statement does. If the CONDITION is true, THEN-BODY is executed; +otherwise, ELSE-BODY is executed. The `else' part of the statement is +optional. The condition is considered false if its value is zero or +the null string; otherwise, the condition is true. Refer to the +following: + + if (x % 2 == 0) + print "x is even" + else + print "x is odd" + + In this example, if the expression `x % 2 == 0' is true (that is, if +the value of `x' is evenly divisible by two), then the first `print' +statement is executed; otherwise, the second `print' statement is +executed. If the `else' keyword appears on the same line as THEN-BODY +and THEN-BODY is not a compound statement (i.e., not surrounded by +curly braces), then a semicolon must separate THEN-BODY from the `else'. +To illustrate this, the previous example can be rewritten as: + + if (x % 2 == 0) print "x is even"; else + print "x is odd" + +If the `;' is left out, `awk' can't interpret the statement and it +produces a syntax error. Don't actually write programs this way, +because a human reader might fail to see the `else' if it is not the +first thing on its line. + + +File: gawk.info, Node: While Statement, Next: Do Statement, Prev: If Statement, Up: Statements + +6.4.2 The `while' Statement +--------------------------- + +In programming, a "loop" is a part of a program that can be executed +two or more times in succession. The `while' statement is the simplest +looping statement in `awk'. It repeatedly executes a statement as long +as a condition is true. For example: + + while (CONDITION) + BODY + +BODY is a statement called the "body" of the loop, and CONDITION is an +expression that controls how long the loop keeps running. The first +thing the `while' statement does is test the CONDITION. If the +CONDITION is true, it executes the statement BODY. (The CONDITION is +true when the value is not zero and not a null string.) After BODY has +been executed, CONDITION is tested again, and if it is still true, BODY +is executed again. This process repeats until the CONDITION is no +longer true. If the CONDITION is initially false, the body of the loop +is never executed and `awk' continues with the statement following the +loop. This example prints the first three fields of each record, one +per line: + + awk '{ i = 1 + while (i <= 3) { + print $i + i++ + } + }' inventory-shipped + +The body of this loop is a compound statement enclosed in braces, +containing two statements. The loop works in the following manner: +first, the value of `i' is set to one. Then, the `while' statement +tests whether `i' is less than or equal to three. This is true when +`i' equals one, so the `i'-th field is printed. Then the `i++' +increments the value of `i' and the loop repeats. The loop terminates +when `i' reaches four. + + A newline is not required between the condition and the body; +however using one makes the program clearer unless the body is a +compound statement or else is very simple. The newline after the +open-brace that begins the compound statement is not required either, +but the program is harder to read without it. + + +File: gawk.info, Node: Do Statement, Next: For Statement, Prev: While Statement, Up: Statements + +6.4.3 The `do'-`while' Statement +-------------------------------- + +The `do' loop is a variation of the `while' looping statement. The +`do' loop executes the BODY once and then repeats the BODY as long as +the CONDITION is true. It looks like this: + + do + BODY + while (CONDITION) + + Even if the CONDITION is false at the start, the BODY is executed at +least once (and only once, unless executing BODY makes CONDITION true). +Contrast this with the corresponding `while' statement: + + while (CONDITION) + BODY + +This statement does not execute BODY even once if the CONDITION is +false to begin with. The following is an example of a `do' statement: + + { i = 1 + do { + print $0 + i++ + } while (i <= 10) + } + +This program prints each input record 10 times. However, it isn't a +very realistic example, since in this case an ordinary `while' would do +just as well. This situation reflects actual experience; only +occasionally is there a real use for a `do' statement. + + +File: gawk.info, Node: For Statement, Next: Switch Statement, Prev: Do Statement, Up: Statements + +6.4.4 The `for' Statement +------------------------- + +The `for' statement makes it more convenient to count iterations of a +loop. The general form of the `for' statement looks like this: + + for (INITIALIZATION; CONDITION; INCREMENT) + BODY + +The INITIALIZATION, CONDITION, and INCREMENT parts are arbitrary `awk' +expressions, and BODY stands for any `awk' statement. + + The `for' statement starts by executing INITIALIZATION. Then, as +long as the CONDITION is true, it repeatedly executes BODY and then +INCREMENT. Typically, INITIALIZATION sets a variable to either zero or +one, INCREMENT adds one to it, and CONDITION compares it against the +desired number of iterations. For example: + + awk '{ for (i = 1; i <= 3; i++) + print $i + }' inventory-shipped + +This prints the first three fields of each input record, with one field +per line. + + It isn't possible to set more than one variable in the +INITIALIZATION part without using a multiple assignment statement such +as `x = y = 0'. This makes sense only if all the initial values are +equal. (But it is possible to initialize additional variables by +writing their assignments as separate statements preceding the `for' +loop.) + + The same is true of the INCREMENT part. Incrementing additional +variables requires separate statements at the end of the loop. The C +compound expression, using C's comma operator, is useful in this +context but it is not supported in `awk'. + + Most often, INCREMENT is an increment expression, as in the previous +example. But this is not required; it can be any expression +whatsoever. For example, the following statement prints all the powers +of two between 1 and 100: + + for (i = 1; i <= 100; i *= 2) + print i + + If there is nothing to be done, any of the three expressions in the +parentheses following the `for' keyword may be omitted. Thus, +`for (; x > 0;)' is equivalent to `while (x > 0)'. If the CONDITION is +omitted, it is treated as true, effectively yielding an "infinite loop" +(i.e., a loop that never terminates). + + In most cases, a `for' loop is an abbreviation for a `while' loop, +as shown here: + + INITIALIZATION + while (CONDITION) { + BODY + INCREMENT + } + +The only exception is when the `continue' statement (*note Continue +Statement::) is used inside the loop. Changing a `for' statement to a +`while' statement in this way can change the effect of the `continue' +statement inside the loop. + + The `awk' language has a `for' statement in addition to a `while' +statement because a `for' loop is often both less work to type and more +natural to think of. Counting the number of iterations is very common +in loops. It can be easier to think of this counting as part of +looping rather than as something to do inside the loop. + + There is an alternate version of the `for' loop, for iterating over +all the indices of an array: + + for (i in array) + DO SOMETHING WITH array[i] + +*Note Scanning an Array::, for more information on this version of the +`for' loop. + + +File: gawk.info, Node: Switch Statement, Next: Break Statement, Prev: For Statement, Up: Statements + +6.4.5 The `switch' Statement +---------------------------- + + NOTE: This node describes an experimental feature added in `gawk' + 3.1.3. It is _not_ enabled by default. To enable it, use the + `--enable-switch' option to `configure' when `gawk' is being + configured and built. *Note Additional Configuration Options::, + for more information. + + The `switch' statement allows the evaluation of an expression and +the execution of statements based on a `case' match. Case statements +are checked for a match in the order they are defined. If no suitable +`case' is found, the `default' section is executed, if supplied. + + Each `case' contains a single constant, be it numeric, string, or +regexp. The `switch' expression is evaluated, and then each `case''s +constant is compared against the result in turn. The type of constant +determines the comparison: numeric or string do the usual comparisons. +A regexp constant does a regular expression match against the string +value of the original expression. The general form of the `switch' +statement looks like this: + + switch (EXPRESSION) { + case VALUE OR REGULAR EXPRESSION: + CASE-BODY + default: + DEFAULT-BODY + } + + Control flow in the `switch' statement works as it does in C. Once a +match to a given case is made, case statement bodies are executed until +a `break', `continue', `next', `nextfile' or `exit' is encountered, or +the end of the `switch' statement itself. For example: + + switch (NR * 2 + 1) { + case 3: + case "11": + print NR - 1 + break + + case /2[[:digit:]]+/: + print NR + + default: + print NR + 1 + + case -1: + print NR * -1 + } + + Note that if none of the statements specified above halt execution +of a matched `case' statement, execution falls through to the next +`case' until execution halts. In the above example, for any case value +starting with `2' followed by one or more digits, the `print' statement +is executed and then falls through into the `default' section, +executing its `print' statement. In turn, the -1 case will also be +executed since the `default' does not halt execution. + + +File: gawk.info, Node: Break Statement, Next: Continue Statement, Prev: Switch Statement, Up: Statements + +6.4.6 The `break' Statement +--------------------------- + +The `break' statement jumps out of the innermost `for', `while', or +`do' loop that encloses it. The following example finds the smallest +divisor of any integer, and also identifies prime numbers: + + # find smallest divisor of num + { + num = $1 + for (div = 2; div*div <= num; div++) + if (num % div == 0) + break + if (num % div == 0) + printf "Smallest divisor of %d is %d\n", num, div + else + printf "%d is prime\n", num + } + + When the remainder is zero in the first `if' statement, `awk' +immediately "breaks out" of the containing `for' loop. This means that +`awk' proceeds immediately to the statement following the loop and +continues processing. (This is very different from the `exit' +statement, which stops the entire `awk' program. *Note Exit +Statement::.) + + Th following program illustrates how the CONDITION of a `for' or +`while' statement could be replaced with a `break' inside an `if': + + # find smallest divisor of num + { + num = $1 + for (div = 2; ; div++) { + if (num % div == 0) { + printf "Smallest divisor of %d is %d\n", num, div + break + } + if (div*div > num) { + printf "%d is prime\n", num + break + } + } + } + + The `break' statement has no meaning when used outside the body of a +loop. However, although it was never documented, historical +implementations of `awk' treated the `break' statement outside of a +loop as if it were a `next' statement (*note Next Statement::). Recent +versions of Unix `awk' no longer allow this usage. `gawk' supports +this use of `break' only if `--traditional' has been specified on the +command line (*note Options::). Otherwise, it is treated as an error, +since the POSIX standard specifies that `break' should only be used +inside the body of a loop. (d.c.) + + +File: gawk.info, Node: Continue Statement, Next: Next Statement, Prev: Break Statement, Up: Statements + +6.4.7 The `continue' Statement +------------------------------ + +As with `break', the `continue' statement is used only inside `for', +`while', and `do' loops. It skips over the rest of the loop body, +causing the next cycle around the loop to begin immediately. Contrast +this with `break', which jumps out of the loop altogether. + + The `continue' statement in a `for' loop directs `awk' to skip the +rest of the body of the loop and resume execution with the +increment-expression of the `for' statement. The following program +illustrates this fact: + + BEGIN { + for (x = 0; x <= 20; x++) { + if (x == 5) + continue + printf "%d ", x + } + print "" + } + +This program prints all the numbers from 0 to 20--except for 5, for +which the `printf' is skipped. Because the increment `x++' is not +skipped, `x' does not remain stuck at 5. Contrast the `for' loop from +the previous example with the following `while' loop: + + BEGIN { + x = 0 + while (x <= 20) { + if (x == 5) + continue + printf "%d ", x + x++ + } + print "" + } + +This program loops forever once `x' reaches 5. + + The `continue' statement has no meaning when used outside the body of +a loop. Historical versions of `awk' treated a `continue' statement +outside a loop the same way they treated a `break' statement outside a +loop: as if it were a `next' statement (*note Next Statement::). +Recent versions of Unix `awk' no longer work this way, and `gawk' +allows it only if `--traditional' is specified on the command line +(*note Options::). Just like the `break' statement, the POSIX standard +specifies that `continue' should only be used inside the body of a loop. +(d.c.) + + +File: gawk.info, Node: Next Statement, Next: Nextfile Statement, Prev: Continue Statement, Up: Statements + +6.4.8 The `next' Statement +-------------------------- + +The `next' statement forces `awk' to immediately stop processing the +current record and go on to the next record. This means that no +further rules are executed for the current record, and the rest of the +current rule's action isn't executed. + + Contrast this with the effect of the `getline' function (*note +Getline::). That also causes `awk' to read the next record +immediately, but it does not alter the flow of control in any way +(i.e., the rest of the current action executes with a new input record). + + At the highest level, `awk' program execution is a loop that reads +an input record and then tests each rule's pattern against it. If you +think of this loop as a `for' statement whose body contains the rules, +then the `next' statement is analogous to a `continue' statement. It +skips to the end of the body of this implicit loop and executes the +increment (which reads another record). + + For example, suppose an `awk' program works only on records with +four fields, and it shouldn't fail when given bad input. To avoid +complicating the rest of the program, write a "weed out" rule near the +beginning, in the following manner: + + NF != 4 { + err = sprintf("%s:%d: skipped: NF != 4\n", FILENAME, FNR) + print err > "/dev/stderr" + next + } + +Because of the `next' statement, the program's subsequent rules won't +see the bad record. The error message is redirected to the standard +error output stream, as error messages should be. For more detail see +*note Special Files::. + + According to the POSIX standard, the behavior is undefined if the +`next' statement is used in a `BEGIN' or `END' rule. `gawk' treats it +as a syntax error. Although POSIX permits it, some other `awk' +implementations don't allow the `next' statement inside function bodies +(*note User-defined::). Just as with any other `next' statement, a +`next' statement inside a function body reads the next record and +starts processing it with the first rule in the program. If the `next' +statement causes the end of the input to be reached, then the code in +any `END' rules is executed. *Note BEGIN/END::. + + +File: gawk.info, Node: Nextfile Statement, Next: Exit Statement, Prev: Next Statement, Up: Statements + +6.4.9 Using `gawk''s `nextfile' Statement +----------------------------------------- + +`gawk' provides the `nextfile' statement, which is similar to the +`next' statement. However, instead of abandoning processing of the +current record, the `nextfile' statement instructs `gawk' to stop +processing the current data file. + + The `nextfile' statement is a `gawk' extension. In most other `awk' +implementations, or if `gawk' is in compatibility mode (*note +Options::), `nextfile' is not special. + + Upon execution of the `nextfile' statement, `FILENAME' is updated to +the name of the next data file listed on the command line, `FNR' is +reset to one, `ARGIND' is incremented, and processing starts over with +the first rule in the program. (`ARGIND' hasn't been introduced yet. +*Note Built-in Variables::.) If the `nextfile' statement causes the +end of the input to be reached, then the code in any `END' rules is +executed. *Note BEGIN/END::. + + The `nextfile' statement is useful when there are many data files to +process but it isn't necessary to process every record in every file. +Normally, in order to move on to the next data file, a program has to +continue scanning the unwanted records. The `nextfile' statement +accomplishes this much more efficiently. + + While one might think that `close(FILENAME)' would accomplish the +same as `nextfile', this isn't true. `close' is reserved for closing +files, pipes, and coprocesses that are opened with redirections. It is +not related to the main processing that `awk' does with the files +listed in `ARGV'. + + If it's necessary to use an `awk' version that doesn't support +`nextfile', see *note Nextfile Function::, for a user-defined function +that simulates the `nextfile' statement. + + The current version of the Bell Laboratories `awk' (*note Other +Versions::) also supports `nextfile'. However, it doesn't allow the +`nextfile' statement inside function bodies (*note User-defined::). +`gawk' does; a `nextfile' inside a function body reads the next record +and starts processing it with the first rule in the program, just as +any other `nextfile' statement. + + *Caution:* Versions of `gawk' prior to 3.0 used two words (`next +file') for the `nextfile' statement. In version 3.0, this was changed +to one word, because the treatment of `file' was inconsistent. When it +appeared after `next', `file' was a keyword; otherwise, it was a +regular identifier. The old usage is no longer accepted; `next file' +generates a syntax error. + + +File: gawk.info, Node: Exit Statement, Prev: Nextfile Statement, Up: Statements + +6.4.10 The `exit' Statement +--------------------------- + +The `exit' statement causes `awk' to immediately stop executing the +current rule and to stop processing input; any remaining input is +ignored. The `exit' statement is written as follows: + + exit [RETURN CODE] + + When an `exit' statement is executed from a `BEGIN' rule, the +program stops processing everything immediately. No input records are +read. However, if an `END' rule is present, as part of executing the +`exit' statement, the `END' rule is executed (*note BEGIN/END::). If +`exit' is used as part of an `END' rule, it causes the program to stop +immediately. + + An `exit' statement that is not part of a `BEGIN' or `END' rule +stops the execution of any further automatic rules for the current +record, skips reading any remaining input records, and executes the +`END' rule if there is one. + + In such a case, if you don't want the `END' rule to do its job, set +a variable to nonzero before the `exit' statement and check that +variable in the `END' rule. *Note Assert Function::, for an example +that does this. + + If an argument is supplied to `exit', its value is used as the exit +status code for the `awk' process. If no argument is supplied, `exit' +returns status zero (success). In the case where an argument is +supplied to a first `exit' statement, and then `exit' is called a +second time from an `END' rule with no argument, `awk' uses the +previously supplied exit value. (d.c.) + + For example, suppose an error condition occurs that is difficult or +impossible to handle. Conventionally, programs report this by exiting +with a nonzero status. An `awk' program can do this using an `exit' +statement with a nonzero argument, as shown in the following example: + + BEGIN { + if (("date" | getline date_now) <= 0) { + print "Can't get system date" > "/dev/stderr" + exit 1 + } + print "current date is", date_now + close("date") + } + + +File: gawk.info, Node: Built-in Variables, Prev: Statements, Up: Patterns and Actions + +6.5 Built-in Variables +====================== + +Most `awk' variables are available to use for your own purposes; they +never change unless your program assigns values to them, and they never +affect anything unless your program examines them. However, a few +variables in `awk' have special built-in meanings. `awk' examines some +of these automatically, so that they enable you to tell `awk' how to do +certain things. Others are set automatically by `awk', so that they +carry information from the internal workings of `awk' to your program. + + This minor node documents all the built-in variables of `gawk', most +of which are also documented in the chapters describing their areas of +activity. + +* Menu: + +* User-modified:: Built-in variables that you change to control + `awk'. +* Auto-set:: Built-in variables where `awk' gives + you information. +* ARGC and ARGV:: Ways to use `ARGC' and `ARGV'. + + +File: gawk.info, Node: User-modified, Next: Auto-set, Up: Built-in Variables + +6.5.1 Built-in Variables That Control `awk' +------------------------------------------- + +The following is an alphabetical list of variables that you can change +to control how `awk' does certain things. The variables that are +specific to `gawk' are marked with a pound sign (`#'). + +`BINMODE #' + On non-POSIX systems, this variable specifies use of binary mode + for all I/O. Numeric values of one, two, or three specify that + input files, output files, or all files, respectively, should use + binary I/O. Alternatively, string values of `"r"' or `"w"' + specify that input files and output files, respectively, should + use binary I/O. A string value of `"rw"' or `"wr"' indicates that + all files should use binary I/O. Any other string value is + equivalent to `"rw"', but `gawk' generates a warning message. + `BINMODE' is described in more detail in *note PC Using::. + + This variable is a `gawk' extension. In other `awk' + implementations (except `mawk', *note Other Versions::), or if + `gawk' is in compatibility mode (*note Options::), it is not + special. + +`CONVFMT' + This string controls conversion of numbers to strings (*note + Conversion::). It works by being passed, in effect, as the first + argument to the `sprintf' function (*note String Functions::). + Its default value is `"%.6g"'. `CONVFMT' was introduced by the + POSIX standard. + +`FIELDWIDTHS #' + This is a space-separated list of columns that tells `gawk' how to + split input with fixed columnar boundaries. Assigning a value to + `FIELDWIDTHS' overrides the use of `FS' for field splitting. + *Note Constant Size::, for more information. + + If `gawk' is in compatibility mode (*note Options::), then + `FIELDWIDTHS' has no special meaning, and field-splitting + operations occur based exclusively on the value of `FS'. + +`FS' + This is the input field separator (*note Field Separators::). The + value is a single-character string or a multi-character regular + expression that matches the separations between fields in an input + record. If the value is the null string (`""'), then each + character in the record becomes a separate field. (This behavior + is a `gawk' extension. POSIX `awk' does not specify the behavior + when `FS' is the null string.) + + The default value is `" "', a string consisting of a single space. + As a special exception, this value means that any sequence of + spaces, tabs, and/or newlines is a single separator.(1) It also + causes spaces, tabs, and newlines at the beginning and end of a + record to be ignored. + + You can set the value of `FS' on the command line using the `-F' + option: + + awk -F, 'PROGRAM' INPUT-FILES + + If `gawk' is using `FIELDWIDTHS' for field splitting, assigning a + value to `FS' causes `gawk' to return to the normal, `FS'-based + field splitting. An easy way to do this is to simply say `FS = + FS', perhaps with an explanatory comment. + +`IGNORECASE #' + If `IGNORECASE' is nonzero or non-null, then all string comparisons + and all regular expression matching are case independent. Thus, + regexp matching with `~' and `!~', as well as the `gensub', + `gsub', `index', `match', `split', and `sub' functions, record + termination with `RS', and field splitting with `FS', all ignore + case when doing their particular regexp operations. However, the + value of `IGNORECASE' does _not_ affect array subscripting and it + does not affect field splitting when using a single-character + field separator. *Note Case-sensitivity::. + + If `gawk' is in compatibility mode (*note Options::), then + `IGNORECASE' has no special meaning. Thus, string and regexp + operations are always case-sensitive. + +`LINT #' + When this variable is true (nonzero or non-null), `gawk' behaves + as if the `--lint' command-line option is in effect. (*note + Options::). With a value of `"fatal"', lint warnings become fatal + errors. With a value of `"invalid"', only warnings about things + that are actually invalid are issued. (This is not fully + implemented yet.) Any other true value prints nonfatal warnings. + Assigning a false value to `LINT' turns off the lint warnings. + + This variable is a `gawk' extension. It is not special in other + `awk' implementations. Unlike the other special variables, + changing `LINT' does affect the production of lint warnings, even + if `gawk' is in compatibility mode. Much as the `--lint' and + `--traditional' options independently control different aspects of + `gawk''s behavior, the control of lint warnings during program + execution is independent of the flavor of `awk' being executed. + +`OFMT' + This string controls conversion of numbers to strings (*note + Conversion::) for printing with the `print' statement. It works + by being passed as the first argument to the `sprintf' function + (*note String Functions::). Its default value is `"%.6g"'. + Earlier versions of `awk' also used `OFMT' to specify the format + for converting numbers to strings in general expressions; this is + now done by `CONVFMT'. + +`OFS' + This is the output field separator (*note Output Separators::). + It is output between the fields printed by a `print' statement. + Its default value is `" "', a string consisting of a single space. + +`ORS' + This is the output record separator. It is output at the end of + every `print' statement. Its default value is `"\n"', the newline + character. (*Note Output Separators::.) + +`RS' + This is `awk''s input record separator. Its default value is a + string containing a single newline character, which means that an + input record consists of a single line of text. It can also be + the null string, in which case records are separated by runs of + blank lines. If it is a regexp, records are separated by matches + of the regexp in the input text. (*Note Records::.) + + The ability for `RS' to be a regular expression is a `gawk' + extension. In most other `awk' implementations, or if `gawk' is + in compatibility mode (*note Options::), just the first character + of `RS''s value is used. + +`SUBSEP' + This is the subscript separator. It has the default value of + `"\034"' and is used to separate the parts of the indices of a + multidimensional array. Thus, the expression `foo["A", "B"]' + really accesses `foo["A\034B"]' (*note Multi-dimensional::). + +`TEXTDOMAIN #' + This variable is used for internationalization of programs at the + `awk' level. It sets the default text domain for specially marked + string constants in the source text, as well as for the + `dcgettext', `dcngettext' and `bindtextdomain' functions (*note + Internationalization::). The default value of `TEXTDOMAIN' is + `"messages"'. + + This variable is a `gawk' extension. In other `awk' + implementations, or if `gawk' is in compatibility mode (*note + Options::), it is not special. + + ---------- Footnotes ---------- + + (1) In POSIX `awk', newline does not count as whitespace. + + +File: gawk.info, Node: Auto-set, Next: ARGC and ARGV, Prev: User-modified, Up: Built-in Variables + +6.5.2 Built-in Variables That Convey Information +------------------------------------------------ + +The following is an alphabetical list of variables that `awk' sets +automatically on certain occasions in order to provide information to +your program. The variables that are specific to `gawk' are marked +with a pound sign (`#'). + +`ARGC, ARGV' + The command-line arguments available to `awk' programs are stored + in an array called `ARGV'. `ARGC' is the number of command-line + arguments present. *Note Other Arguments::. Unlike most `awk' + arrays, `ARGV' is indexed from 0 to `ARGC' - 1. In the following + example: + + $ awk 'BEGIN { + > for (i = 0; i < ARGC; i++) + > print ARGV[i] + > }' inventory-shipped BBS-list + -| awk + -| inventory-shipped + -| BBS-list + + `ARGV[0]' contains `"awk"', `ARGV[1]' contains + `"inventory-shipped"', and `ARGV[2]' contains `"BBS-list"'. The + value of `ARGC' is three, one more than the index of the last + element in `ARGV', because the elements are numbered from zero. + + The names `ARGC' and `ARGV', as well as the convention of indexing + the array from 0 to `ARGC' - 1, are derived from the C language's + method of accessing command-line arguments. + + The value of `ARGV[0]' can vary from system to system. Also, you + should note that the program text is _not_ included in `ARGV', nor + are any of `awk''s command-line options. *Note ARGC and ARGV::, + for information about how `awk' uses these variables. + +`ARGIND #' + The index in `ARGV' of the current file being processed. Every + time `gawk' opens a new data file for processing, it sets `ARGIND' + to the index in `ARGV' of the file name. When `gawk' is + processing the input files, `FILENAME == ARGV[ARGIND]' is always + true. + + This variable is useful in file processing; it allows you to tell + how far along you are in the list of data files as well as to + distinguish between successive instances of the same file name on + the command line. + + While you can change the value of `ARGIND' within your `awk' + program, `gawk' automatically sets it to a new value when the next + file is opened. + + This variable is a `gawk' extension. In other `awk' + implementations, or if `gawk' is in compatibility mode (*note + Options::), it is not special. + +`ENVIRON' + An associative array that contains the values of the environment. + The array indices are the environment variable names; the elements + are the values of the particular environment variables. For + example, `ENVIRON["HOME"]' might be `/home/arnold'. Changing this + array does not affect the environment passed on to any programs + that `awk' may spawn via redirection or the `system' function. + + Some operating systems may not have environment variables. On + such systems, the `ENVIRON' array is empty (except for + `ENVIRON["AWKPATH"]', *note AWKPATH Variable::). + +`ERRNO #' + If a system error occurs during a redirection for `getline', + during a read for `getline', or during a `close' operation, then + `ERRNO' contains a string describing the error. + + `ERRNO' works similarly to the C variable `errno'. In particular + `gawk' _never_ clears it (sets it to zero or `""'). Thus, you + should only expect its value to be meaningful when an I/O + operation returns a failure value, such as `getline' returning -1. + You are, of course, free to clear it yourself before doing an I/O + operation. + + This variable is a `gawk' extension. In other `awk' + implementations, or if `gawk' is in compatibility mode (*note + Options::), it is not special. + +`FILENAME' + The name of the file that `awk' is currently reading. When no + data files are listed on the command line, `awk' reads from the + standard input and `FILENAME' is set to `"-"'. `FILENAME' is + changed each time a new file is read (*note Reading Files::). + Inside a `BEGIN' rule, the value of `FILENAME' is `""', since + there are no input files being processed yet.(1) (d.c.) Note, + though, that using `getline' (*note Getline::) inside a `BEGIN' + rule can give `FILENAME' a value. + +`FNR' + The current record number in the current file. `FNR' is + incremented each time a new record is read (*note Getline::). It + is reinitialized to zero each time a new input file is started. + +`NF' + The number of fields in the current input record. `NF' is set + each time a new record is read, when a new field is created or + when `$0' changes (*note Fields::). + + Unlike most of the variables described in this node, assigning a + value to `NF' has the potential to affect `awk''s internal + workings. In particular, assignments to `NF' can be used to + create or remove fields from the current record: *Note Changing + Fields::. + +`NR' + The number of input records `awk' has processed since the + beginning of the program's execution (*note Records::). `NR' is + incremented each time a new record is read. + +`PROCINFO #' + The elements of this array provide access to information about the + running `awk' program. The following elements (listed + alphabetically) are guaranteed to be available: + + `PROCINFO["egid"]' + The value of the `getegid' system call. + + `PROCINFO["euid"]' + The value of the `geteuid' system call. + + `PROCINFO["FS"]' + This is `"FS"' if field splitting with `FS' is in effect, or + it is `"FIELDWIDTHS"' if field splitting with `FIELDWIDTHS' + is in effect. + + `PROCINFO["gid"]' + The value of the `getgid' system call. + + `PROCINFO["pgrpid"]' + The process group ID of the current process. + + `PROCINFO["pid"]' + The process ID of the current process. + + `PROCINFO["ppid"]' + The parent process ID of the current process. + + `PROCINFO["uid"]' + The value of the `getuid' system call. + + `PROCINFO["version"]' + The version of `gawk'. This is available from version 3.1.4 + and later. + + On some systems, there may be elements in the array, `"group1"' + through `"groupN"' for some N. N is the number of supplementary + groups that the process has. Use the `in' operator to test for + these elements (*note Reference to Elements::). + + This array is a `gawk' extension. In other `awk' implementations, + or if `gawk' is in compatibility mode (*note Options::), it is not + special. + +`RLENGTH' + The length of the substring matched by the `match' function (*note + String Functions::). `RLENGTH' is set by invoking the `match' + function. Its value is the length of the matched string, or -1 if + no match is found. + +`RSTART' + The start-index in characters of the substring that is matched by + the `match' function (*note String Functions::). `RSTART' is set + by invoking the `match' function. Its value is the position of + the string where the matched substring starts, or zero if no match + was found. + +`RT #' + This is set each time a record is read. It contains the input text + that matched the text denoted by `RS', the record separator. + + This variable is a `gawk' extension. In other `awk' + implementations, or if `gawk' is in compatibility mode (*note + Options::), it is not special. + +Advanced Notes: Changing `NR' and `FNR' +--------------------------------------- + +`awk' increments `NR' and `FNR' each time it reads a record, instead of +setting them to the absolute value of the number of records read. This +means that a program can change these variables and their new values +are incremented for each record. (d.c.) This is demonstrated in the +following example: + + $ echo '1 + > 2 + > 3 + > 4' | awk 'NR == 2 { NR = 17 } + > { print NR }' + -| 1 + -| 17 + -| 18 + -| 19 + +Before `FNR' was added to the `awk' language (*note V7/SVR3.1::), many +`awk' programs used this feature to track the number of records in a +file by resetting `NR' to zero when `FILENAME' changed. + + ---------- Footnotes ---------- + + (1) Some early implementations of Unix `awk' initialized `FILENAME' +to `"-"', even if there were data files to be processed. This behavior +was incorrect and should not be relied upon in your programs. + + +File: gawk.info, Node: ARGC and ARGV, Prev: Auto-set, Up: Built-in Variables + +6.5.3 Using `ARGC' and `ARGV' +----------------------------- + +*note Auto-set::, presented the following program describing the +information contained in `ARGC' and `ARGV': + + $ awk 'BEGIN { + > for (i = 0; i < ARGC; i++) + > print ARGV[i] + > }' inventory-shipped BBS-list + -| awk + -| inventory-shipped + -| BBS-list + +In this example, `ARGV[0]' contains `awk', `ARGV[1]' contains +`inventory-shipped', and `ARGV[2]' contains `BBS-list'. Notice that +the `awk' program is not entered in `ARGV'. The other special +command-line options, with their arguments, are also not entered. This +includes variable assignments done with the `-v' option (*note +Options::). Normal variable assignments on the command line _are_ +treated as arguments and do show up in the `ARGV' array: + + $ cat showargs.awk + -| BEGIN { + -| printf "A=%d, B=%d\n", A, B + -| for (i = 0; i < ARGC; i++) + -| printf "\tARGV[%d] = %s\n", i, ARGV[i] + -| } + -| END { printf "A=%d, B=%d\n", A, B } + $ awk -v A=1 -f showargs.awk B=2 /dev/null + -| A=1, B=0 + -| ARGV[0] = awk + -| ARGV[1] = B=2 + -| ARGV[2] = /dev/null + -| A=1, B=2 + + A program can alter `ARGC' and the elements of `ARGV'. Each time +`awk' reaches the end of an input file, it uses the next element of +`ARGV' as the name of the next input file. By storing a different +string there, a program can change which files are read. Use `"-"' to +represent the standard input. Storing additional elements and +incrementing `ARGC' causes additional files to be read. + + If the value of `ARGC' is decreased, that eliminates input files +from the end of the list. By recording the old value of `ARGC' +elsewhere, a program can treat the eliminated arguments as something +other than file names. + + To eliminate a file from the middle of the list, store the null +string (`""') into `ARGV' in place of the file's name. As a special +feature, `awk' ignores file names that have been replaced with the null +string. Another option is to use the `delete' statement to remove +elements from `ARGV' (*note Delete::). + + All of these actions are typically done in the `BEGIN' rule, before +actual processing of the input begins. *Note Split Program::, and see +*note Tee Program::, for examples of each way of removing elements from +`ARGV'. The following fragment processes `ARGV' in order to examine, +and then remove, command-line options: + + BEGIN { + for (i = 1; i < ARGC; i++) { + if (ARGV[i] == "-v") + verbose = 1 + else if (ARGV[i] == "-d") + debug = 1 + else if (ARGV[i] ~ /^-./) { + e = sprintf("%s: unrecognized option -- %c", + ARGV[0], substr(ARGV[i], 2, 1)) + print e > "/dev/stderr" + } else + break + delete ARGV[i] + } + } + + To actually get the options into the `awk' program, end the `awk' +options with `--' and then supply the `awk' program's options, in the +following manner: + + awk -f myprog -- -v -d file1 file2 ... + + This is not necessary in `gawk'. Unless `--posix' has been +specified, `gawk' silently puts any unrecognized options into `ARGV' +for the `awk' program to deal with. As soon as it sees an unknown +option, `gawk' stops looking for other options that it might otherwise +recognize. The previous example with `gawk' would be: + + gawk -f myprog -d -v file1 file2 ... + +Because `-d' is not a valid `gawk' option, it and the following `-v' +are passed on to the `awk' program. + + +File: gawk.info, Node: Arrays, Next: Functions, Prev: Patterns and Actions, Up: Top + +7 Arrays in `awk' +***************** + +An "array" is a table of values called "elements". The elements of an +array are distinguished by their indices. "Indices" may be either +numbers or strings. + + This major node describes how arrays work in `awk', how to use array +elements, how to scan through every element in an array, and how to +remove array elements. It also describes how `awk' simulates +multidimensional arrays, as well as some of the less obvious points +about array usage. The major node finishes with a discussion of +`gawk''s facility for sorting an array based on its indices. + + `awk' maintains a single set of names that may be used for naming +variables, arrays, and functions (*note User-defined::). Thus, you +cannot have a variable and an array with the same name in the same +`awk' program. + +* Menu: + +* Array Intro:: Introduction to Arrays +* Reference to Elements:: How to examine one element of an array. +* Assigning Elements:: How to change an element of an array. +* Array Example:: Basic Example of an Array +* Scanning an Array:: A variation of the `for' statement. It + loops through the indices of an array's + existing elements. +* Delete:: The `delete' statement removes an element + from an array. +* Numeric Array Subscripts:: How to use numbers as subscripts in + `awk'. +* Uninitialized Subscripts:: Using Uninitialized variables as subscripts. +* Multi-dimensional:: Emulating multidimensional arrays in + `awk'. +* Multi-scanning:: Scanning multidimensional arrays. +* Array Sorting:: Sorting array values and indices. + + +File: gawk.info, Node: Array Intro, Next: Reference to Elements, Up: Arrays + +7.1 Introduction to Arrays +========================== + +The `awk' language provides one-dimensional arrays for storing groups +of related strings or numbers. Every `awk' array must have a name. +Array names have the same syntax as variable names; any valid variable +name would also be a valid array name. But one name cannot be used in +both ways (as an array and as a variable) in the same `awk' program. + + Arrays in `awk' superficially resemble arrays in other programming +languages, but there are fundamental differences. In `awk', it isn't +necessary to specify the size of an array before starting to use it. +Additionally, any number or string in `awk', not just consecutive +integers, may be used as an array index. + + In most other languages, arrays must be "declared" before use, +including a specification of how many elements or components they +contain. In such languages, the declaration causes a contiguous block +of memory to be allocated for that many elements. Usually, an index in +the array must be a positive integer. For example, the index zero +specifies the first element in the array, which is actually stored at +the beginning of the block of memory. Index one specifies the second +element, which is stored in memory right after the first element, and +so on. It is impossible to add more elements to the array, because it +has room only for as many elements as given in the declaration. (Some +languages allow arbitrary starting and ending indices--e.g., `15 .. +27'--but the size of the array is still fixed when the array is +declared.) + + A contiguous array of four elements might look like the following +example, conceptually, if the element values are 8, `"foo"', `""', and +30: + + +---------+---------+--------+---------+ + | 8 | "foo" | "" | 30 | Value + +---------+---------+--------+---------+ + 0 1 2 3 Index + +Only the values are stored; the indices are implicit from the order of +the values. Here, 8 is the value at index zero, because 8 appears in the +position with zero elements before it. + + Arrays in `awk' are different--they are "associative". This means +that each array is a collection of pairs: an index and its corresponding +array element value: + + Element 3 Value 30 + Element 1 Value "foo" + Element 0 Value 8 + Element 2 Value "" + +The pairs are shown in jumbled order because their order is irrelevant. + + One advantage of associative arrays is that new pairs can be added +at any time. For example, suppose a tenth element is added to the array +whose value is `"number ten"'. The result is: + + Element 10 Value "number ten" + Element 3 Value 30 + Element 1 Value "foo" + Element 0 Value 8 + Element 2 Value "" + +Now the array is "sparse", which just means some indices are missing. +It has elements 0-3 and 10, but doesn't have elements 4, 5, 6, 7, 8, or +9. + + Another consequence of associative arrays is that the indices don't +have to be positive integers. Any number, or even a string, can be an +index. For example, the following is an array that translates words +from English to French: + + Element "dog" Value "chien" + Element "cat" Value "chat" + Element "one" Value "un" + Element 1 Value "un" + +Here we decided to translate the number one in both spelled-out and +numeric form--thus illustrating that a single array can have both +numbers and strings as indices. In fact, array subscripts are always +strings; this is discussed in more detail in *note Numeric Array +Subscripts::. Here, the number `1' isn't double-quoted, since `awk' +automatically converts it to a string. + + The value of `IGNORECASE' has no effect upon array subscripting. +The identical string value used to store an array element must be used +to retrieve it. When `awk' creates an array (e.g., with the `split' +built-in function), that array's indices are consecutive integers +starting at one. (*Note String Functions::.) + + `awk''s arrays are efficient--the time to access an element is +independent of the number of elements in the array. + + +File: gawk.info, Node: Reference to Elements, Next: Assigning Elements, Prev: Array Intro, Up: Arrays + +7.2 Referring to an Array Element +================================= + +The principal way to use an array is to refer to one of its elements. +An array reference is an expression as follows: + + ARRAY[INDEX] + +Here, ARRAY is the name of an array. The expression INDEX is the index +of the desired element of the array. + + The value of the array reference is the current value of that array +element. For example, `foo[4.3]' is an expression for the element of +array `foo' at index `4.3'. + + A reference to an array element that has no recorded value yields a +value of `""', the null string. This includes elements that have not +been assigned any value as well as elements that have been deleted +(*note Delete::). Such a reference automatically creates that array +element, with the null string as its value. (In some cases, this is +unfortunate, because it might waste memory inside `awk'.) + + To determine whether an element exists in an array at a certain +index, use the following expression: + + INDEX in ARRAY + +This expression tests whether the particular index exists, without the +side effect of creating that element if it is not present. The +expression has the value one (true) if `ARRAY[INDEX]' exists and zero +(false) if it does not exist. For example, this statement tests +whether the array `frequencies' contains the index `2': + + if (2 in frequencies) + print "Subscript 2 is present." + + Note that this is _not_ a test of whether the array `frequencies' +contains an element whose _value_ is two. There is no way to do that +except to scan all the elements. Also, this _does not_ create +`frequencies[2]', while the following (incorrect) alternative does: + + if (frequencies[2] != "") + print "Subscript 2 is present." + + +File: gawk.info, Node: Assigning Elements, Next: Array Example, Prev: Reference to Elements, Up: Arrays + +7.3 Assigning Array Elements +============================ + +Array elements can be assigned values just like `awk' variables: + + ARRAY[SUBSCRIPT] = VALUE + +ARRAY is the name of an array. The expression SUBSCRIPT is the index +of the element of the array that is assigned a value. The expression +VALUE is the value to assign to that element of the array. + + +File: gawk.info, Node: Array Example, Next: Scanning an Array, Prev: Assigning Elements, Up: Arrays + +7.4 Basic Array Example +======================= + +The following program takes a list of lines, each beginning with a line +number, and prints them out in order of line number. The line numbers +are not in order when they are first read--instead they are scrambled. +This program sorts the lines by making an array using the line numbers +as subscripts. The program then prints out the lines in sorted order +of their numbers. It is a very simple program and gets confused upon +encountering repeated numbers, gaps, or lines that don't begin with a +number: + + { + if ($1 > max) + max = $1 + arr[$1] = $0 + } + + END { + for (x = 1; x <= max; x++) + print arr[x] + } + + The first rule keeps track of the largest line number seen so far; +it also stores each line into the array `arr', at an index that is the +line's number. The second rule runs after all the input has been read, +to print out all the lines. When this program is run with the +following input: + + 5 I am the Five man + 2 Who are you? The new number two! + 4 . . . And four on the floor + 1 Who is number one? + 3 I three you. + +Its output is: + + 1 Who is number one? + 2 Who are you? The new number two! + 3 I three you. + 4 . . . And four on the floor + 5 I am the Five man + + If a line number is repeated, the last line with a given number +overrides the others. Gaps in the line numbers can be handled with an +easy improvement to the program's `END' rule, as follows: + + END { + for (x = 1; x <= max; x++) + if (x in arr) + print arr[x] + } + + +File: gawk.info, Node: Scanning an Array, Next: Delete, Prev: Array Example, Up: Arrays + +7.5 Scanning All Elements of an Array +===================================== + +In programs that use arrays, it is often necessary to use a loop that +executes once for each element of an array. In other languages, where +arrays are contiguous and indices are limited to positive integers, +this is easy: all the valid indices can be found by counting from the +lowest index up to the highest. This technique won't do the job in +`awk', because any number or string can be an array index. So `awk' +has a special kind of `for' statement for scanning an array: + + for (VAR in ARRAY) + BODY + +This loop executes BODY once for each index in ARRAY that the program +has previously used, with the variable VAR set to that index. + + The following program uses this form of the `for' statement. The +first rule scans the input records and notes which words appear (at +least once) in the input, by storing a one into the array `used' with +the word as index. The second rule scans the elements of `used' to +find all the distinct words that appear in the input. It prints each +word that is more than 10 characters long and also prints the number of +such words. *Note String Functions::, for more information on the +built-in function `length'. + + # Record a 1 for each word that is used at least once + { + for (i = 1; i <= NF; i++) + used[$i] = 1 + } + + # Find number of distinct words more than 10 characters long + END { + for (x in used) + if (length(x) > 10) { + ++num_long_words + print x + } + print num_long_words, "words longer than 10 characters" + } + +*Note Word Sorting::, for a more detailed example of this type. + + The order in which elements of the array are accessed by this +statement is determined by the internal arrangement of the array +elements within `awk' and cannot be controlled or changed. This can +lead to problems if new elements are added to ARRAY by statements in +the loop body; it is not predictable whether the `for' loop will reach +them. Similarly, changing VAR inside the loop may produce strange +results. It is best to avoid such things. + + +File: gawk.info, Node: Delete, Next: Numeric Array Subscripts, Prev: Scanning an Array, Up: Arrays + +7.6 The `delete' Statement +========================== + +To remove an individual element of an array, use the `delete' statement: + + delete ARRAY[INDEX] + + Once an array element has been deleted, any value the element once +had is no longer available. It is as if the element had never been +referred to or had been given a value. The following is an example of +deleting elements in an array: + + for (i in frequencies) + delete frequencies[i] + +This example removes all the elements from the array `frequencies'. +Once an element is deleted, a subsequent `for' statement to scan the +array does not report that element and the `in' operator to check for +the presence of that element returns zero (i.e., false): + + delete foo[4] + if (4 in foo) + print "This will never be printed" + + It is important to note that deleting an element is _not_ the same +as assigning it a null value (the empty string, `""'). For example: + + foo[4] = "" + if (4 in foo) + print "This is printed, even though foo[4] is empty" + + It is not an error to delete an element that does not exist. If +`--lint' is provided on the command line (*note Options::), `gawk' +issues a warning message when an element that is not in the array is +deleted. + + All the elements of an array may be deleted with a single statement +by leaving off the subscript in the `delete' statement, as follows: + + delete ARRAY + + This ability is a `gawk' extension; it is not available in +compatibility mode (*note Options::). + + Using this version of the `delete' statement is about three times +more efficient than the equivalent loop that deletes each element one +at a time. + + The following statement provides a portable but nonobvious way to +clear out an array:(1) + + split("", array) + + The `split' function (*note String Functions::) clears out the +target array first. This call asks it to split apart the null string. +Because there is no data to split out, the function simply clears the +array and then returns. + + *Caution:* Deleting an array does not change its type; you cannot +delete an array and then use the array's name as a scalar (i.e., a +regular variable). For example, the following does not work: + + a[1] = 3; delete a; a = 3 + + ---------- Footnotes ---------- + + (1) Thanks to Michael Brennan for pointing this out. + + +File: gawk.info, Node: Numeric Array Subscripts, Next: Uninitialized Subscripts, Prev: Delete, Up: Arrays + +7.7 Using Numbers to Subscript Arrays +===================================== + +An important aspect about arrays to remember is that _array subscripts +are always strings_. When a numeric value is used as a subscript, it +is converted to a string value before being used for subscripting +(*note Conversion::). This means that the value of the built-in +variable `CONVFMT' can affect how your program accesses elements of an +array. For example: + + xyz = 12.153 + data[xyz] = 1 + CONVFMT = "%2.2f" + if (xyz in data) + printf "%s is in data\n", xyz + else + printf "%s is not in data\n", xyz + +This prints `12.15 is not in data'. The first statement gives `xyz' a +numeric value. Assigning to `data[xyz]' subscripts `data' with the +string value `"12.153"' (using the default conversion value of +`CONVFMT', `"%.6g"'). Thus, the array element `data["12.153"]' is +assigned the value one. The program then changes the value of +`CONVFMT'. The test `(xyz in data)' generates a new string value from +`xyz'--this time `"12.15"'--because the value of `CONVFMT' only allows +two significant digits. This test fails, since `"12.15"' is a +different string from `"12.153"'. + + According to the rules for conversions (*note Conversion::), integer +values are always converted to strings as integers, no matter what the +value of `CONVFMT' may happen to be. So the usual case of the +following works: + + for (i = 1; i <= maxsub; i++) + do something with array[i] + + The "integer values always convert to strings as integers" rule has +an additional consequence for array indexing. Octal and hexadecimal +constants (*note Nondecimal-numbers::) are converted internally into +numbers, and their original form is forgotten. This means, for +example, that `array[17]', `array[021]', and `array[0x11]' all refer to +the same element! + + As with many things in `awk', the majority of the time things work +as one would expect them to. But it is useful to have a precise +knowledge of the actual rules which sometimes can have a subtle effect +on your programs. + + +File: gawk.info, Node: Uninitialized Subscripts, Next: Multi-dimensional, Prev: Numeric Array Subscripts, Up: Arrays + +7.8 Using Uninitialized Variables as Subscripts +=============================================== + +Suppose it's necessary to write a program to print the input data in +reverse order. A reasonable attempt to do so (with some test data) +might look like this: + + $ echo 'line 1 + > line 2 + > line 3' | awk '{ l[lines] = $0; ++lines } + > END { + > for (i = lines-1; i >= 0; --i) + > print l[i] + > }' + -| line 3 + -| line 2 + + Unfortunately, the very first line of input data did not come out in +the output! + + At first glance, this program should have worked. The variable +`lines' is uninitialized, and uninitialized variables have the numeric +value zero. So, `awk' should have printed the value of `l[0]'. + + The issue here is that subscripts for `awk' arrays are _always_ +strings. Uninitialized variables, when used as strings, have the value +`""', not zero. Thus, `line 1' ends up stored in `l[""]'. The +following version of the program works correctly: + + { l[lines++] = $0 } + END { + for (i = lines - 1; i >= 0; --i) + print l[i] + } + + Here, the `++' forces `lines' to be numeric, thus making the "old +value" numeric zero. This is then converted to `"0"' as the array +subscript. + + Even though it is somewhat unusual, the null string (`""') is a +valid array subscript. (d.c.) `gawk' warns about the use of the null +string as a subscript if `--lint' is provided on the command line +(*note Options::). + + +File: gawk.info, Node: Multi-dimensional, Next: Multi-scanning, Prev: Uninitialized Subscripts, Up: Arrays + +7.9 Multidimensional Arrays +=========================== + +A multidimensional array is an array in which an element is identified +by a sequence of indices instead of a single index. For example, a +two-dimensional array requires two indices. The usual way (in most +languages, including `awk') to refer to an element of a two-dimensional +array named `grid' is with `grid[X,Y]'. + + Multidimensional arrays are supported in `awk' through concatenation +of indices into one string. `awk' converts the indices into strings +(*note Conversion::) and concatenates them together, with a separator +between them. This creates a single string that describes the values +of the separate indices. The combined string is used as a single index +into an ordinary, one-dimensional array. The separator used is the +value of the built-in variable `SUBSEP'. + + For example, suppose we evaluate the expression `foo[5,12] = "value"' +when the value of `SUBSEP' is `"@"'. The numbers 5 and 12 are +converted to strings and concatenated with an `@' between them, +yielding `"5@12"'; thus, the array element `foo["5@12"]' is set to +`"value"'. + + Once the element's value is stored, `awk' has no record of whether +it was stored with a single index or a sequence of indices. The two +expressions `foo[5,12]' and `foo[5 SUBSEP 12]' are always equivalent. + + The default value of `SUBSEP' is the string `"\034"', which contains +a nonprinting character that is unlikely to appear in an `awk' program +or in most input data. The usefulness of choosing an unlikely +character comes from the fact that index values that contain a string +matching `SUBSEP' can lead to combined strings that are ambiguous. +Suppose that `SUBSEP' is `"@"'; then `foo["a@b", "c"]' and +`foo["a", "b@c"]' are indistinguishable because both are actually +stored as `foo["a@b@c"]'. + + To test whether a particular index sequence exists in a +multidimensional array, use the same operator (`in') that is used for +single dimensional arrays. Write the whole sequence of indices in +parentheses, separated by commas, as the left operand: + + (SUBSCRIPT1, SUBSCRIPT2, ...) in ARRAY + + The following example treats its input as a two-dimensional array of +fields; it rotates this array 90 degrees clockwise and prints the +result. It assumes that all lines have the same number of elements: + + { + if (max_nf < NF) + max_nf = NF + max_nr = NR + for (x = 1; x <= NF; x++) + vector[x, NR] = $x + } + + END { + for (x = 1; x <= max_nf; x++) { + for (y = max_nr; y >= 1; --y) + printf("%s ", vector[x, y]) + printf("\n") + } + } + +When given the input: + + 1 2 3 4 5 6 + 2 3 4 5 6 1 + 3 4 5 6 1 2 + 4 5 6 1 2 3 + +the program produces the following output: + + 4 3 2 1 + 5 4 3 2 + 6 5 4 3 + 1 6 5 4 + 2 1 6 5 + 3 2 1 6 + + +File: gawk.info, Node: Multi-scanning, Next: Array Sorting, Prev: Multi-dimensional, Up: Arrays + +7.10 Scanning Multidimensional Arrays +===================================== + +There is no special `for' statement for scanning a "multidimensional" +array. There cannot be one, because, in truth, there are no +multidimensional arrays or elements--there is only a multidimensional +_way of accessing_ an array. + + However, if your program has an array that is always accessed as +multidimensional, you can get the effect of scanning it by combining +the scanning `for' statement (*note Scanning an Array::) with the +built-in `split' function (*note String Functions::). It works in the +following manner: + + for (combined in array) { + split(combined, separate, SUBSEP) + ... + } + +This sets the variable `combined' to each concatenated combined index +in the array, and splits it into the individual indices by breaking it +apart where the value of `SUBSEP' appears. The individual indices then +become the elements of the array `separate'. + + Thus, if a value is previously stored in `array[1, "foo"]'; then an +element with index `"1\034foo"' exists in `array'. (Recall that the +default value of `SUBSEP' is the character with code 034.) Sooner or +later, the `for' statement finds that index and does an iteration with +the variable `combined' set to `"1\034foo"'. Then the `split' function +is called as follows: + + split("1\034foo", separate, "\034") + +The result is to set `separate[1]' to `"1"' and `separate[2]' to +`"foo"'. Presto! The original sequence of separate indices is +recovered. + + +File: gawk.info, Node: Array Sorting, Prev: Multi-scanning, Up: Arrays + +7.11 Sorting Array Values and Indices with `gawk' +================================================= + +The order in which an array is scanned with a `for (i in array)' loop +is essentially arbitrary. In most `awk' implementations, sorting an +array requires writing a `sort' function. While this can be +educational for exploring different sorting algorithms, usually that's +not the point of the program. `gawk' provides the built-in `asort' and +`asorti' functions (*note String Functions::) for sorting arrays. For +example: + + POPULATE THE ARRAY data + n = asort(data) + for (i = 1; i <= n; i++) + DO SOMETHING WITH data[i] + + After the call to `asort', the array `data' is indexed from 1 to +some number N, the total number of elements in `data'. (This count is +`asort''s return value.) `data[1]' <= `data[2]' <= `data[3]', and so +on. The comparison of array elements is done using `gawk''s usual +comparison rules (*note Typing and Comparison::). + + An important side effect of calling `asort' is that _the array's +original indices are irrevocably lost_. As this isn't always +desirable, `asort' accepts a second argument: + + POPULATE THE ARRAY source + n = asort(source, dest) + for (i = 1; i <= n; i++) + DO SOMETHING WITH dest[i] + + In this case, `gawk' copies the `source' array into the `dest' array +and then sorts `dest', destroying its indices. However, the `source' +array is not affected. + + Often, what's needed is to sort on the values of the _indices_ +instead of the values of the elements. To do that, starting with +`gawk' 3.1.2, use the `asorti' function. The interface is identical to +that of `asort', except that the index values are used for sorting, and +become the values of the result array: + + { source[$0] = some_func($0) } + + END { + n = asorti(source, dest) + for (i = 1; i <= n; i++) { + DO SOMETHING WITH dest[i] Work with sorted indices directly + ... + DO SOMETHING WITH source[dest[i]] Access original array via sorted indices + } + } + + If your version of `gawk' is 3.1.0 or 3.1.1, you don't have +`asorti'. Instead, use a helper array to hold the sorted index values, +and then access the original array's elements. It works in the +following way: + + POPULATE THE ARRAY data + # copy indices + j = 1 + for (i in data) { + ind[j] = i # index value becomes element value + j++ + } + n = asort(ind) # index values are now sorted + for (i = 1; i <= n; i++) { + DO SOMETHING WITH ind[i] Work with sorted indices directly + ... + DO SOMETHING WITH data[ind[i]] Access original array via sorted indices + } + + Sorting the array by replacing the indices provides maximal +flexibility. To traverse the elements in decreasing order, use a loop +that goes from N down to 1, either over the elements or over the +indices. + + Copying array indices and elements isn't expensive in terms of +memory. Internally, `gawk' maintains "reference counts" to data. For +example, when `asort' copies the first array to the second one, there +is only one copy of the original array elements' data, even though both +arrays use the values. Similarly, when copying the indices from `data' +to `ind', there is only one copy of the actual index strings. + + We said previously that comparisons are done using `gawk''s "usual +comparison rules." Because `IGNORECASE' affects string comparisons, +the value of `IGNORECASE' also affects sorting for both `asort' and +`asorti'. Caveat Emptor. + + +File: gawk.info, Node: Functions, Next: Internationalization, Prev: Arrays, Up: Top + +8 Functions +*********** + +This major node describes `awk''s built-in functions, which fall into +three categories: numeric, string, and I/O. `gawk' provides additional +groups of functions to work with values that represent time, do bit +manipulation, and internationalize and localize programs. + + Besides the built-in functions, `awk' has provisions for writing new +functions that the rest of a program can use. The second half of this +major node describes these "user-defined" functions. + +* Menu: + +* Built-in:: Summarizes the built-in functions. +* User-defined:: Describes User-defined functions in detail. + + +File: gawk.info, Node: Built-in, Next: User-defined, Up: Functions + +8.1 Built-in Functions +====================== + +"Built-in" functions are always available for your `awk' program to +call. This minor node defines all the built-in functions in `awk'; +some of these are mentioned in other sections but are summarized here +for your convenience. + +* Menu: + +* Calling Built-in:: How to call built-in functions. +* Numeric Functions:: Functions that work with numbers, including + `int', `sin' and `rand'. +* String Functions:: Functions for string manipulation, such as + `split', `match' and `sprintf'. +* I/O Functions:: Functions for files and shell commands. +* Time Functions:: Functions for dealing with timestamps. +* Bitwise Functions:: Functions for bitwise operations. +* I18N Functions:: Functions for string translation. + + +File: gawk.info, Node: Calling Built-in, Next: Numeric Functions, Up: Built-in + +8.1.1 Calling Built-in Functions +-------------------------------- + +To call one of `awk''s built-in functions, write the name of the +function followed by arguments in parentheses. For example, `atan2(y + +z, 1)' is a call to the function `atan2' and has two arguments. + + Whitespace is ignored between the built-in function name and the +open parenthesis, and it is good practice to avoid using whitespace +there. User-defined functions do not permit whitespace in this way, and +it is easier to avoid mistakes by following a simple convention that +always works--no whitespace after a function name. + + Each built-in function accepts a certain number of arguments. In +some cases, arguments can be omitted. The defaults for omitted +arguments vary from function to function and are described under the +individual functions. In some `awk' implementations, extra arguments +given to built-in functions are ignored. However, in `gawk', it is a +fatal error to give extra arguments to a built-in function. + + When a function is called, expressions that create the function's +actual parameters are evaluated completely before the call is performed. +For example, in the following code fragment: + + i = 4 + j = sqrt(i++) + +the variable `i' is incremented to the value five before `sqrt' is +called with a value of four for its actual parameter. The order of +evaluation of the expressions used for the function's parameters is +undefined. Thus, avoid writing programs that assume that parameters +are evaluated from left to right or from right to left. For example: + + i = 5 + j = atan2(i++, i *= 2) + + If the order of evaluation is left to right, then `i' first becomes +6, and then 12, and `atan2' is called with the two arguments 6 and 12. +But if the order of evaluation is right to left, `i' first becomes 10, +then 11, and `atan2' is called with the two arguments 11 and 10. + + +File: gawk.info, Node: Numeric Functions, Next: String Functions, Prev: Calling Built-in, Up: Built-in + +8.1.2 Numeric Functions +----------------------- + +The following list describes all of the built-in functions that work +with numbers. Optional parameters are enclosed in square +brackets ([ ]): + +`int(X)' + This returns the nearest integer to X, located between X and zero + and truncated toward zero. + + For example, `int(3)' is 3, `int(3.9)' is 3, `int(-3.9)' is -3, + and `int(-3)' is -3 as well. + +`sqrt(X)' + This returns the positive square root of X. `gawk' reports an + error if X is negative. Thus, `sqrt(4)' is 2. + +`exp(X)' + This returns the exponential of X (`e ^ X') or reports an error if + X is out of range. The range of values X can have depends on your + machine's floating-point representation. + +`log(X)' + This returns the natural logarithm of X, if X is positive; + otherwise, it reports an error. + +`sin(X)' + This returns the sine of X, with X in radians. + +`cos(X)' + This returns the cosine of X, with X in radians. + +`atan2(Y, X)' + This returns the arctangent of `Y / X' in radians. + +`rand()' + This returns a random number. The values of `rand' are uniformly + distributed between zero and one. The value could be zero but is + never one.(1) + + Often random integers are needed instead. Following is a + user-defined function that can be used to obtain a random + non-negative integer less than N: + + function randint(n) { + return int(n * rand()) + } + + The multiplication produces a random number greater than zero and + less than `n'. Using `int', this result is made into an integer + between zero and `n' - 1, inclusive. + + The following example uses a similar function to produce random + integers between one and N. This program prints a new random + number for each input record: + + # Function to roll a simulated die. + function roll(n) { return 1 + int(rand() * n) } + + # Roll 3 six-sided dice and + # print total number of points. + { + printf("%d points\n", + roll(6)+roll(6)+roll(6)) + } + + *Caution:* In most `awk' implementations, including `gawk', `rand' + starts generating numbers from the same starting number, or + "seed", each time you run `awk'. Thus, a program generates the + same results each time you run it. The numbers are random within + one `awk' run but predictable from run to run. This is convenient + for debugging, but if you want a program to do different things + each time it is used, you must change the seed to a value that is + different in each run. To do this, use `srand'. + +`srand([X])' + The function `srand' sets the starting point, or seed, for + generating random numbers to the value X. + + Each seed value leads to a particular sequence of random + numbers.(2) Thus, if the seed is set to the same value a second + time, the same sequence of random numbers is produced again. + + Different `awk' implementations use different random-number + generators internally. Don't expect the same `awk' program to + produce the same series of random numbers when executed by + different versions of `awk'. + + If the argument X is omitted, as in `srand()', then the current + date and time of day are used for a seed. This is the way to get + random numbers that are truly unpredictable. + + The return value of `srand' is the previous seed. This makes it + easy to keep track of the seeds in case you need to consistently + reproduce sequences of random numbers. + + ---------- Footnotes ---------- + + (1) The C version of `rand' is known to produce fairly poor +sequences of random numbers. However, nothing requires that an `awk' +implementation use the C `rand' to implement the `awk' version of +`rand'. In fact, `gawk' uses the BSD `random' function, which is +considerably better than `rand', to produce random numbers. + + (2) Computer-generated random numbers really are not truly random. +They are technically known as "pseudorandom." This means that while +the numbers in a sequence appear to be random, you can in fact generate +the same sequence of random numbers over and over again. + + +File: gawk.info, Node: String Functions, Next: I/O Functions, Prev: Numeric Functions, Up: Built-in + +8.1.3 String-Manipulation Functions +----------------------------------- + +The functions in this minor node look at or change the text of one or +more strings. Optional parameters are enclosed in square +brackets ([ ]). Those functions that are specific to `gawk' are marked +with a pound sign (`#'): + +* Menu: + +* Gory Details:: More than you want to know about `\' and + `&' with `sub', `gsub', and + `gensub'. + +`asort(SOURCE [, DEST]) #' + `asort' is a `gawk'-specific extension, returning the number of + elements in the array SOURCE. The contents of SOURCE are sorted + using `gawk''s normal rules for comparing values (in particular, + `IGNORECASE' affects the sorting) and the indices of the sorted + values of SOURCE are replaced with sequential integers starting + with one. If the optional array DEST is specified, then SOURCE is + duplicated into DEST. DEST is then sorted, leaving the indices of + SOURCE unchanged. For example, if the contents of `a' are as + follows: + + a["last"] = "de" + a["first"] = "sac" + a["middle"] = "cul" + + A call to `asort': + + asort(a) + + results in the following contents of `a': + + a[1] = "cul" + a[2] = "de" + a[3] = "sac" + + The `asort' function is described in more detail in *note Array + Sorting::. `asort' is a `gawk' extension; it is not available in + compatibility mode (*note Options::). + +`asorti(SOURCE [, DEST]) #' + `asorti' is a `gawk'-specific extension, returning the number of + elements in the array SOURCE. It works similarly to `asort', + however, the _indices_ are sorted, instead of the values. As + array indices are always strings, the comparison performed is + always a string comparison. (Here too, `IGNORECASE' affects the + sorting.) + + The `asorti' function is described in more detail in *note Array + Sorting::. It was added in `gawk' 3.1.2. `asorti' is a `gawk' + extension; it is not available in compatibility mode (*note + Options::). + +`index(IN, FIND)' + This searches the string IN for the first occurrence of the string + FIND, and returns the position in characters where that occurrence + begins in the string IN. Consider the following example: + + $ awk 'BEGIN { print index("peanut", "an") }' + -| 3 + + If FIND is not found, `index' returns zero. (Remember that string + indices in `awk' start at one.) + +`length([STRING])' + This returns the number of characters in STRING. If STRING is a + number, the length of the digit string representing that number is + returned. For example, `length("abcde")' is 5. By contrast, + `length(15 * 35)' works out to 3. In this example, 15 * 35 = 525, + and 525 is then converted to the string `"525"', which has three + characters. + + If no argument is supplied, `length' returns the length of `$0'. + + NOTE: In older versions of `awk', the `length' function could + be called without any parentheses. Doing so is marked as + "deprecated" in the POSIX standard. This means that while a + program can do this, it is a feature that can eventually be + removed from a future version of the standard. Therefore, + for programs to be maximally portable, always supply the + parentheses. + + Beginning with `gawk' version 3.2, when supplied an array + argument, the `length' function returns the number of elements in + the array. This is less useful than it might seem at first, as the + array is not guaranteed to be indexed from one to the number of + elements in it. If `--lint' is provided on the command line + (*note Options::), `gawk' warns that passing an array argument is + not portable. If `--posix' is supplied, using an array argument + is a fatal error (*note Arrays::). + +`match(STRING, REGEXP [, ARRAY])' + The `match' function searches STRING for the longest, leftmost + substring matched by the regular expression, REGEXP. It returns + the character position, or "index", at which that substring begins + (one, if it starts at the beginning of STRING). If no match is + found, it returns zero. + + The REGEXP argument may be either a regexp constant (`/.../') or a + string constant ("..."). In the latter case, the string is + treated as a regexp to be matched. *note Computed Regexps::, for a + discussion of the difference between the two forms, and the + implications for writing your program correctly. + + The order of the first two arguments is backwards from most other + string functions that work with regular expressions, such as `sub' + and `gsub'. It might help to remember that for `match', the order + is the same as for the `~' operator: `STRING ~ REGEXP'. + + The `match' function sets the built-in variable `RSTART' to the + index. It also sets the built-in variable `RLENGTH' to the length + in characters of the matched substring. If no match is found, + `RSTART' is set to zero, and `RLENGTH' to -1. + + For example: + + { + if ($1 == "FIND") + regex = $2 + else { + where = match($0, regex) + if (where != 0) + print "Match of", regex, "found at", + where, "in", $0 + } + } + + This program looks for lines that match the regular expression + stored in the variable `regex'. This regular expression can be + changed. If the first word on a line is `FIND', `regex' is + changed to be the second word on that line. Therefore, if given: + + FIND ru+n + My program runs + but not very quickly + FIND Melvin + JF+KM + This line is property of Reality Engineering Co. + Melvin was here. + + `awk' prints: + + Match of ru+n found at 12 in My program runs + Match of Melvin found at 1 in Melvin was here. + + If ARRAY is present, it is cleared, and then the 0th element of + ARRAY is set to the entire portion of STRING matched by REGEXP. + If REGEXP contains parentheses, the integer-indexed elements of + ARRAY are set to contain the portion of STRING matching the + corresponding parenthesized subexpression. For example: + + $ echo foooobazbarrrrr | + > gawk '{ match($0, /(fo+).+(bar*)/, arr) + > print arr[1], arr[2] }' + -| foooo barrrrr + + In addition, beginning with `gawk' 3.1.2, multidimensional + subscripts are available providing the start index and length of + each matched subexpression: + + $ echo foooobazbarrrrr | + > gawk '{ match($0, /(fo+).+(bar*)/, arr) + > print arr[1], arr[2] + > print arr[1, "start"], arr[1, "length"] + > print arr[2, "start"], arr[2, "length"] + > }' + -| foooo barrrrr + -| 1 5 + -| 9 7 + + There may not be subscripts for the start and index for every + parenthesized subexpressions, since they may not all have matched + text; thus they should be tested for with the `in' operator (*note + Reference to Elements::). + + The ARRAY argument to `match' is a `gawk' extension. In + compatibility mode (*note Options::), using a third argument is a + fatal error. + +`split(STRING, ARRAY [, FIELDSEP])' + This function divides STRING into pieces separated by FIELDSEP and + stores the pieces in ARRAY. The first piece is stored in + `ARRAY[1]', the second piece in `ARRAY[2]', and so forth. The + string value of the third argument, FIELDSEP, is a regexp + describing where to split STRING (much as `FS' can be a regexp + describing where to split input records). If FIELDSEP is omitted, + the value of `FS' is used. `split' returns the number of elements + created. + + The `split' function splits strings into pieces in a manner + similar to the way input lines are split into fields. For example: + + split("cul-de-sac", a, "-") + + splits the string `cul-de-sac' into three fields using `-' as the + separator. It sets the contents of the array `a' as follows: + + a[1] = "cul" + a[2] = "de" + a[3] = "sac" + + The value returned by this call to `split' is three. + + As with input field-splitting, when the value of FIELDSEP is + `" "', leading and trailing whitespace is ignored, and the elements + are separated by runs of whitespace. Also as with input + field-splitting, if FIELDSEP is the null string, each individual + character in the string is split into its own array element. + (This is a `gawk'-specific extension.) + + Note, however, that `RS' has no effect on the way `split' works. + Even though `RS = ""' causes newline to also be an input field + separator, this does not affect how `split' splits strings. + + Modern implementations of `awk', including `gawk', allow the third + argument to be a regexp constant (`/abc/') as well as a string. + (d.c.) The POSIX standard allows this as well. *note Computed + Regexps::, for a discussion of the difference between using a + string constant or a regexp constant, and the implications for + writing your program correctly. + + Before splitting the string, `split' deletes any previously + existing elements in the array ARRAY. + + If STRING is null, the array has no elements. (So this is a + portable way to delete an entire array with one statement. *Note + Delete::.) + + If STRING does not match FIELDSEP at all (but is not null), ARRAY + has one element only. The value of that element is the original + STRING. + +`sprintf(FORMAT, EXPRESSION1, ...)' + This returns (without printing) the string that `printf' would + have printed out with the same arguments (*note Printf::). For + example: + + pival = sprintf("pi = %.2f (approx.)", 22/7) + + assigns the string `"pi = 3.14 (approx.)"' to the variable `pival'. + +`strtonum(STR) #' + Examines STR and returns its numeric value. If STR begins with a + leading `0', `strtonum' assumes that STR is an octal number. If + STR begins with a leading `0x' or `0X', `strtonum' assumes that + STR is a hexadecimal number. For example: + + $ echo 0x11 | + > gawk '{ printf "%d\n", strtonum($1) }' + -| 17 + + Using the `strtonum' function is _not_ the same as adding zero to + a string value; the automatic coercion of strings to numbers works + only for decimal data, not for octal or hexadecimal.(1) + + Note also that `strtonum' uses the current locale's decimal point + for recognizing numbers. + + `strtonum' is a `gawk' extension; it is not available in + compatibility mode (*note Options::). + +`sub(REGEXP, REPLACEMENT [, TARGET])' + The `sub' function alters the value of TARGET. It searches this + value, which is treated as a string, for the leftmost, longest + substring matched by the regular expression REGEXP. Then the + entire string is changed by replacing the matched text with + REPLACEMENT. The modified string becomes the new value of TARGET. + + The REGEXP argument may be either a regexp constant (`/.../') or a + string constant ("..."). In the latter case, the string is + treated as a regexp to be matched. *note Computed Regexps::, for a + discussion of the difference between the two forms, and the + implications for writing your program correctly. + + This function is peculiar because TARGET is not simply used to + compute a value, and not just any expression will do--it must be a + variable, field, or array element so that `sub' can store a + modified value there. If this argument is omitted, then the + default is to use and alter `$0'.(2) For example: + + str = "water, water, everywhere" + sub(/at/, "ith", str) + + sets `str' to `"wither, water, everywhere"', by replacing the + leftmost longest occurrence of `at' with `ith'. + + The `sub' function returns the number of substitutions made (either + one or zero). + + If the special character `&' appears in REPLACEMENT, it stands for + the precise substring that was matched by REGEXP. (If the regexp + can match more than one string, then this precise substring may + vary.) For example: + + { sub(/candidate/, "& and his wife"); print } + + changes the first occurrence of `candidate' to `candidate and his + wife' on each input line. Here is another example: + + $ awk 'BEGIN { + > str = "daabaaa" + > sub(/a+/, "C&C", str) + > print str + > }' + -| dCaaCbaaa + + This shows how `&' can represent a nonconstant string and also + illustrates the "leftmost, longest" rule in regexp matching (*note + Leftmost Longest::). + + The effect of this special character (`&') can be turned off by + putting a backslash before it in the string. As usual, to insert + one backslash in the string, you must write two backslashes. + Therefore, write `\\&' in a string constant to include a literal + `&' in the replacement. For example, the following shows how to + replace the first `|' on each line with an `&': + + { sub(/\|/, "\\&"); print } + + As mentioned, the third argument to `sub' must be a variable, + field or array reference. Some versions of `awk' allow the third + argument to be an expression that is not an lvalue. In such a + case, `sub' still searches for the pattern and returns zero or + one, but the result of the substitution (if any) is thrown away + because there is no place to put it. Such versions of `awk' + accept expressions such as the following: + + sub(/USA/, "United States", "the USA and Canada") + + For historical compatibility, `gawk' accepts erroneous code, such + as in the previous example. However, using any other nonchangeable + object as the third parameter causes a fatal error and your program + will not run. + + Finally, if the REGEXP is not a regexp constant, it is converted + into a string, and then the value of that string is treated as the + regexp to match. + +`gsub(REGEXP, REPLACEMENT [, TARGET])' + This is similar to the `sub' function, except `gsub' replaces + _all_ of the longest, leftmost, _nonoverlapping_ matching + substrings it can find. The `g' in `gsub' stands for "global," + which means replace everywhere. For example: + + { gsub(/Britain/, "United Kingdom"); print } + + replaces all occurrences of the string `Britain' with `United + Kingdom' for all input records. + + The `gsub' function returns the number of substitutions made. If + the variable to search and alter (TARGET) is omitted, then the + entire input record (`$0') is used. As in `sub', the characters + `&' and `\' are special, and the third argument must be assignable. + +`gensub(REGEXP, REPLACEMENT, HOW [, TARGET]) #' + `gensub' is a general substitution function. Like `sub' and + `gsub', it searches the target string TARGET for matches of the + regular expression REGEXP. Unlike `sub' and `gsub', the modified + string is returned as the result of the function and the original + target string is _not_ changed. If HOW is a string beginning with + `g' or `G', then it replaces all matches of REGEXP with + REPLACEMENT. Otherwise, HOW is treated as a number that indicates + which match of REGEXP to replace. If no TARGET is supplied, `$0' + is used. + + `gensub' provides an additional feature that is not available in + `sub' or `gsub': the ability to specify components of a regexp in + the replacement text. This is done by using parentheses in the + regexp to mark the components and then specifying `\N' in the + replacement text, where N is a digit from 1 to 9. For example: + + $ gawk ' + > BEGIN { + > a = "abc def" + > b = gensub(/(.+) (.+)/, "\\2 \\1", "g", a) + > print b + > }' + -| def abc + + As with `sub', you must type two backslashes in order to get one + into the string. In the replacement text, the sequence `\0' + represents the entire matched text, as does the character `&'. + + The following example shows how you can use the third argument to + control which match of the regexp should be changed: + + $ echo a b c a b c | + > gawk '{ print gensub(/a/, "AA", 2) }' + -| a b c AA b c + + In this case, `$0' is used as the default target string. `gensub' + returns the new string as its result, which is passed directly to + `print' for printing. + + If the HOW argument is a string that does not begin with `g' or + `G', or if it is a number that is less than or equal to zero, only + one substitution is performed. If HOW is zero, `gawk' issues a + warning message. + + If REGEXP does not match TARGET, `gensub''s return value is the + original unchanged value of TARGET. + + `gensub' is a `gawk' extension; it is not available in + compatibility mode (*note Options::). + +`substr(STRING, START [, LENGTH])' + This returns a LENGTH-character-long substring of STRING, starting + at character number START. The first character of a string is + character number one.(3) For example, `substr("washington", 5, 3)' + returns `"ing"'. + + If LENGTH is not present, this function returns the whole suffix of + STRING that begins at character number START. For example, + `substr("washington", 5)' returns `"ington"'. The whole suffix is + also returned if LENGTH is greater than the number of characters + remaining in the string, counting from character START. + + If START is less than one, `substr' treats it as if it was one. + (POSIX doesn't specify what to do in this case: Unix `awk' acts + this way, and therefore `gawk' does too.) If START is greater + than the number of characters in the string, `substr' returns the + null string. Similarly, if LENGTH is present but less than or + equal to zero, the null string is returned. + + The string returned by `substr' _cannot_ be assigned. Thus, it is + a mistake to attempt to change a portion of a string, as shown in + the following example: + + string = "abcdef" + # try to get "abCDEf", won't work + substr(string, 3, 3) = "CDE" + + It is also a mistake to use `substr' as the third argument of + `sub' or `gsub': + + gsub(/xyz/, "pdq", substr($0, 5, 20)) # WRONG + + (Some commercial versions of `awk' do in fact let you use `substr' + this way, but doing so is not portable.) + + If you need to replace bits and pieces of a string, combine + `substr' with string concatenation, in the following manner: + + string = "abcdef" + ... + string = substr(string, 1, 2) "CDE" substr(string, 6) + +`tolower(STRING)' + This returns a copy of STRING, with each uppercase character in + the string replaced with its corresponding lowercase character. + Nonalphabetic characters are left unchanged. For example, + `tolower("MiXeD cAsE 123")' returns `"mixed case 123"'. + +`toupper(STRING)' + This returns a copy of STRING, with each lowercase character in + the string replaced with its corresponding uppercase character. + Nonalphabetic characters are left unchanged. For example, + `toupper("MiXeD cAsE 123")' returns `"MIXED CASE 123"'. + + ---------- Footnotes ---------- + + (1) Unless you use the `--non-decimal-data' option, which isn't +recommended. *Note Nondecimal Data::, for more information. + + (2) Note that this means that the record will first be regenerated +using the value of `OFS' if any fields have been changed, and that the +fields will be updated after the substitution, even if the operation is +a "no-op" such as `sub(/^/, "")'. + + (3) This is different from C and C++, in which the first character +is number zero. + + +File: gawk.info, Node: Gory Details, Up: String Functions + +8.1.3.1 More About `\' and `&' with `sub', `gsub', and `gensub' +............................................................... + +When using `sub', `gsub', or `gensub', and trying to get literal +backslashes and ampersands into the replacement text, you need to +remember that there are several levels of "escape processing" going on. + + First, there is the "lexical" level, which is when `awk' reads your +program and builds an internal copy of it that can be executed. Then +there is the runtime level, which is when `awk' actually scans the +replacement string to determine what to generate. + + At both levels, `awk' looks for a defined set of characters that can +come after a backslash. At the lexical level, it looks for the escape +sequences listed in *note Escape Sequences::. Thus, for every `\' that +`awk' processes at the runtime level, type two backslashes at the +lexical level. When a character that is not valid for an escape +sequence follows the `\', Unix `awk' and `gawk' both simply remove the +initial `\' and put the next character into the string. Thus, for +example, `"a\qb"' is treated as `"aqb"'. + + At the runtime level, the various functions handle sequences of `\' +and `&' differently. The situation is (sadly) somewhat complex. +Historically, the `sub' and `gsub' functions treated the two character +sequence `\&' specially; this sequence was replaced in the generated +text with a single `&'. Any other `\' within the REPLACEMENT string +that did not precede an `&' was passed through unchanged. This is +illustrated in *note table-sub-escapes::. + + You type `sub' sees `sub' generates + ------- --------- -------------- + `\&' `&' the matched text + `\\&' `\&' a literal `&' + `\\\&' `\&' a literal `&' + `\\\\&' `\\&' a literal `\&' + `\\\\\&' `\\&' a literal `\&' + `\\\\\\&' `\\\&' a literal `\\&' + `\\q' `\q' a literal `\q' + +Table 8.1: Historical Escape Sequence Processing for sub and gsub + +This table shows both the lexical-level processing, where an odd number +of backslashes becomes an even number at the runtime level, as well as +the runtime processing done by `sub'. (For the sake of simplicity, the +rest of the following tables only show the case of even numbers of +backslashes entered at the lexical level.) + + The problem with the historical approach is that there is no way to +get a literal `\' followed by the matched text. + + The 1992 POSIX standard attempted to fix this problem. That standard +says that `sub' and `gsub' look for either a `\' or an `&' after the +`\'. If either one follows a `\', that character is output literally. +The interpretation of `\' and `&' then becomes as shown in *note +table-sub-posix-92::. + + You type `sub' sees `sub' generates + ------- --------- -------------- + `&' `&' the matched text + `\\&' `\&' a literal `&' + `\\\\&' `\\&' a literal `\', then the matched text + `\\\\\\&' `\\\&' a literal `\&' + +Table 8.2: 1992 POSIX Rules for sub and gsub Escape Sequence Processing + +This appears to solve the problem. Unfortunately, the phrasing of the +standard is unusual. It says, in effect, that `\' turns off the special +meaning of any following character, but for anything other than `\' and +`&', such special meaning is undefined. This wording leads to two +problems: + + * Backslashes must now be doubled in the REPLACEMENT string, breaking + historical `awk' programs. + + * To make sure that an `awk' program is portable, _every_ character + in the REPLACEMENT string must be preceded with a backslash.(1) + + Because of the problems just listed, in 1996, the `gawk' maintainer +submitted proposed text for a revised standard that reverts to rules +that correspond more closely to the original existing practice. The +proposed rules have special cases that make it possible to produce a +`\' preceding the matched text. This is shown in *note +table-sub-proposed::. + + You type `sub' sees `sub' generates + ------- --------- -------------- + `\\\\\\&' `\\\&' a literal `\&' + `\\\\&' `\\&' a literal `\', followed by the matched text + `\\&' `\&' a literal `&' + `\\q' `\q' a literal `\q' + `\\\\' `\\' `\\' + +Table 8.3: Proposed rules for sub and backslash + + In a nutshell, at the runtime level, there are now three special +sequences of characters (`\\\&', `\\&' and `\&') whereas historically +there was only one. However, as in the historical case, any `\' that +is not part of one of these three sequences is not special and appears +in the output literally. + + `gawk' 3.0 and 3.1 follow these proposed POSIX rules for `sub' and +`gsub'. The POSIX standard took much longer to be revised than was +expected in 1996. The 2001 standard does not follow the above rules. +Instead, the rules there are somewhat simpler. The results are similar +except for one case. + + The 2001 POSIX rules state that `\&' in the replacement string +produces a literal `&', `\\' produces a literal `\', and `\' followed +by anything else is not special; the `\' is placed straight into the +output. These rules are presented in *note table-posix-2001-sub::. + + You type `sub' sees `sub' generates + ------- --------- -------------- + `\\\\\\&' `\\\&' a literal `\&' + `\\\\&' `\\&' a literal `\', followed by the matched text + `\\&' `\&' a literal `&' + `\\q' `\q' a literal `\q' + `\\\\' `\\' `\' + +Table 8.4: POSIX 2001 rules for sub + + The only case where the difference is noticeable is the last one: +`\\\\' is seen as `\\' and produces `\' instead of `\\'. + + Starting with version 3.1.4, `gawk' follows the POSIX rules when +`--posix' is specified (*note Options::). Otherwise, it continues to +follow the 1996 proposed rules, since, as of this writing, that has +been its behavior for over seven years. + + NOTE: At the next major release, `gawk' will switch to using the + POSIX 2001 rules by default. + + The rules for `gensub' are considerably simpler. At the runtime +level, whenever `gawk' sees a `\', if the following character is a +digit, then the text that matched the corresponding parenthesized +subexpression is placed in the generated output. Otherwise, no matter +what character follows the `\', it appears in the generated text and +the `\' does not, as shown in *note table-gensub-escapes::. + + You type `gensub' sees `gensub' generates + ------- ------------ ----------------- + `&' `&' the matched text + `\\&' `\&' a literal `&' + `\\\\' `\\' a literal `\' + `\\\\&' `\\&' a literal `\', then the matched text + `\\\\\\&' `\\\&' a literal `\&' + `\\q' `\q' a literal `q' + +Table 8.5: Escape Sequence Processing for gensub + + Because of the complexity of the lexical and runtime level processing +and the special cases for `sub' and `gsub', we recommend the use of +`gawk' and `gensub' when you have to do substitutions. + +Advanced Notes: Matching the Null String +---------------------------------------- + +In `awk', the `*' operator can match the null string. This is +particularly important for the `sub', `gsub', and `gensub' functions. +For example: + + $ echo abc | awk '{ gsub(/m*/, "X"); print }' + -| XaXbXcX + +Although this makes a certain amount of sense, it can be surprising. + + ---------- Footnotes ---------- + + (1) This consequence was certainly unintended. + + +File: gawk.info, Node: I/O Functions, Next: Time Functions, Prev: String Functions, Up: Built-in + +8.1.4 Input/Output Functions +---------------------------- + +The following functions relate to input/output (I/O). Optional +parameters are enclosed in square brackets ([ ]): + +`close(FILENAME [, HOW])' + Close the file FILENAME for input or output. Alternatively, the + argument may be a shell command that was used for creating a + coprocess, or for redirecting to or from a pipe; then the + coprocess or pipe is closed. *Note Close Files And Pipes::, for + more information. + + When closing a coprocess, it is occasionally useful to first close + one end of the two-way pipe and then to close the other. This is + done by providing a second argument to `close'. This second + argument should be one of the two string values `"to"' or `"from"', + indicating which end of the pipe to close. Case in the string does + not matter. *Note Two-way I/O::, which discusses this feature in + more detail and gives an example. + +`fflush([FILENAME])' + Flush any buffered output associated with FILENAME, which is + either a file opened for writing or a shell command for + redirecting output to a pipe or coprocess. + + Many utility programs "buffer" their output; i.e., they save + information to write to a disk file or terminal in memory until + there is enough for it to be worthwhile to send the data to the + output device. This is often more efficient than writing every + little bit of information as soon as it is ready. However, + sometimes it is necessary to force a program to "flush" its + buffers; that is, write the information to its destination, even + if a buffer is not full. This is the purpose of the `fflush' + function--`gawk' also buffers its output and the `fflush' function + forces `gawk' to flush its buffers. + + `fflush' was added to the Bell Laboratories research version of + `awk' in 1994; it is not part of the POSIX standard and is not + available if `--posix' has been specified on the command line + (*note Options::). + + `gawk' extends the `fflush' function in two ways. The first is to + allow no argument at all. In this case, the buffer for the + standard output is flushed. The second is to allow the null string + (`""') as the argument. In this case, the buffers for _all_ open + output files and pipes are flushed. + + `fflush' returns zero if the buffer is successfully flushed; + otherwise, it returns -1. In the case where all buffers are + flushed, the return value is zero only if all buffers were flushed + successfully. Otherwise, it is -1, and `gawk' warns about the + problem FILENAME. + + `gawk' also issues a warning message if you attempt to flush a + file or pipe that was opened for reading (such as with `getline'), + or if FILENAME is not an open file, pipe, or coprocess. In such a + case, `fflush' returns -1, as well. + +`system(COMMAND)' + Executes operating-system commands and then returns to the `awk' + program. The `system' function executes the command given by the + string COMMAND. It returns the status returned by the command + that was executed as its value. + + For example, if the following fragment of code is put in your `awk' + program: + + END { + system("date | mail -s 'awk run done' root") + } + + the system administrator is sent mail when the `awk' program + finishes processing input and begins its end-of-input processing. + + Note that redirecting `print' or `printf' into a pipe is often + enough to accomplish your task. If you need to run many commands, + it is more efficient to simply print them down a pipeline to the + shell: + + while (MORE STUFF TO DO) + print COMMAND | "/bin/sh" + close("/bin/sh") + + However, if your `awk' program is interactive, `system' is useful + for cranking up large self-contained programs, such as a shell or + an editor. Some operating systems cannot implement the `system' + function. `system' causes a fatal error if it is not supported. + +Advanced Notes: Interactive Versus Noninteractive Buffering +----------------------------------------------------------- + +As a side point, buffering issues can be even more confusing, depending +upon whether your program is "interactive", i.e., communicating with a +user sitting at a keyboard.(1) + + Interactive programs generally "line buffer" their output; i.e., they +write out every line. Noninteractive programs wait until they have a +full buffer, which may be many lines of output. Here is an example of +the difference: + + $ awk '{ print $1 + $2 }' + 1 1 + -| 2 + 2 3 + -| 5 + Ctrl-d + +Each line of output is printed immediately. Compare that behavior with +this example: + + $ awk '{ print $1 + $2 }' | cat + 1 1 + 2 3 + Ctrl-d + -| 2 + -| 5 + +Here, no output is printed until after the `Ctrl-d' is typed, because +it is all buffered and sent down the pipe to `cat' in one shot. + +Advanced Notes: Controlling Output Buffering with `system' +---------------------------------------------------------- + +The `fflush' function provides explicit control over output buffering +for individual files and pipes. However, its use is not portable to +many other `awk' implementations. An alternative method to flush output +buffers is to call `system' with a null string as its argument: + + system("") # flush output + +`gawk' treats this use of the `system' function as a special case and +is smart enough not to run a shell (or other command interpreter) with +the empty command. Therefore, with `gawk', this idiom is not only +useful, it is also efficient. While this method should work with other +`awk' implementations, it does not necessarily avoid starting an +unnecessary shell. (Other implementations may only flush the buffer +associated with the standard output and not necessarily all buffered +output.) + + If you think about what a programmer expects, it makes sense that +`system' should flush any pending output. The following program: + + BEGIN { + print "first print" + system("echo system echo") + print "second print" + } + +must print: + + first print + system echo + second print + +and not: + + system echo + first print + second print + + If `awk' did not flush its buffers before calling `system', you +would see the latter (undesirable) output. + + ---------- Footnotes ---------- + + (1) A program is interactive if the standard output is connected to +a terminal device. + + +File: gawk.info, Node: Time Functions, Next: Bitwise Functions, Prev: I/O Functions, Up: Built-in + +8.1.5 Using `gawk''s Timestamp Functions +---------------------------------------- + +`awk' programs are commonly used to process log files containing +timestamp information, indicating when a particular log record was +written. Many programs log their timestamp in the form returned by the +`time' system call, which is the number of seconds since a particular +epoch. On POSIX-compliant systems, it is the number of seconds since +1970-01-01 00:00:00 UTC, not counting leap seconds.(1) All known +POSIX-compliant systems support timestamps from 0 through 2^31 - 1, +which is sufficient to represent times through 2038-01-19 03:14:07 UTC. +Many systems support a wider range of timestamps, including negative +timestamps that represent times before the epoch. + + In order to make it easier to process such log files and to produce +useful reports, `gawk' provides the following functions for working +with timestamps. They are `gawk' extensions; they are not specified in +the POSIX standard, nor are they in any other known version of `awk'.(2) +Optional parameters are enclosed in square brackets ([ ]): + +`systime()' + This function returns the current time as the number of seconds + since the system epoch. On POSIX systems, this is the number of + seconds since 1970-01-01 00:00:00 UTC, not counting leap seconds. + It may be a different number on other systems. + +`mktime(DATESPEC)' + This function turns DATESPEC into a timestamp in the same form as + is returned by `systime'. It is similar to the function of the + same name in ISO C. The argument, DATESPEC, is a string of the + form `"YYYY MM DD HH MM SS [DST]"'. The string consists of six or + seven numbers representing, respectively, the full year including + century, the month from 1 to 12, the day of the month from 1 to + 31, the hour of the day from 0 to 23, the minute from 0 to 59, the + second from 0 to 60,(3) and an optional daylight-savings flag. + + The values of these numbers need not be within the ranges + specified; for example, an hour of -1 means 1 hour before midnight. + The origin-zero Gregorian calendar is assumed, with year 0 + preceding year 1 and year -1 preceding year 0. The time is + assumed to be in the local timezone. If the daylight-savings flag + is positive, the time is assumed to be daylight savings time; if + zero, the time is assumed to be standard time; and if negative + (the default), `mktime' attempts to determine whether daylight + savings time is in effect for the specified time. + + If DATESPEC does not contain enough elements or if the resulting + time is out of range, `mktime' returns -1. + +`strftime([FORMAT [, TIMESTAMP [, UTC-FLAG]]])' + This function returns a string. It is similar to the function of + the same name in ISO C. The time specified by TIMESTAMP is used to + produce a string, based on the contents of the FORMAT string. If + UTC-FLAG is present and is either non-zero or non-null, the value + is formatted as UTC (Coordinated Universal Time, formerly GMT or + Greenwich Mean Time). Otherwise, the value is formatted for the + local time zone. The TIMESTAMP is in the same format as the value + returned by the `systime' function. If no TIMESTAMP argument is + supplied, `gawk' uses the current time of day as the timestamp. + If no FORMAT argument is supplied, `strftime' uses + `"%a %b %d %H:%M:%S %Z %Y"'. This format string produces output + that is (almost) equivalent to that of the `date' utility. + (Versions of `gawk' prior to 3.0 require the FORMAT argument.) + + The `systime' function allows you to compare a timestamp from a log +file with the current time of day. In particular, it is easy to +determine how long ago a particular record was logged. It also allows +you to produce log records using the "seconds since the epoch" format. + + The `mktime' function allows you to convert a textual representation +of a date and time into a timestamp. This makes it easy to do +before/after comparisons of dates and times, particularly when dealing +with date and time data coming from an external source, such as a log +file. + + The `strftime' function allows you to easily turn a timestamp into +human-readable information. It is similar in nature to the `sprintf' +function (*note String Functions::), in that it copies nonformat +specification characters verbatim to the returned string, while +substituting date and time values for format specifications in the +FORMAT string. + + `strftime' is guaranteed by the 1999 ISO C standard(4) to support +the following date format specifications: + +`%a' + The locale's abbreviated weekday name. + +`%A' + The locale's full weekday name. + +`%b' + The locale's abbreviated month name. + +`%B' + The locale's full month name. + +`%c' + The locale's "appropriate" date and time representation. (This is + `%A %B %d %T %Y' in the `"C"' locale.) + +`%C' + The century. This is the year divided by 100 and truncated to the + next lower integer. + +`%d' + The day of the month as a decimal number (01-31). + +`%D' + Equivalent to specifying `%m/%d/%y'. + +`%e' + The day of the month, padded with a space if it is only one digit. + +`%F' + Equivalent to specifying `%Y-%m-%d'. This is the ISO 8601 date + format. + +`%g' + The year modulo 100 of the ISO week number, as a decimal number + (00-99). For example, January 1, 1993 is in week 53 of 1992. + Thus, the year of its ISO week number is 1992, even though its + year is 1993. Similarly, December 31, 1973 is in week 1 of 1974. + Thus, the year of its ISO week number is 1974, even though its + year is 1973. + +`%G' + The full year of the ISO week number, as a decimal number. + +`%h' + Equivalent to `%b'. + +`%H' + The hour (24-hour clock) as a decimal number (00-23). + +`%I' + The hour (12-hour clock) as a decimal number (01-12). + +`%j' + The day of the year as a decimal number (001-366). + +`%m' + The month as a decimal number (01-12). + +`%M' + The minute as a decimal number (00-59). + +`%n' + A newline character (ASCII LF). + +`%p' + The locale's equivalent of the AM/PM designations associated with + a 12-hour clock. + +`%r' + The locale's 12-hour clock time. (This is `%I:%M:%S %p' in the + `"C"' locale.) + +`%R' + Equivalent to specifying `%H:%M'. + +`%S' + The second as a decimal number (00-60). + +`%t' + A TAB character. + +`%T' + Equivalent to specifying `%H:%M:%S'. + +`%u' + The weekday as a decimal number (1-7). Monday is day one. + +`%U' + The week number of the year (the first Sunday as the first day of + week one) as a decimal number (00-53). + +`%V' + The week number of the year (the first Monday as the first day of + week one) as a decimal number (01-53). The method for determining + the week number is as specified by ISO 8601. (To wit: if the week + containing January 1 has four or more days in the new year, then + it is week one; otherwise it is week 53 of the previous year and + the next week is week one.) + +`%w' + The weekday as a decimal number (0-6). Sunday is day zero. + +`%W' + The week number of the year (the first Monday as the first day of + week one) as a decimal number (00-53). + +`%x' + The locale's "appropriate" date representation. (This is `%A %B + %d %Y' in the `"C"' locale.) + +`%X' + The locale's "appropriate" time representation. (This is `%T' in + the `"C"' locale.) + +`%y' + The year modulo 100 as a decimal number (00-99). + +`%Y' + The full year as a decimal number (e.g., 1995). + +`%z' + The timezone offset in a +HHMM format (e.g., the format necessary + to produce RFC 822/RFC 1036 date headers). + +`%Z' + The time zone name or abbreviation; no characters if no time zone + is determinable. + +`%Ec %EC %Ex %EX %Ey %EY %Od %Oe %OH' +`%OI %Om %OM %OS %Ou %OU %OV %Ow %OW %Oy' + "Alternate representations" for the specifications that use only + the second letter (`%c', `%C', and so on).(5) (These facilitate + compliance with the POSIX `date' utility.) + +`%%' + A literal `%'. + + If a conversion specifier is not one of the above, the behavior is +undefined.(6) + + Informally, a "locale" is the geographic place in which a program is +meant to run. For example, a common way to abbreviate the date +September 4, 1991 in the United States is "9/4/91." In many countries +in Europe, however, it is abbreviated "4.9.91." Thus, the `%x' +specification in a `"US"' locale might produce `9/4/91', while in a +`"EUROPE"' locale, it might produce `4.9.91'. The ISO C standard +defines a default `"C"' locale, which is an environment that is typical +of what most C programmers are used to. + + For systems that are not yet fully standards-compliant, `gawk' +supplies a copy of `strftime' from the GNU C Library. It supports all +of the just listed format specifications. If that version is used to +compile `gawk' (*note Installation::), then the following additional +format specifications are available: + +`%k' + The hour (24-hour clock) as a decimal number (0-23). Single-digit + numbers are padded with a space. + +`%l' + The hour (12-hour clock) as a decimal number (1-12). Single-digit + numbers are padded with a space. + +`%s' + The time as a decimal timestamp in seconds since the epoch. + + + Additionally, the alternate representations are recognized but their +normal representations are used. + + This example is an `awk' implementation of the POSIX `date' utility. +Normally, the `date' utility prints the current date and time of day in +a well-known format. However, if you provide an argument to it that +begins with a `+', `date' copies nonformat specifier characters to the +standard output and interprets the current time according to the format +specifiers in the string. For example: + + $ date '+Today is %A, %B %d, %Y.' + -| Today is Thursday, September 14, 2000. + + Here is the `gawk' version of the `date' utility. It has a shell +"wrapper" to handle the `-u' option, which requires that `date' run as +if the time zone is set to UTC: + + #! /bin/sh + # + # date --- approximate the P1003.2 'date' command + + case $1 in + -u) TZ=UTC0 # use UTC + export TZ + shift ;; + esac + + gawk 'BEGIN { + format = "%a %b %d %H:%M:%S %Z %Y" + exitval = 0 + + if (ARGC > 2) + exitval = 1 + else if (ARGC == 2) { + format = ARGV[1] + if (format ~ /^\+/) + format = substr(format, 2) # remove leading + + } + print strftime(format) + exit exitval + }' "$@" + + ---------- Footnotes ---------- + + (1) *Note Glossary::, especially the entries "Epoch" and "UTC." + + (2) The GNU `date' utility can also do many of the things described +here. Its use may be preferable for simple time-related operations in +shell scripts. + + (3) Occasionally there are minutes in a year with a leap second, +which is why the seconds can go up to 60. + + (4) As this is a recent standard, not every system's `strftime' +necessarily supports all of the conversions listed here. + + (5) If you don't understand any of this, don't worry about it; these +facilities are meant to make it easier to "internationalize" programs. +Other internationalization features are described in *note +Internationalization::. + + (6) This is because ISO C leaves the behavior of the C version of +`strftime' undefined and `gawk' uses the system's version of `strftime' +if it's there. Typically, the conversion specifier either does not +appear in the returned string or appears literally. + + +File: gawk.info, Node: Bitwise Functions, Next: I18N Functions, Prev: Time Functions, Up: Built-in + +8.1.6 Bit-Manipulation Functions of `gawk' +------------------------------------------ + + I can explain it for you, but I can't understand it for you. + Anonymous + + Many languages provide the ability to perform "bitwise" operations +on two integer numbers. In other words, the operation is performed on +each successive pair of bits in the operands. Three common operations +are bitwise AND, OR, and XOR. The operations are described in *note +table-bitwise-ops::. + + Bit Operator + | AND | OR | XOR + |--+--+--+--+--+-- + Operands | 0 | 1 | 0 | 1 | 0 | 1 + ---------+--+--+--+--+--+-- + 0 | 0 0 | 0 1 | 0 1 + 1 | 0 1 | 1 1 | 1 0 + +Table 8.6: Bitwise Operations + + As you can see, the result of an AND operation is 1 only when _both_ +bits are 1. The result of an OR operation is 1 if _either_ bit is 1. +The result of an XOR operation is 1 if either bit is 1, but not both. +The next operation is the "complement"; the complement of 1 is 0 and +the complement of 0 is 1. Thus, this operation "flips" all the bits of +a given value. + + Finally, two other common operations are to shift the bits left or +right. For example, if you have a bit string `10111001' and you shift +it right by three bits, you end up with `00010111'.(1) If you start over +again with `10111001' and shift it left by three bits, you end up with +`11001000'. `gawk' provides built-in functions that implement the +bitwise operations just described. They are: + +`and(V1, V2)' Returns the bitwise AND of the values provided by V1 + and V2. +`or(V1, V2)' Returns the bitwise OR of the values provided by V1 + and V2. +`xor(V1, V2)' Returns the bitwise XOR of the values provided by V1 + and V2. +`compl(VAL)' Returns the bitwise complement of VAL. +`lshift(VAL, COUNT)' Returns the value of VAL, shifted left by COUNT bits. +`rshift(VAL, COUNT)' Returns the value of VAL, shifted right by COUNT bits. + + For all of these functions, first the double-precision +floating-point value is converted to the widest C unsigned integer +type, then the bitwise operation is performed. If the result cannot be +represented exactly as a C `double', leading nonzero bits are removed +one by one until it can be represented exactly. The result is then +converted back into a C `double'. (If you don't understand this +paragraph, don't worry about it.) + + Here is a user-defined function (*note User-defined::) that +illustrates the use of these functions: + + # bits2str --- turn a byte into readable 1's and 0's + + function bits2str(bits, data, mask) + { + if (bits == 0) + return "0" + + mask = 1 + for (; bits != 0; bits = rshift(bits, 1)) + data = (and(bits, mask) ? "1" : "0") data + + while ((length(data) % 8) != 0) + data = "0" data + + return data + } + + BEGIN { + printf "123 = %s\n", bits2str(123) + printf "0123 = %s\n", bits2str(0123) + printf "0x99 = %s\n", bits2str(0x99) + comp = compl(0x99) + printf "compl(0x99) = %#x = %s\n", comp, bits2str(comp) + shift = lshift(0x99, 2) + printf "lshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift) + shift = rshift(0x99, 2) + printf "rshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift) + } + +This program produces the following output when run: + + $ gawk -f testbits.awk + -| 123 = 01111011 + -| 0123 = 01010011 + -| 0x99 = 10011001 + -| compl(0x99) = 0xffffff66 = 11111111111111111111111101100110 + -| lshift(0x99, 2) = 0x264 = 0000001001100100 + -| rshift(0x99, 2) = 0x26 = 00100110 + + The `bits2str' function turns a binary number into a string. The +number `1' represents a binary value where the rightmost bit is set to +1. Using this mask, the function repeatedly checks the rightmost bit. +ANDing the mask with the value indicates whether the rightmost bit is 1 +or not. If so, a `"1"' is concatenated onto the front of the string. +Otherwise, a `"0"' is added. The value is then shifted right by one +bit and the loop continues until there are no more 1 bits. + + If the initial value is zero it returns a simple `"0"'. Otherwise, +at the end, it pads the value with zeros to represent multiples of +8-bit quantities. This is typical in modern computers. + + The main code in the `BEGIN' rule shows the difference between the +decimal and octal values for the same numbers (*note +Nondecimal-numbers::), and then demonstrates the results of the +`compl', `lshift', and `rshift' functions. + + ---------- Footnotes ---------- + + (1) This example shows that 0's come in on the left side. For +`gawk', this is always true, but in some languages, it's possible to +have the left side fill with 1's. Caveat emptor. + + +File: gawk.info, Node: I18N Functions, Prev: Bitwise Functions, Up: Built-in + +8.1.7 Using `gawk''s String-Translation Functions +------------------------------------------------- + +`gawk' provides facilities for internationalizing `awk' programs. +These include the functions described in the following list. The +descriptions here are purposely brief. *Note Internationalization::, +for the full story. Optional parameters are enclosed in square +brackets ([ ]): + +`dcgettext(STRING [, DOMAIN [, CATEGORY]])' + This function returns the translation of STRING in text domain + DOMAIN for locale category CATEGORY. The default value for DOMAIN + is the current value of `TEXTDOMAIN'. The default value for + CATEGORY is `"LC_MESSAGES"'. + +`dcngettext(STRING1, STRING2, NUMBER [, DOMAIN [, CATEGORY]])' + This function returns the plural form used for NUMBER of the + translation of STRING1 and STRING2 in text domain DOMAIN for + locale category CATEGORY. STRING1 is the English singular variant + of a message, and STRING2 the English plural variant of the same + message. The default value for DOMAIN is the current value of + `TEXTDOMAIN'. The default value for CATEGORY is `"LC_MESSAGES"'. + +`bindtextdomain(DIRECTORY [, DOMAIN])' + This function allows you to specify the directory in which `gawk' + will look for message translation files, in case they will not or + cannot be placed in the "standard" locations (e.g., during + testing). It returns the directory in which DOMAIN is "bound." + + The default DOMAIN is the value of `TEXTDOMAIN'. If DIRECTORY is + the null string (`""'), then `bindtextdomain' returns the current + binding for the given DOMAIN. + + +File: gawk.info, Node: User-defined, Prev: Built-in, Up: Functions + +8.2 User-Defined Functions +========================== + +Complicated `awk' programs can often be simplified by defining your own +functions. User-defined functions can be called just like built-in +ones (*note Function Calls::), but it is up to you to define them, +i.e., to tell `awk' what they should do. + +* Menu: + +* Definition Syntax:: How to write definitions and what they mean. +* Function Example:: An example function definition and what it + does. +* Function Caveats:: Things to watch out for. +* Return Statement:: Specifying the value a function returns. +* Dynamic Typing:: How variable types can change at runtime. + + +File: gawk.info, Node: Definition Syntax, Next: Function Example, Up: User-defined + +8.2.1 Function Definition Syntax +-------------------------------- + +Definitions of functions can appear anywhere between the rules of an +`awk' program. Thus, the general form of an `awk' program is extended +to include sequences of rules _and_ user-defined function definitions. +There is no need to put the definition of a function before all uses of +the function. This is because `awk' reads the entire program before +starting to execute any of it. + + The definition of a function named NAME looks like this: + + function NAME(PARAMETER-LIST) + { + BODY-OF-FUNCTION + } + +NAME is the name of the function to define. A valid function name is +like a valid variable name: a sequence of letters, digits, and +underscores that doesn't start with a digit. Within a single `awk' +program, any particular name can only be used as a variable, array, or +function. + + PARAMETER-LIST is a list of the function's arguments and local +variable names, separated by commas. When the function is called, the +argument names are used to hold the argument values given in the call. +The local variables are initialized to the empty string. A function +cannot have two parameters with the same name, nor may it have a +parameter with the same name as the function itself. + + The BODY-OF-FUNCTION consists of `awk' statements. It is the most +important part of the definition, because it says what the function +should actually _do_. The argument names exist to give the body a way +to talk about the arguments; local variables exist to give the body +places to keep temporary values. + + Argument names are not distinguished syntactically from local +variable names. Instead, the number of arguments supplied when the +function is called determines how many argument variables there are. +Thus, if three argument values are given, the first three names in +PARAMETER-LIST are arguments and the rest are local variables. + + It follows that if the number of arguments is not the same in all +calls to the function, some of the names in PARAMETER-LIST may be +arguments on some occasions and local variables on others. Another way +to think of this is that omitted arguments default to the null string. + + Usually when you write a function, you know how many names you +intend to use for arguments and how many you intend to use as local +variables. It is conventional to place some extra space between the +arguments and the local variables, in order to document how your +function is supposed to be used. + + During execution of the function body, the arguments and local +variable values hide, or "shadow", any variables of the same names used +in the rest of the program. The shadowed variables are not accessible +in the function definition, because there is no way to name them while +their names have been taken away for the local variables. All other +variables used in the `awk' program can be referenced or set normally +in the function's body. + + The arguments and local variables last only as long as the function +body is executing. Once the body finishes, you can once again access +the variables that were shadowed while the function was running. + + The function body can contain expressions that call functions. They +can even call this function, either directly or by way of another +function. When this happens, we say the function is "recursive". The +act of a function calling itself is called "recursion". + + In many `awk' implementations, including `gawk', the keyword +`function' may be abbreviated `func'. However, POSIX only specifies +the use of the keyword `function'. This actually has some practical +implications. If `gawk' is in POSIX-compatibility mode (*note +Options::), then the following statement does _not_ define a function: + + func foo() { a = sqrt($1) ; print a } + +Instead it defines a rule that, for each record, concatenates the value +of the variable `func' with the return value of the function `foo'. If +the resulting string is non-null, the action is executed. This is +probably not what is desired. (`awk' accepts this input as +syntactically valid, because functions may be used before they are +defined in `awk' programs.) + + To ensure that your `awk' programs are portable, always use the +keyword `function' when defining a function. + + +File: gawk.info, Node: Function Example, Next: Function Caveats, Prev: Definition Syntax, Up: User-defined + +8.2.2 Function Definition Examples +---------------------------------- + +Here is an example of a user-defined function, called `myprint', that +takes a number and prints it in a specific format: + + function myprint(num) + { + printf "%6.3g\n", num + } + +To illustrate, here is an `awk' rule that uses our `myprint' function: + + $3 > 0 { myprint($3) } + +This program prints, in our special format, all the third fields that +contain a positive number in our input. Therefore, when given the +following: + + 1.2 3.4 5.6 7.8 + 9.10 11.12 -13.14 15.16 + 17.18 19.20 21.22 23.24 + +this program, using our function to format the results, prints: + + 5.6 + 21.2 + + This function deletes all the elements in an array: + + function delarray(a, i) + { + for (i in a) + delete a[i] + } + + When working with arrays, it is often necessary to delete all the +elements in an array and start over with a new list of elements (*note +Delete::). Instead of having to repeat this loop everywhere that you +need to clear out an array, your program can just call `delarray'. +(This guarantees portability. The use of `delete ARRAY' to delete the +contents of an entire array is a nonstandard extension.) + + The following is an example of a recursive function. It takes a +string as an input parameter and returns the string in backwards order. +Recursive functions must always have a test that stops the recursion. +In this case, the recursion terminates when the starting position is +zero, i.e., when there are no more characters left in the string. + + function rev(str, start) + { + if (start == 0) + return "" + + return (substr(str, start, 1) rev(str, start - 1)) + } + + If this function is in a file named `rev.awk', it can be tested this +way: + + $ echo "Don't Panic!" | + > gawk --source '{ print rev($0, length($0)) }' -f rev.awk + -| !cinaP t'noD + + The C `ctime' function takes a timestamp and returns it in a string, +formatted in a well-known fashion. The following example uses the +built-in `strftime' function (*note Time Functions::) to create an +`awk' version of `ctime': + + # ctime.awk + # + # awk version of C ctime(3) function + + function ctime(ts, format) + { + format = "%a %b %d %H:%M:%S %Z %Y" + if (ts == 0) + ts = systime() # use current time as default + return strftime(format, ts) + } + + +File: gawk.info, Node: Function Caveats, Next: Return Statement, Prev: Function Example, Up: User-defined + +8.2.3 Calling User-Defined Functions +------------------------------------ + +"Calling a function" means causing the function to run and do its job. +A function call is an expression and its value is the value returned by +the function. + + A function call consists of the function name followed by the +arguments in parentheses. `awk' expressions are what you write in the +call for the arguments. Each time the call is executed, these +expressions are evaluated, and the values are the actual arguments. For +example, here is a call to `foo' with three arguments (the first being +a string concatenation): + + foo(x y, "lose", 4 * z) + + *Caution:* Whitespace characters (spaces and tabs) are not allowed +between the function name and the open-parenthesis of the argument list. +If you write whitespace by mistake, `awk' might think that you mean to +concatenate a variable with an expression in parentheses. However, it +notices that you used a function name and not a variable name, and +reports an error. + + When a function is called, it is given a _copy_ of the values of its +arguments. This is known as "call by value". The caller may use a +variable as the expression for the argument, but the called function +does not know this--it only knows what value the argument had. For +example, if you write the following code: + + foo = "bar" + z = myfunc(foo) + +then you should not think of the argument to `myfunc' as being "the +variable `foo'." Instead, think of the argument as the string value +`"bar"'. If the function `myfunc' alters the values of its local +variables, this has no effect on any other variables. Thus, if `myfunc' +does this: + + function myfunc(str) + { + print str + str = "zzz" + print str + } + +to change its first argument variable `str', it does _not_ change the +value of `foo' in the caller. The role of `foo' in calling `myfunc' +ended when its value (`"bar"') was computed. If `str' also exists +outside of `myfunc', the function body cannot alter this outer value, +because it is shadowed during the execution of `myfunc' and cannot be +seen or changed from there. + + However, when arrays are the parameters to functions, they are _not_ +copied. Instead, the array itself is made available for direct +manipulation by the function. This is usually called "call by +reference". Changes made to an array parameter inside the body of a +function _are_ visible outside that function. + + NOTE: Changing an array parameter inside a function can be very + dangerous if you do not watch what you are doing. For example: + + function changeit(array, ind, nvalue) + { + array[ind] = nvalue + } + + BEGIN { + a[1] = 1; a[2] = 2; a[3] = 3 + changeit(a, 2, "two") + printf "a[1] = %s, a[2] = %s, a[3] = %s\n", + a[1], a[2], a[3] + } + + prints `a[1] = 1, a[2] = two, a[3] = 3', because `changeit' stores + `"two"' in the second element of `a'. + + Some `awk' implementations allow you to call a function that has not +been defined. They only report a problem at runtime when the program +actually tries to call the function. For example: + + BEGIN { + if (0) + foo() + else + bar() + } + function bar() { ... } + # note that `foo' is not defined + +Because the `if' statement will never be true, it is not really a +problem that `foo' has not been defined. Usually, though, it is a +problem if a program calls an undefined function. + + If `--lint' is specified (*note Options::), `gawk' reports calls to +undefined functions. + + Some `awk' implementations generate a runtime error if you use the +`next' statement (*note Next Statement::) inside a user-defined +function. `gawk' does not have this limitation. + + +File: gawk.info, Node: Return Statement, Next: Dynamic Typing, Prev: Function Caveats, Up: User-defined + +8.2.4 The `return' Statement +---------------------------- + +The body of a user-defined function can contain a `return' statement. +This statement returns control to the calling part of the `awk' +program. It can also be used to return a value for use in the rest of +the `awk' program. It looks like this: + + return [EXPRESSION] + + The EXPRESSION part is optional. If it is omitted, then the returned +value is undefined, and therefore, unpredictable. + + A `return' statement with no value expression is assumed at the end +of every function definition. So if control reaches the end of the +function body, then the function returns an unpredictable value. `awk' +does _not_ warn you if you use the return value of such a function. + + Sometimes, you want to write a function for what it does, not for +what it returns. Such a function corresponds to a `void' function in C +or to a `procedure' in Pascal. Thus, it may be appropriate to not +return any value; simply bear in mind that if you use the return value +of such a function, you do so at your own risk. + + The following is an example of a user-defined function that returns +a value for the largest number among the elements of an array: + + function maxelt(vec, i, ret) + { + for (i in vec) { + if (ret == "" || vec[i] > ret) + ret = vec[i] + } + return ret + } + +You call `maxelt' with one argument, which is an array name. The local +variables `i' and `ret' are not intended to be arguments; while there +is nothing to stop you from passing more than one argument to `maxelt', +the results would be strange. The extra space before `i' in the +function parameter list indicates that `i' and `ret' are not supposed +to be arguments. You should follow this convention when defining +functions. + + The following program uses the `maxelt' function. It loads an +array, calls `maxelt', and then reports the maximum number in that +array: + + function maxelt(vec, i, ret) + { + for (i in vec) { + if (ret == "" || vec[i] > ret) + ret = vec[i] + } + return ret + } + + # Load all fields of each record into nums. + { + for(i = 1; i <= NF; i++) + nums[NR, i] = $i + } + + END { + print maxelt(nums) + } + + Given the following input: + + 1 5 23 8 16 + 44 3 5 2 8 26 + 256 291 1396 2962 100 + -6 467 998 1101 + 99385 11 0 225 + +the program reports (predictably) that `99385' is the largest number in +the array. + + +File: gawk.info, Node: Dynamic Typing, Prev: Return Statement, Up: User-defined + +8.2.5 Functions and Their Effects on Variable Typing +---------------------------------------------------- + +`awk' is a very fluid language. It is possible that `awk' can't tell +if an identifier represents a regular variable or an array until +runtime. Here is an annotated sample program: + + function foo(a) + { + a[1] = 1 # parameter is an array + } + + BEGIN { + b = 1 + foo(b) # invalid: fatal type mismatch + + foo(x) # x uninitialized, becomes an array dynamically + x = 1 # now not allowed, runtime error + } + + Usually, such things aren't a big issue, but it's worth being aware +of them. + + +File: gawk.info, Node: Internationalization, Next: Advanced Features, Prev: Functions, Up: Top + +9 Internationalization with `gawk' +********************************** + +Once upon a time, computer makers wrote software that worked only in +English. Eventually, hardware and software vendors noticed that if +their systems worked in the native languages of non-English-speaking +countries, they were able to sell more systems. As a result, +internationalization and localization of programs and software systems +became a common practice. + + Until recently, the ability to provide internationalization was +largely restricted to programs written in C and C++. This major node +describes the underlying library `gawk' uses for internationalization, +as well as how `gawk' makes internationalization features available at +the `awk' program level. Having internationalization available at the +`awk' level gives software developers additional flexibility--they are +no longer required to write in C when internationalization is a +requirement. + +* Menu: + +* I18N and L10N:: Internationalization and Localization. +* Explaining gettext:: How GNU `gettext' works. +* Programmer i18n:: Features for the programmer. +* Translator i18n:: Features for the translator. +* I18N Example:: A simple i18n example. +* Gawk I18N:: `gawk' is also internationalized. + + +File: gawk.info, Node: I18N and L10N, Next: Explaining gettext, Up: Internationalization + +9.1 Internationalization and Localization +========================================= + +"Internationalization" means writing (or modifying) a program once, in +such a way that it can use multiple languages without requiring further +source-code changes. "Localization" means providing the data necessary +for an internationalized program to work in a particular language. +Most typically, these terms refer to features such as the language used +for printing error messages, the language used to read responses, and +information related to how numerical and monetary values are printed +and read. + + +File: gawk.info, Node: Explaining gettext, Next: Programmer i18n, Prev: I18N and L10N, Up: Internationalization + +9.2 GNU `gettext' +================= + +The facilities in GNU `gettext' focus on messages; strings printed by a +program, either directly or via formatting with `printf' or +`sprintf'.(1) + + When using GNU `gettext', each application has its own "text +domain". This is a unique name, such as `kpilot' or `gawk', that +identifies the application. A complete application may have multiple +components--programs written in C or C++, as well as scripts written in +`sh' or `awk'. All of the components use the same text domain. + + To make the discussion concrete, assume we're writing an application +named `guide'. Internationalization consists of the following steps, +in this order: + + 1. The programmer goes through the source for all of `guide''s + components and marks each string that is a candidate for + translation. For example, `"`-F': option required"' is a good + candidate for translation. A table with strings of option names + is not (e.g., `gawk''s `--profile' option should remain the same, + no matter what the local language). + + 2. The programmer indicates the application's text domain (`"guide"') + to the `gettext' library, by calling the `textdomain' function. + + 3. Messages from the application are extracted from the source code + and collected into a portable object file (`guide.po'), which + lists the strings and their translations. The translations are + initially empty. The original (usually English) messages serve as + the key for lookup of the translations. + + 4. For each language with a translator, `guide.po' is copied and + translations are created and shipped with the application. + + 5. Each language's `.po' file is converted into a binary message + object (`.mo') file. A message object file contains the original + messages and their translations in a binary format that allows + fast lookup of translations at runtime. + + 6. When `guide' is built and installed, the binary translation files + are installed in a standard place. + + 7. For testing and development, it is possible to tell `gettext' to + use `.mo' files in a different directory than the standard one by + using the `bindtextdomain' function. + + 8. At runtime, `guide' looks up each string via a call to `gettext'. + The returned string is the translated string if available, or the + original string if not. + + 9. If necessary, it is possible to access messages from a different + text domain than the one belonging to the application, without + having to switch the application's default text domain back and + forth. + + In C (or C++), the string marking and dynamic translation lookup are +accomplished by wrapping each string in a call to `gettext': + + printf(gettext("Don't Panic!\n")); + + The tools that extract messages from source code pull out all +strings enclosed in calls to `gettext'. + + The GNU `gettext' developers, recognizing that typing `gettext' over +and over again is both painful and ugly to look at, use the macro `_' +(an underscore) to make things easier: + + /* In the standard header file: */ + #define _(str) gettext(str) + + /* In the program text: */ + printf(_("Don't Panic!\n")); + +This reduces the typing overhead to just three extra characters per +string and is considerably easier to read as well. There are locale +"categories" for different types of locale-related information. The +defined locale categories that `gettext' knows about are: + +`LC_MESSAGES' + Text messages. This is the default category for `gettext' + operations, but it is possible to supply a different one + explicitly, if necessary. (It is almost never necessary to supply + a different category.) + +`LC_COLLATE' + Text-collation information; i.e., how different characters and/or + groups of characters sort in a given language. + +`LC_CTYPE' + Character-type information (alphabetic, digit, upper- or + lowercase, and so on). This information is accessed via the POSIX + character classes in regular expressions, such as `/[[:alnum:]]/' + (*note Regexp Operators::). + +`LC_MONETARY' + Monetary information, such as the currency symbol, and whether the + symbol goes before or after a number. + +`LC_NUMERIC' + Numeric information, such as which characters to use for the + decimal point and the thousands separator.(2) + +`LC_RESPONSE' + Response information, such as how "yes" and "no" appear in the + local language, and possibly other information as well. + +`LC_TIME' + Time- and date-related information, such as 12- or 24-hour clock, + month printed before or after day in a date, local month + abbreviations, and so on. + +`LC_ALL' + All of the above. (Not too useful in the context of `gettext'.) + + ---------- Footnotes ---------- + + (1) For some operating systems, the `gawk' port doesn't support GNU +`gettext'. This applies most notably to the PC operating systems. As +such, these features are not available if you are using one of those +operating systems. Sorry. + + (2) Americans use a comma every three decimal places and a period +for the decimal point, while many Europeans do exactly the opposite: +`1,234.56' versus `1.234,56'. + + +File: gawk.info, Node: Programmer i18n, Next: Translator i18n, Prev: Explaining gettext, Up: Internationalization + +9.3 Internationalizing `awk' Programs +===================================== + +`gawk' provides the following variables and functions for +internationalization: + +`TEXTDOMAIN' + This variable indicates the application's text domain. For + compatibility with GNU `gettext', the default value is + `"messages"'. + +`_"your message here"' + String constants marked with a leading underscore are candidates + for translation at runtime. String constants without a leading + underscore are not translated. + +`dcgettext(STRING [, DOMAIN [, CATEGORY]])' + This built-in function returns the translation of STRING in text + domain DOMAIN for locale category CATEGORY. The default value for + DOMAIN is the current value of `TEXTDOMAIN'. The default value + for CATEGORY is `"LC_MESSAGES"'. + + If you supply a value for CATEGORY, it must be a string equal to + one of the known locale categories described in *note Explaining + gettext::. You must also supply a text domain. Use `TEXTDOMAIN' + if you want to use the current domain. + + *Caution:* The order of arguments to the `awk' version of the + `dcgettext' function is purposely different from the order for the + C version. The `awk' version's order was chosen to be simple and + to allow for reasonable `awk'-style default arguments. + +`dcngettext(STRING1, STRING2, NUMBER [, DOMAIN [, CATEGORY]])' + This built-in function returns the plural form used for NUMBER of + the translation of STRING1 and STRING2 in text domain DOMAIN for + locale category CATEGORY. STRING1 is the English singular variant + of a message, and STRING2 the English plural variant of the same + message. The default value for DOMAIN is the current value of + `TEXTDOMAIN'. The default value for CATEGORY is `"LC_MESSAGES"'. + + The same remarks as for the `dcgettext' function apply. + +`bindtextdomain(DIRECTORY [, DOMAIN])' + This built-in function allows you to specify the directory in which + `gettext' looks for `.mo' files, in case they will not or cannot + be placed in the standard locations (e.g., during testing). It + returns the directory in which DOMAIN is "bound." + + The default DOMAIN is the value of `TEXTDOMAIN'. If DIRECTORY is + the null string (`""'), then `bindtextdomain' returns the current + binding for the given DOMAIN. + + To use these facilities in your `awk' program, follow the steps +outlined in *note Explaining gettext::, like so: + + 1. Set the variable `TEXTDOMAIN' to the text domain of your program. + This is best done in a `BEGIN' rule (*note BEGIN/END::), or it can + also be done via the `-v' command-line option (*note Options::): + + BEGIN { + TEXTDOMAIN = "guide" + ... + } + + 2. Mark all translatable strings with a leading underscore (`_') + character. It _must_ be adjacent to the opening quote of the + string. For example: + + print _"hello, world" + x = _"you goofed" + printf(_"Number of users is %d\n", nusers) + + 3. If you are creating strings dynamically, you can still translate + them, using the `dcgettext' built-in function: + + message = nusers " users logged in" + message = dcgettext(message, "adminprog") + print message + + Here, the call to `dcgettext' supplies a different text domain + (`"adminprog"') in which to find the message, but it uses the + default `"LC_MESSAGES"' category. + + 4. During development, you might want to put the `.mo' file in a + private directory for testing. This is done with the + `bindtextdomain' built-in function: + + BEGIN { + TEXTDOMAIN = "guide" # our text domain + if (Testing) { + # where to find our files + bindtextdomain("testdir") + # joe is in charge of adminprog + bindtextdomain("../joe/testdir", "adminprog") + } + ... + } + + + *Note I18N Example::, for an example program showing the steps to +create and use translations from `awk'. + + +File: gawk.info, Node: Translator i18n, Next: I18N Example, Prev: Programmer i18n, Up: Internationalization + +9.4 Translating `awk' Programs +============================== + +Once a program's translatable strings have been marked, they must be +extracted to create the initial `.po' file. As part of translation, it +is often helpful to rearrange the order in which arguments to `printf' +are output. + + `gawk''s `--gen-po' command-line option extracts the messages and is +discussed next. After that, `printf''s ability to rearrange the order +for `printf' arguments at runtime is covered. + +* Menu: + +* String Extraction:: Extracting marked strings. +* Printf Ordering:: Rearranging `printf' arguments. +* I18N Portability:: `awk'-level portability issues. + + +File: gawk.info, Node: String Extraction, Next: Printf Ordering, Up: Translator i18n + +9.4.1 Extracting Marked Strings +------------------------------- + +Once your `awk' program is working, and all the strings have been +marked and you've set (and perhaps bound) the text domain, it is time +to produce translations. First, use the `--gen-po' command-line option +to create the initial `.po' file: + + $ gawk --gen-po -f guide.awk > guide.po + + When run with `--gen-po', `gawk' does not execute your program. +Instead, it parses it as usual and prints all marked strings to +standard output in the format of a GNU `gettext' Portable Object file. +Also included in the output are any constant strings that appear as the +first argument to `dcgettext' or as the first and second argument to +`dcngettext'.(1) *Note I18N Example::, for the full list of steps to go +through to create and test translations for `guide'. + + ---------- Footnotes ---------- + + (1) Starting with `gettext' version 0.11.5, the `xgettext' utility +that comes with GNU `gettext' can handle `.awk' files. + + +File: gawk.info, Node: Printf Ordering, Next: I18N Portability, Prev: String Extraction, Up: Translator i18n + +9.4.2 Rearranging `printf' Arguments +------------------------------------ + +Format strings for `printf' and `sprintf' (*note Printf::) present a +special problem for translation. Consider the following:(1) + + printf(_"String `%s' has %d characters\n", + string, length(string))) + + A possible German translation for this might be: + + "%d Zeichen lang ist die Zeichenkette `%s'\n" + + The problem should be obvious: the order of the format +specifications is different from the original! Even though `gettext' +can return the translated string at runtime, it cannot change the +argument order in the call to `printf'. + + To solve this problem, `printf' format specifiers may have an +additional optional element, which we call a "positional specifier". +For example: + + "%2$d Zeichen lang ist die Zeichenkette `%1$s'\n" + + Here, the positional specifier consists of an integer count, which +indicates which argument to use, and a `$'. Counts are one-based, and +the format string itself is _not_ included. Thus, in the following +example, `string' is the first argument and `length(string)' is the +second: + + $ gawk 'BEGIN { + > string = "Dont Panic" + > printf _"%2$d characters live in \"%1$s\"\n", + > string, length(string) + > }' + -| 10 characters live in "Dont Panic" + + If present, positional specifiers come first in the format +specification, before the flags, the field width, and/or the precision. + + Positional specifiers can be used with the dynamic field width and +precision capability: + + $ gawk 'BEGIN { + > printf("%*.*s\n", 10, 20, "hello") + > printf("%3$*2$.*1$s\n", 20, 10, "hello") + > }' + -| hello + -| hello + + NOTE: When using `*' with a positional specifier, the `*' comes + first, then the integer position, and then the `$'. This is + somewhat counterintuitive. + + `gawk' does not allow you to mix regular format specifiers and those +with positional specifiers in the same string: + + $ gawk 'BEGIN { printf _"%d %3$s\n", 1, 2, "hi" }' + error--> gawk: cmd. line:1: fatal: must use `count$' on all formats or none + + NOTE: There are some pathological cases that `gawk' may fail to + diagnose. In such cases, the output may not be what you expect. + It's still a bad idea to try mixing them, even if `gawk' doesn't + detect it. + + Although positional specifiers can be used directly in `awk' +programs, their primary purpose is to help in producing correct +translations of format strings into languages different from the one in +which the program is first written. + + ---------- Footnotes ---------- + + (1) This example is borrowed from the GNU `gettext' manual. + + +File: gawk.info, Node: I18N Portability, Prev: Printf Ordering, Up: Translator i18n + +9.4.3 `awk' Portability Issues +------------------------------ + +`gawk''s internationalization features were purposely chosen to have as +little impact as possible on the portability of `awk' programs that use +them to other versions of `awk'. Consider this program: + + BEGIN { + TEXTDOMAIN = "guide" + if (Test_Guide) # set with -v + bindtextdomain("/test/guide/messages") + print _"don't panic!" + } + +As written, it won't work on other versions of `awk'. However, it is +actually almost portable, requiring very little change: + + * Assignments to `TEXTDOMAIN' won't have any effect, since + `TEXTDOMAIN' is not special in other `awk' implementations. + + * Non-GNU versions of `awk' treat marked strings as the + concatenation of a variable named `_' with the string following + it.(1) Typically, the variable `_' has the null string (`""') as + its value, leaving the original string constant as the result. + + * By defining "dummy" functions to replace `dcgettext', `dcngettext' + and `bindtextdomain', the `awk' program can be made to run, but + all the messages are output in the original language. For example: + + function bindtextdomain(dir, domain) + { + return dir + } + + function dcgettext(string, domain, category) + { + return string + } + + function dcngettext(string1, string2, number, domain, category) + { + return (number == 1 ? string1 : string2) + } + + * The use of positional specifications in `printf' or `sprintf' is + _not_ portable. To support `gettext' at the C level, many + systems' C versions of `sprintf' do support positional specifiers. + But it works only if enough arguments are supplied in the function + call. Many versions of `awk' pass `printf' formats and arguments + unchanged to the underlying C library version of `sprintf', but + only one format and argument at a time. What happens if a + positional specification is used is anybody's guess. However, + since the positional specifications are primarily for use in + _translated_ format strings, and since non-GNU `awk's never + retrieve the translated string, this should not be a problem in + practice. + + ---------- Footnotes ---------- + + (1) This is good fodder for an "Obfuscated `awk'" contest. + + +File: gawk.info, Node: I18N Example, Next: Gawk I18N, Prev: Translator i18n, Up: Internationalization + +9.5 A Simple Internationalization Example +========================================= + +Now let's look at a step-by-step example of how to internationalize and +localize a simple `awk' program, using `guide.awk' as our original +source: + + BEGIN { + TEXTDOMAIN = "guide" + bindtextdomain(".") # for testing + print _"Don't Panic" + print _"The Answer Is", 42 + print "Pardon me, Zaphod who?" + } + +Run `gawk --gen-po' to create the `.po' file: + + $ gawk --gen-po -f guide.awk > guide.po + +This produces: + + #: guide.awk:4 + msgid "Don't Panic" + msgstr "" + + #: guide.awk:5 + msgid "The Answer Is" + msgstr "" + + This original portable object file is saved and reused for each +language into which the application is translated. The `msgid' is the +original string and the `msgstr' is the translation. + + NOTE: Strings not marked with a leading underscore do not appear + in the `guide.po' file. + + Next, the messages must be translated. Here is a translation to a +hypothetical dialect of English, called "Mellow":(1) + + $ cp guide.po guide-mellow.po + ADD TRANSLATIONS TO guide-mellow.po ... + +Following are the translations: + + #: guide.awk:4 + msgid "Don't Panic" + msgstr "Hey man, relax!" + + #: guide.awk:5 + msgid "The Answer Is" + msgstr "Like, the scoop is" + + The next step is to make the directory to hold the binary message +object file and then to create the `guide.mo' file. The directory +layout shown here is standard for GNU `gettext' on GNU/Linux systems. +Other versions of `gettext' may use a different layout: + + $ mkdir en_US en_US/LC_MESSAGES + + The `msgfmt' utility does the conversion from human-readable `.po' +file to machine-readable `.mo' file. By default, `msgfmt' creates a +file named `messages'. This file must be renamed and placed in the +proper directory so that `gawk' can find it: + + $ msgfmt guide-mellow.po + $ mv messages en_US/LC_MESSAGES/guide.mo + + Finally, we run the program to test it: + + $ gawk -f guide.awk + -| Hey man, relax! + -| Like, the scoop is 42 + -| Pardon me, Zaphod who? + + If the three replacement functions for `dcgettext', `dcngettext' and +`bindtextdomain' (*note I18N Portability::) are in a file named +`libintl.awk', then we can run `guide.awk' unchanged as follows: + + $ gawk --posix -f guide.awk -f libintl.awk + -| Don't Panic + -| The Answer Is 42 + -| Pardon me, Zaphod who? + + ---------- Footnotes ---------- + + (1) Perhaps it would be better if it were called "Hippy." Ah, well. + + +File: gawk.info, Node: Gawk I18N, Prev: I18N Example, Up: Internationalization + +9.6 `gawk' Can Speak Your Language +================================== + +As of version 3.1, `gawk' itself has been internationalized using the +GNU `gettext' package. (GNU `gettext' is described in complete detail +in *note Top::.) As of this writing, the latest version of GNU +`gettext' is version 0.11.5 +(ftp://ftp.gnu.org/gnu/gettext/gettext-0.11.5.tar.gz). + + If a translation of `gawk''s messages exists, then `gawk' produces +usage messages, warnings, and fatal errors in the local language. + + +File: gawk.info, Node: Advanced Features, Next: Invoking Gawk, Prev: Internationalization, Up: Top + +10 Advanced Features of `gawk' +****************************** + + Write documentation as if whoever reads it is a violent psychopath + who knows where you live. + Steve English, as quoted by Peter Langston + + This major node discusses advanced features in `gawk'. It's a bit +of a "grab bag" of items that are otherwise unrelated to each other. +First, a command-line option allows `gawk' to recognize nondecimal +numbers in input data, not just in `awk' programs. Next, two-way I/O, +discussed briefly in earlier parts of this Info file, is described in +full detail, along with the basics of TCP/IP networking and BSD portal +files. Finally, `gawk' can "profile" an `awk' program, making it +possible to tune it for performance. + + *note Dynamic Extensions::, discusses the ability to dynamically add +new built-in functions to `gawk'. As this feature is still immature +and likely to change, its description is relegated to an appendix. + +* Menu: + +* Nondecimal Data:: Allowing nondecimal input data. +* Two-way I/O:: Two-way communications with another process. +* TCP/IP Networking:: Using `gawk' for network programming. +* Portal Files:: Using `gawk' with BSD portals. +* Profiling:: Profiling your `awk' programs. + + +File: gawk.info, Node: Nondecimal Data, Next: Two-way I/O, Up: Advanced Features + +10.1 Allowing Nondecimal Input Data +=================================== + +If you run `gawk' with the `--non-decimal-data' option, you can have +nondecimal constants in your input data: + + $ echo 0123 123 0x123 | + > gawk --non-decimal-data '{ printf "%d, %d, %d\n", + > $1, $2, $3 }' + -| 83, 123, 291 + + For this feature to work, write your program so that `gawk' treats +your data as numeric: + + $ echo 0123 123 0x123 | gawk '{ print $1, $2, $3 }' + -| 0123 123 0x123 + +The `print' statement treats its expressions as strings. Although the +fields can act as numbers when necessary, they are still strings, so +`print' does not try to treat them numerically. You may need to add +zero to a field to force it to be treated as a number. For example: + + $ echo 0123 123 0x123 | gawk --non-decimal-data ' + > { print $1, $2, $3 + > print $1 + 0, $2 + 0, $3 + 0 }' + -| 0123 123 0x123 + -| 83 123 291 + + Because it is common to have decimal data with leading zeros, and +because using it could lead to surprising results, the default is to +leave this facility disabled. If you want it, you must explicitly +request it. + + *Caution:* _Use of this option is not recommended._ It can break old +programs very badly. Instead, use the `strtonum' function to convert +your data (*note Nondecimal-numbers::). This makes your programs +easier to write and easier to read, and leads to less surprising +results. + + +File: gawk.info, Node: Two-way I/O, Next: TCP/IP Networking, Prev: Nondecimal Data, Up: Advanced Features + +10.2 Two-Way Communications with Another Process +================================================ + + From: brennan@whidbey.com (Mike Brennan) + Newsgroups: comp.lang.awk + Subject: Re: Learn the SECRET to Attract Women Easily + Date: 4 Aug 1997 17:34:46 GMT + Message-ID: <5s53rm$eca@news.whidbey.com> + + On 3 Aug 1997 13:17:43 GMT, Want More Dates??? + <tracy78@kilgrona.com> wrote: + >Learn the SECRET to Attract Women Easily + > + >The SCENT(tm) Pheromone Sex Attractant For Men to Attract Women + + The scent of awk programmers is a lot more attractive to women than + the scent of perl programmers. + -- + Mike Brennan + + It is often useful to be able to send data to a separate program for +processing and then read the result. This can always be done with +temporary files: + + # write the data for processing + tempfile = ("mydata." PROCINFO["pid"]) + while (NOT DONE WITH DATA) + print DATA | ("subprogram > " tempfile) + close("subprogram > " tempfile) + + # read the results, remove tempfile when done + while ((getline newdata < tempfile) > 0) + PROCESS newdata APPROPRIATELY + close(tempfile) + system("rm " tempfile) + +This works, but not elegantly. Among other things, it requires that +the program be run in a directory that cannot be shared among users; +for example, `/tmp' will not do, as another user might happen to be +using a temporary file with the same name. + + Starting with version 3.1 of `gawk', it is possible to open a +_two-way_ pipe to another process. The second process is termed a +"coprocess", since it runs in parallel with `gawk'. The two-way +connection is created using the new `|&' operator (borrowed from the +Korn shell, `ksh'):(1) + + do { + print DATA |& "subprogram" + "subprogram" |& getline results + } while (DATA LEFT TO PROCESS) + close("subprogram") + + The first time an I/O operation is executed using the `|&' operator, +`gawk' creates a two-way pipeline to a child process that runs the +other program. Output created with `print' or `printf' is written to +the program's standard input, and output from the program's standard +output can be read by the `gawk' program using `getline'. As is the +case with processes started by `|', the subprogram can be any program, +or pipeline of programs, that can be started by the shell. + + There are some cautionary items to be aware of: + + * As the code inside `gawk' currently stands, the coprocess's + standard error goes to the same place that the parent `gawk''s + standard error goes. It is not possible to read the child's + standard error separately. + + * I/O buffering may be a problem. `gawk' automatically flushes all + output down the pipe to the child process. However, if the + coprocess does not flush its output, `gawk' may hang when doing a + `getline' in order to read the coprocess's results. This could + lead to a situation known as "deadlock", where each process is + waiting for the other one to do something. + + It is possible to close just one end of the two-way pipe to a +coprocess, by supplying a second argument to the `close' function of +either `"to"' or `"from"' (*note Close Files And Pipes::). These +strings tell `gawk' to close the end of the pipe that sends data to the +process or the end that reads from it, respectively. + + This is particularly necessary in order to use the system `sort' +utility as part of a coprocess; `sort' must read _all_ of its input +data before it can produce any output. The `sort' program does not +receive an end-of-file indication until `gawk' closes the write end of +the pipe. + + When you have finished writing data to the `sort' utility, you can +close the `"to"' end of the pipe, and then start reading sorted data +via `getline'. For example: + + BEGIN { + command = "LC_ALL=C sort" + n = split("abcdefghijklmnopqrstuvwxyz", a, "") + + for (i = n; i > 0; i--) + print a[i] |& command + close(command, "to") + + while ((command |& getline line) > 0) + print "got", line + close(command) + } + + This program writes the letters of the alphabet in reverse order, one +per line, down the two-way pipe to `sort'. It then closes the write +end of the pipe, so that `sort' receives an end-of-file indication. +This causes `sort' to sort the data and write the sorted data back to +the `gawk' program. Once all of the data has been read, `gawk' +terminates the coprocess and exits. + + As a side note, the assignment `LC_ALL=C' in the `sort' command +ensures traditional Unix (ASCII) sorting from `sort'. + + Beginning with `gawk' 3.1.2, you may use Pseudo-ttys (ptys) for +two-way communication instead of pipes, if your system supports them. +This is done on a per-command basis, by setting a special element in +the `PROCINFO' array (*note Auto-set::), like so: + + command = "sort -nr" # command, saved in variable for convenience + PROCINFO[command, "pty"] = 1 # update PROCINFO + print ... |& command # start two-way pipe + ... + +Using ptys avoids the buffer deadlock issues described earlier, at some +loss in performance. If your system does not have ptys, or if all the +system's ptys are in use, `gawk' automatically falls back to using +regular pipes. + + ---------- Footnotes ---------- + + (1) This is very different from the same operator in the C shell, +`csh'. + + +File: gawk.info, Node: TCP/IP Networking, Next: Portal Files, Prev: Two-way I/O, Up: Advanced Features + +10.3 Using `gawk' for Network Programming +========================================= + + `EMISTERED': A host is a host from coast to coast, + and no-one can talk to host that's close, + unless the host that isn't close + is busy hung or dead. + + In addition to being able to open a two-way pipeline to a coprocess +on the same system (*note Two-way I/O::), it is possible to make a +two-way connection to another process on another system across an IP +networking connection. + + You can think of this as just a _very long_ two-way pipeline to a +coprocess. The way `gawk' decides that you want to use TCP/IP +networking is by recognizing special file names that begin with +`/inet/'. + + The full syntax of the special file name is +`/inet/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT'. The components +are: + +PROTOCOL + The protocol to use over IP. This must be either `tcp', `udp', or + `raw', for a TCP, UDP, or raw IP connection, respectively. The + use of TCP is recommended for most applications. + + *Caution:* The use of raw sockets is not currently supported in + version 3.1 of `gawk'. + +LOCAL-PORT + The local TCP or UDP port number to use. Use a port number of `0' + when you want the system to pick a port. This is what you should do + when writing a TCP or UDP client. You may also use a well-known + service name, such as `smtp' or `http', in which case `gawk' + attempts to determine the predefined port number using the C + `getservbyname' function. + +REMOTE-HOST + The IP address or fully-qualified domain name of the Internet host + to which you want to connect. + +REMOTE-PORT + The TCP or UDP port number to use on the given REMOTE-HOST. + Again, use `0' if you don't care, or else a well-known service + name. + + Consider the following very simple example: + + BEGIN { + Service = "/inet/tcp/0/localhost/daytime" + Service |& getline + print $0 + close(Service) + } + + This program reads the current date and time from the local system's +TCP `daytime' server. It then prints the results and closes the +connection. + + Because this topic is extensive, the use of `gawk' for TCP/IP +programming is documented separately. *Note Top::, for a much more +complete introduction and discussion, as well as extensive examples. + + +File: gawk.info, Node: Portal Files, Next: Profiling, Prev: TCP/IP Networking, Up: Advanced Features + +10.4 Using `gawk' with BSD Portals +================================== + +Similar to the `/inet' special files, if `gawk' is configured with the +`--enable-portals' option (*note Quick Installation::), then `gawk' +treats files whose pathnames begin with `/p' as 4.4 BSD-style portals. + + When used with the `|&' operator, `gawk' opens the file for two-way +communications. The operating system's portal mechanism then manages +creating the process associated with the portal and the corresponding +communications with the portal's process. + + +File: gawk.info, Node: Profiling, Prev: Portal Files, Up: Advanced Features + +10.5 Profiling Your `awk' Programs +================================== + +Beginning with version 3.1 of `gawk', you may produce execution traces +of your `awk' programs. This is done with a specially compiled version +of `gawk', called `pgawk' ("profiling `gawk'"). + + `pgawk' is identical in every way to `gawk', except that when it has +finished running, it creates a profile of your program in a file named +`awkprof.out'. Because it is profiling, it also executes up to 45% +slower than `gawk' normally does. + + As shown in the following example, the `--profile' option can be +used to change the name of the file where `pgawk' will write the +profile: + + $ pgawk --profile=myprog.prof -f myprog.awk data1 data2 + +In the above example, `pgawk' places the profile in `myprog.prof' +instead of in `awkprof.out'. + + Regular `gawk' also accepts this option. When called with just +`--profile', `gawk' "pretty prints" the program into `awkprof.out', +without any execution counts. You may supply an option to `--profile' +to change the file name. Here is a sample session showing a simple +`awk' program, its input data, and the results from running `pgawk'. +First, the `awk' program: + + BEGIN { print "First BEGIN rule" } + + END { print "First END rule" } + + /foo/ { + print "matched /foo/, gosh" + for (i = 1; i <= 3; i++) + sing() + } + + { + if (/foo/) + print "if is true" + else + print "else is true" + } + + BEGIN { print "Second BEGIN rule" } + + END { print "Second END rule" } + + function sing( dummy) + { + print "I gotta be me!" + } + + Following is the input data: + + foo + bar + baz + foo + junk + + Here is the `awkprof.out' that results from running `pgawk' on this +program and data (this example also illustrates that `awk' programmers +sometimes have to work late): + + # gawk profile, created Sun Aug 13 00:00:15 2000 + + # BEGIN block(s) + + BEGIN { + 1 print "First BEGIN rule" + 1 print "Second BEGIN rule" + } + + # Rule(s) + + 5 /foo/ { # 2 + 2 print "matched /foo/, gosh" + 6 for (i = 1; i <= 3; i++) { + 6 sing() + } + } + + 5 { + 5 if (/foo/) { # 2 + 2 print "if is true" + 3 } else { + 3 print "else is true" + } + } + + # END block(s) + + END { + 1 print "First END rule" + 1 print "Second END rule" + } + + # Functions, listed alphabetically + + 6 function sing(dummy) + { + 6 print "I gotta be me!" + } + + This example illustrates many of the basic rules for profiling +output. The rules are as follows: + + * The program is printed in the order `BEGIN' rule, pattern/action + rules, `END' rule and functions, listed alphabetically. Multiple + `BEGIN' and `END' rules are merged together. + + * Pattern-action rules have two counts. The first count, to the + left of the rule, shows how many times the rule's pattern was + _tested_. The second count, to the right of the rule's opening + left brace in a comment, shows how many times the rule's action + was _executed_. The difference between the two indicates how many + times the rule's pattern evaluated to false. + + * Similarly, the count for an `if'-`else' statement shows how many + times the condition was tested. To the right of the opening left + brace for the `if''s body is a count showing how many times the + condition was true. The count for the `else' indicates how many + times the test failed. + + * The count for a loop header (such as `for' or `while') shows how + many times the loop test was executed. (Because of this, you + can't just look at the count on the first statement in a rule to + determine how many times the rule was executed. If the first + statement is a loop, the count is misleading.) + + * For user-defined functions, the count next to the `function' + keyword indicates how many times the function was called. The + counts next to the statements in the body show how many times + those statements were executed. + + * The layout uses "K&R" style with tabs. Braces are used + everywhere, even when the body of an `if', `else', or loop is only + a single statement. + + * Parentheses are used only where needed, as indicated by the + structure of the program and the precedence rules. For example, + `(3 + 5) * 4' means add three plus five, then multiply the total + by four. However, `3 + 5 * 4' has no parentheses, and means `3 + + (5 * 4)'. + + * Parentheses are used around the arguments to `print' and `printf' + only when the `print' or `printf' statement is followed by a + redirection. Similarly, if the target of a redirection isn't a + scalar, it gets parenthesized. + + * `pgawk' supplies leading comments in front of the `BEGIN' and + `END' rules, the pattern/action rules, and the functions. + + + The profiled version of your program may not look exactly like what +you typed when you wrote it. This is because `pgawk' creates the +profiled version by "pretty printing" its internal representation of +the program. The advantage to this is that `pgawk' can produce a +standard representation. The disadvantage is that all source-code +comments are lost, as are the distinctions among multiple `BEGIN' and +`END' rules. Also, things such as: + + /foo/ + +come out as: + + /foo/ { + print $0 + } + +which is correct, but possibly surprising. + + Besides creating profiles when a program has completed, `pgawk' can +produce a profile while it is running. This is useful if your `awk' +program goes into an infinite loop and you want to see what has been +executed. To use this feature, run `pgawk' in the background: + + $ pgawk -f myprog & + [1] 13992 + +The shell prints a job number and process ID number; in this case, +13992. Use the `kill' command to send the `USR1' signal to `pgawk': + + $ kill -USR1 13992 + +As usual, the profiled version of the program is written to +`awkprof.out', or to a different file if you use the `--profile' option. + + Along with the regular profile, as shown earlier, the profile +includes a trace of any active functions: + + # Function Call Stack: + + # 3. baz + # 2. bar + # 1. foo + # -- main -- + + You may send `pgawk' the `USR1' signal as many times as you like. +Each time, the profile and function call trace are appended to the +output profile file. + + If you use the `HUP' signal instead of the `USR1' signal, `pgawk' +produces the profile and the function call trace and then exits. + + When `pgawk' runs on MS-DOS or MS-Windows, it uses the `INT' and +`QUIT' signals for producing the profile and, in the case of the `INT' +signal, `pgawk' exits. This is because these systems don't support the +`kill' command, so the only signals you can deliver to a program are +those generated by the keyboard. The `INT' signal is generated by the +`Ctrl-<C>' or `Ctrl-<BREAK>' key, while the `QUIT' signal is generated +by the `Ctrl-<\>' key. + + +File: gawk.info, Node: Invoking Gawk, Next: Library Functions, Prev: Advanced Features, Up: Top + +11 Running `awk' and `gawk' +*************************** + +This major node covers how to run awk, both POSIX-standard and +`gawk'-specific command-line options, and what `awk' and `gawk' do with +non-option arguments. It then proceeds to cover how `gawk' searches +for source files, obsolete options and/or features, and known bugs in +`gawk'. This major node rounds out the discussion of `awk' as a +program and as a language. + + While a number of the options and features described here were +discussed in passing earlier in the book, this major node provides the +full details. + +* Menu: + +* Command Line:: How to run `awk'. +* Options:: Command-line options and their meanings. +* Other Arguments:: Input file names and variable assignments. +* AWKPATH Variable:: Searching directories for `awk' + programs. +* Obsolete:: Obsolete Options and/or features. +* Undocumented:: Undocumented Options and Features. +* Known Bugs:: Known Bugs in `gawk'. + + +File: gawk.info, Node: Command Line, Next: Options, Up: Invoking Gawk + +11.1 Invoking `awk' +=================== + +There are two ways to run `awk'--with an explicit program or with one +or more program files. Here are templates for both of them; items +enclosed in [...] in these templates are optional: + + awk [OPTIONS] -f progfile [`--'] FILE ... + awk [OPTIONS] [`--'] 'PROGRAM' FILE ... + + Besides traditional one-letter POSIX-style options, `gawk' also +supports GNU long options. + + It is possible to invoke `awk' with an empty program: + + awk '' datafile1 datafile2 + +Doing so makes little sense, though; `awk' exits silently when given an +empty program. (d.c.) If `--lint' has been specified on the command +line, `gawk' issues a warning that the program is empty. + + +File: gawk.info, Node: Options, Next: Other Arguments, Prev: Command Line, Up: Invoking Gawk + +11.2 Command-Line Options +========================= + +Options begin with a dash and consist of a single character. GNU-style +long options consist of two dashes and a keyword. The keyword can be +abbreviated, as long as the abbreviation allows the option to be +uniquely identified. If the option takes an argument, then the keyword +is either immediately followed by an equals sign (`=') and the +argument's value, or the keyword and the argument's value are separated +by whitespace. If a particular option with a value is given more than +once, it is the last value that counts. + + Each long option for `gawk' has a corresponding POSIX-style option. +The long and short options are interchangeable in all contexts. The +options and their meanings are as follows: + +`-F FS' +`--field-separator FS' + Sets the `FS' variable to FS (*note Field Separators::). + +`-f SOURCE-FILE' +`--file SOURCE-FILE' + Indicates that the `awk' program is to be found in SOURCE-FILE + instead of in the first non-option argument. + +`-v VAR=VAL' +`--assign VAR=VAL' + Sets the variable VAR to the value VAL _before_ execution of the + program begins. Such variable values are available inside the + `BEGIN' rule (*note Other Arguments::). + + The `-v' option can only set one variable, but it can be used more + than once, setting another variable each time, like this: `awk + -v foo=1 -v bar=2 ...'. + + *Caution:* Using `-v' to set the values of the built-in variables + may lead to surprising results. `awk' will reset the values of + those variables as it needs to, possibly ignoring any predefined + value you may have given. + +`-mf N' +`-mr N' + Sets various memory limits to the value N. The `f' flag sets the + maximum number of fields and the `r' flag sets the maximum record + size. These two flags and the `-m' option are from the Bell + Laboratories research version of Unix `awk'. They are provided + for compatibility but otherwise ignored by `gawk', since `gawk' + has no predefined limits. (The Bell Laboratories `awk' no longer + needs these options; it continues to accept them to avoid breaking + old programs.) + +`-W GAWK-OPT' + Following the POSIX standard, implementation-specific options are + supplied as arguments to the `-W' option. These options also have + corresponding GNU-style long options. Note that the long options + may be abbreviated, as long as the abbreviations remain unique. + The full list of `gawk'-specific options is provided next. + +`--' + Signals the end of the command-line options. The following + arguments are not treated as options even if they begin with `-'. + This interpretation of `--' follows the POSIX argument parsing + conventions. + + This is useful if you have file names that start with `-', or in + shell scripts, if you have file names that will be specified by + the user that could start with `-'. + + The previous list described options mandated by the POSIX standard, +as well as options available in the Bell Laboratories version of `awk'. +The following list describes `gawk'-specific options: + +`-W compat' +`-W traditional' +`--compat' +`--traditional' + Specifies "compatibility mode", in which the GNU extensions to the + `awk' language are disabled, so that `gawk' behaves just like the + Bell Laboratories research version of Unix `awk'. `--traditional' + is the preferred form of this option. *Note POSIX/GNU::, which + summarizes the extensions. Also see *note Compatibility Mode::. + +`-W copyright' +`--copyright' + Print the short version of the General Public License and then + exit. + +`-W copyleft' +`--copyleft' + Just like `--copyright'. This option may disappear in a future + version of `gawk'. + +`-W dump-variables[=FILE]' +`--dump-variables[=FILE]' + Prints a sorted list of global variables, their types, and final + values to FILE. If no FILE is provided, `gawk' prints this list + to the file named `awkvars.out' in the current directory. + + Having a list of all global variables is a good way to look for + typographical errors in your programs. You would also use this + option if you have a large program with a lot of functions, and + you want to be sure that your functions don't inadvertently use + global variables that you meant to be local. (This is a + particularly easy mistake to make with simple variable names like + `i', `j', etc.) + +`-W exec FILE' +`--exec FILE' + Similar to `-f', reads `awk' program text from FILE. There are + two differences. The fist is that this option also terminates + option processing; anything else on the command line is passed on + directly to the `awk' program. The second is that command line + variable assignments of the form `VAR=VALUE' are disallowed. + + This option is particularly necessary for World Wide Web CGI + applications that pass arguments through the URL; using this + option prevents a malicious (or other) user from passing in + options, assignments, or `awk' source code (via `--source') to the + CGI application. This option should be used with `#!' scripts + (*note Executable Scripts::), like so: + + #! /usr/local/bin/gawk --exec + + AWK PROGRAM HERE ... + +`-W gen-po' +`--gen-po' + Analyzes the source program and generates a GNU `gettext' Portable + Object file on standard output for all string constants that have + been marked for translation. *Note Internationalization::, for + information about this option. + +`-W help' +`-W usage' +`--help' +`--usage' + Prints a "usage" message summarizing the short and long style + options that `gawk' accepts and then exit. + +`-W lint[=fatal]' +`--lint[=fatal]' + Warns about constructs that are dubious or nonportable to other + `awk' implementations. Some warnings are issued when `gawk' first + reads your program. Others are issued at runtime, as your program + executes. With an optional argument of `fatal', lint warnings + become fatal errors. This may be drastic, but its use will + certainly encourage the development of cleaner `awk' programs. + With an optional argument of `invalid', only warnings about things + that are actually invalid are issued. (This is not fully + implemented yet.) + + Some warnings are only printed once, even if the dubious + constructs they warn about occur multiple times in your `awk' + program. Thus, when eliminating problems pointed out by `--lint', + you should take care to search for all occurrences of each + inappropriate construct. As `awk' programs are usually short, + doing so is not burdensome. + +`-W lint-old' +`--lint-old' + Warns about constructs that are not available in the original + version of `awk' from Version 7 Unix (*note V7/SVR3.1::). + +`-W non-decimal-data' +`--non-decimal-data' + Enable automatic interpretation of octal and hexadecimal values in + input data (*note Nondecimal Data::). + + *Caution:* This option can severely break old programs. Use with + care. + +`-W posix' +`--posix' + Operates in strict POSIX mode. This disables all `gawk' + extensions (just like `--traditional') and adds the following + additional restrictions: + + * `\x' escape sequences are not recognized (*note Escape + Sequences::). + + * Newlines do not act as whitespace to separate fields when + `FS' is equal to a single space (*note Fields::). + + * Newlines are not allowed after `?' or `:' (*note Conditional + Exp::). + + * The synonym `func' for the keyword `function' is not + recognized (*note Definition Syntax::). + + * The `**' and `**=' operators cannot be used in place of `^' + and `^=' (*note Arithmetic Ops::, and also *note Assignment + Ops::). + + * Specifying `-Ft' on the command-line does not set the value + of `FS' to be a single TAB character (*note Field + Separators::). + + * The locale's decimal point character is used for parsing input + data (*note Locales::). + + * The `fflush' built-in function is not supported (*note I/O + Functions::). + + If you supply both `--traditional' and `--posix' on the command + line, `--posix' takes precedence. `gawk' also issues a warning if + both options are supplied. + +`-W profile[=FILE]' +`--profile[=FILE]' + Enable profiling of `awk' programs (*note Profiling::). By + default, profiles are created in a file named `awkprof.out'. The + optional FILE argument allows you to specify a different file name + for the profile file. + + When run with `gawk', the profile is just a "pretty printed" + version of the program. When run with `pgawk', the profile + contains execution counts for each statement in the program in the + left margin, and function call counts for each function. + +`-W re-interval' +`--re-interval' + Allows interval expressions (*note Regexp Operators::) in regexps. + Because interval expressions were traditionally not available in + `awk', `gawk' does not provide them by default. This prevents old + `awk' programs from breaking. + +`-W source PROGRAM-TEXT' +`--source PROGRAM-TEXT' + Allows you to mix source code in files with source code that you + enter on the command line. Program source code is taken from the + PROGRAM-TEXT. This is particularly useful when you have library + functions that you want to use from your command-line programs + (*note AWKPATH Variable::). + +`-W use-lc-numeric' +`--use-lc-numeric' + This option forces the use of the locale's decimal point character + when parsing numeric input data (*note Locales::). + +`-W version' +`--version' + Prints version information for this particular copy of `gawk'. + This allows you to determine if your copy of `gawk' is up to date + with respect to whatever the Free Software Foundation is currently + distributing. It is also useful for bug reports (*note Bugs::). + + As long as program text has been supplied, any other options are +flagged as invalid with a warning message but are otherwise ignored. + + In compatibility mode, as a special case, if the value of FS supplied +to the `-F' option is `t', then `FS' is set to the TAB character +(`"\t"'). This is true only for `--traditional' and not for `--posix' +(*note Field Separators::). + + The `-f' option may be used more than once on the command line. If +it is, `awk' reads its program source from all of the named files, as +if they had been concatenated together into one big file. This is +useful for creating libraries of `awk' functions. These functions can +be written once and then retrieved from a standard place, instead of +having to be included into each individual program. (As mentioned in +*note Definition Syntax::, function names must be unique.) + + Library functions can still be used, even if the program is entered +at the terminal, by specifying `-f /dev/tty'. After typing your +program, type `Ctrl-d' (the end-of-file character) to terminate it. +(You may also use `-f -' to read program source from the standard input +but then you will not be able to also use the standard input as a +source of data.) + + Because it is clumsy using the standard `awk' mechanisms to mix +source file and command-line `awk' programs, `gawk' provides the +`--source' option. This does not require you to pre-empt the standard +input for your source code; it allows you to easily mix command-line +and library source code (*note AWKPATH Variable::). + + If no `-f' or `--source' option is specified, then `gawk' uses the +first non-option command-line argument as the text of the program +source code. + + If the environment variable `POSIXLY_CORRECT' exists, then `gawk' +behaves in strict POSIX mode, exactly as if you had supplied the +`--posix' command-line option. Many GNU programs look for this +environment variable to turn on strict POSIX mode. If `--lint' is +supplied on the command line and `gawk' turns on POSIX mode because of +`POSIXLY_CORRECT', then it issues a warning message indicating that +POSIX mode is in effect. You would typically set this variable in your +shell's startup file. For a Bourne-compatible shell (such as `bash'), +you would add these lines to the `.profile' file in your home directory: + + POSIXLY_CORRECT=true + export POSIXLY_CORRECT + + For a `csh'-compatible shell,(1) you would add this line to the +`.login' file in your home directory: + + setenv POSIXLY_CORRECT true + + Having `POSIXLY_CORRECT' set is not recommended for daily use, but +it is good for testing the portability of your programs to other +environments. + + ---------- Footnotes ---------- + + (1) Not recommended. + + +File: gawk.info, Node: Other Arguments, Next: AWKPATH Variable, Prev: Options, Up: Invoking Gawk + +11.3 Other Command-Line Arguments +================================= + +Any additional arguments on the command line are normally treated as +input files to be processed in the order specified. However, an +argument that has the form `VAR=VALUE', assigns the value VALUE to the +variable VAR--it does not specify a file at all. (This was discussed +earlier in *note Assignment Options::.) + + All these arguments are made available to your `awk' program in the +`ARGV' array (*note Built-in Variables::). Command-line options and +the program text (if present) are omitted from `ARGV'. All other +arguments, including variable assignments, are included. As each +element of `ARGV' is processed, `gawk' sets the variable `ARGIND' to +the index in `ARGV' of the current element. + + The distinction between file name arguments and variable-assignment +arguments is made when `awk' is about to open the next input file. At +that point in execution, it checks the file name to see whether it is +really a variable assignment; if so, `awk' sets the variable instead of +reading a file. + + Therefore, the variables actually receive the given values after all +previously specified files have been read. In particular, the values of +variables assigned in this fashion are _not_ available inside a `BEGIN' +rule (*note BEGIN/END::), because such rules are run before `awk' +begins scanning the argument list. + + The variable values given on the command line are processed for +escape sequences (*note Escape Sequences::). (d.c.) + + In some earlier implementations of `awk', when a variable assignment +occurred before any file names, the assignment would happen _before_ +the `BEGIN' rule was executed. `awk''s behavior was thus inconsistent; +some command-line assignments were available inside the `BEGIN' rule, +while others were not. Unfortunately, some applications came to depend +upon this "feature." When `awk' was changed to be more consistent, the +`-v' option was added to accommodate applications that depended upon +the old behavior. + + The variable assignment feature is most useful for assigning to +variables such as `RS', `OFS', and `ORS', which control input and +output formats before scanning the data files. It is also useful for +controlling state if multiple passes are needed over a data file. For +example: + + awk 'pass == 1 { PASS 1 STUFF } + pass == 2 { PASS 2 STUFF }' pass=1 mydata pass=2 mydata + + Given the variable assignment feature, the `-F' option for setting +the value of `FS' is not strictly necessary. It remains for historical +compatibility. + + +File: gawk.info, Node: AWKPATH Variable, Next: Obsolete, Prev: Other Arguments, Up: Invoking Gawk + +11.4 The `AWKPATH' Environment Variable +======================================= + +The previous minor node described how `awk' program files can be named +on the command-line with the `-f' option. In most `awk' +implementations, you must supply a precise path name for each program +file, unless the file is in the current directory. But in `gawk', if +the file name supplied to the `-f' option does not contain a `/', then +`gawk' searches a list of directories (called the "search path"), one +by one, looking for a file with the specified name. + +The search path is a string consisting of directory names separated by +colons. `gawk' gets its search path from the `AWKPATH' environment +variable. If that variable does not exist, `gawk' uses a default path, +`.:/usr/local/share/awk'.(1) (Programs written for use by system +administrators should use an `AWKPATH' variable that does not include +the current directory, `.'.) + + The search path feature is particularly useful for building libraries +of useful `awk' functions. The library files can be placed in a +standard directory in the default path and then specified on the +command line with a short file name. Otherwise, the full file name +would have to be typed for each file. + + By using both the `--source' and `-f' options, your command-line +`awk' programs can use facilities in `awk' library files (*note Library +Functions::). Path searching is not done if `gawk' is in compatibility +mode. This is true for both `--traditional' and `--posix'. *Note +Options::. + + NOTE: If you want files in the current directory to be found, you + must include the current directory in the path, either by including + `.' explicitly in the path or by writing a null entry in the path. + (A null entry is indicated by starting or ending the path with a + colon or by placing two colons next to each other (`::').) If the + current directory is not included in the path, then files cannot be + found in the current directory. This path search mechanism is + identical to the shell's. + + Starting with version 3.0, if `AWKPATH' is not defined in the +environment, `gawk' places its default search path into +`ENVIRON["AWKPATH"]'. This makes it easy to determine the actual search +path that `gawk' will use from within an `awk' program. + + While you can change `ENVIRON["AWKPATH"]' within your `awk' program, +this has no effect on the running program's behavior. This makes +sense: the `AWKPATH' environment variable is used to find the program +source files. Once your program is running, all the files have been +found, and `gawk' no longer needs to use `AWKPATH'. + + ---------- Footnotes ---------- + + (1) Your version of `gawk' may use a different directory; it will +depend upon how `gawk' was built and installed. The actual directory is +the value of `$(datadir)' generated when `gawk' was configured. You +probably don't need to worry about this, though. + + +File: gawk.info, Node: Obsolete, Next: Undocumented, Prev: AWKPATH Variable, Up: Invoking Gawk + +11.5 Obsolete Options and/or Features +===================================== + +This minor node describes features and/or command-line options from +previous releases of `gawk' that are either not available in the +current version or that are still supported but deprecated (meaning that +they will _not_ be in the next release). + + For version 3.1 of `gawk', there are no deprecated command-line +options from the previous version of `gawk'. The use of `next file' +(two words) for `nextfile' was deprecated in `gawk' 3.0 but still +worked. Starting with version 3.1, the two-word usage is no longer +accepted. + + The process-related special files described in *note Special +Process::, work as described, but are now considered deprecated. +`gawk' prints a warning message every time they are used. (Use +`PROCINFO' instead; see *note Auto-set::.) They will be removed from +the next release of `gawk'. + + +File: gawk.info, Node: Undocumented, Next: Known Bugs, Prev: Obsolete, Up: Invoking Gawk + +11.6 Undocumented Options and Features +====================================== + + Use the Source, Luke! + Obi-Wan + + This minor node intentionally left blank. + + +File: gawk.info, Node: Known Bugs, Prev: Undocumented, Up: Invoking Gawk + +11.7 Known Bugs in `gawk' +========================= + + * The `-F' option for changing the value of `FS' (*note Options::) + is not necessary given the command-line variable assignment + feature; it remains only for backward compatibility. + + * Syntactically invalid single-character programs tend to overflow + the parse stack, generating a rather unhelpful message. Such + programs are surprisingly difficult to diagnose in the completely + general case, and the effort to do so really is not worth it. + + +File: gawk.info, Node: Library Functions, Next: Sample Programs, Prev: Invoking Gawk, Up: Top + +12 A Library of `awk' Functions +******************************* + +*note User-defined::, describes how to write your own `awk' functions. +Writing functions is important, because it allows you to encapsulate +algorithms and program tasks in a single place. It simplifies +programming, making program development more manageable, and making +programs more readable. + + One valuable way to learn a new programming language is to _read_ +programs in that language. To that end, this major node and *note +Sample Programs::, provide a good-sized body of code for you to read, +and hopefully, to learn from. + + This major node presents a library of useful `awk' functions. Many +of the sample programs presented later in this Info file use these +functions. The functions are presented here in a progression from +simple to complex. + + *note Extract Program::, presents a program that you can use to +extract the source code for these example library functions and +programs from the Texinfo source for this Info file. (This has already +been done as part of the `gawk' distribution.) + + If you have written one or more useful, general-purpose `awk' +functions and would like to contribute them to the author's collection +of `awk' programs, see *note How To Contribute::, for more information. + + The programs in this major node and in *note Sample Programs::, +freely use features that are `gawk'-specific. Rewriting these programs +for different implementations of awk is pretty straightforward. + + Diagnostic error messages are sent to `/dev/stderr'. Use `| "cat +1>&2"' instead of `> "/dev/stderr"' if your system does not have a +`/dev/stderr', or if you cannot use `gawk'. + + A number of programs use `nextfile' (*note Nextfile Statement::) to +skip any remaining input in the input file. *note Nextfile Function::, +shows you how to write a function that does the same thing. + + Finally, some of the programs choose to ignore upper- and lowercase +distinctions in their input. They do so by assigning one to +`IGNORECASE'. You can achieve almost the same effect(1) by adding the +following rule to the beginning of the program: + + # ignore case + { $0 = tolower($0) } + +Also, verify that all regexp and string constants used in comparisons +use only lowercase letters. + +* Menu: + +* Library Names:: How to best name private global variables in + library functions. +* General Functions:: Functions that are of general use. +* Data File Management:: Functions for managing command-line data + files. +* Getopt Function:: A function for processing command-line + arguments. +* Passwd Functions:: Functions for getting user information. +* Group Functions:: Functions for getting group information. + + ---------- Footnotes ---------- + + (1) The effects are not identical. Output of the transformed record +will be in all lowercase, while `IGNORECASE' preserves the original +contents of the input record. + + +File: gawk.info, Node: Library Names, Next: General Functions, Up: Library Functions + +12.1 Naming Library Function Global Variables +============================================= + +Due to the way the `awk' language evolved, variables are either +"global" (usable by the entire program) or "local" (usable just by a +specific function). There is no intermediate state analogous to +`static' variables in C. + + Library functions often need to have global variables that they can +use to preserve state information between calls to the function--for +example, `getopt''s variable `_opti' (*note Getopt Function::). Such +variables are called "private", since the only functions that need to +use them are the ones in the library. + + When writing a library function, you should try to choose names for +your private variables that will not conflict with any variables used by +either another library function or a user's main program. For example, +a name like `i' or `j' is not a good choice, because user programs +often use variable names like these for their own purposes. + + The example programs shown in this major node all start the names of +their private variables with an underscore (`_'). Users generally +don't use leading underscores in their variable names, so this +convention immediately decreases the chances that the variable name +will be accidentally shared with the user's program. + + In addition, several of the library functions use a prefix that helps +indicate what function or set of functions use the variables--for +example, `_pw_byname' in the user database routines (*note Passwd +Functions::). This convention is recommended, since it even further +decreases the chance of inadvertent conflict among variable names. +Note that this convention is used equally well for variable names and +for private function names as well.(1) + + As a final note on variable naming, if a function makes global +variables available for use by a main program, it is a good convention +to start that variable's name with a capital letter--for example, +`getopt''s `Opterr' and `Optind' variables (*note Getopt Function::). +The leading capital letter indicates that it is global, while the fact +that the variable name is not all capital letters indicates that the +variable is not one of `awk''s built-in variables, such as `FS'. + + It is also important that _all_ variables in library functions that +do not need to save state are, in fact, declared local.(2) If this is +not done, the variable could accidentally be used in the user's +program, leading to bugs that are very difficult to track down: + + function lib_func(x, y, l1, l2) + { + ... + USE VARIABLE some_var # some_var should be local + ... # but is not by oversight + } + + A different convention, common in the Tcl community, is to use a +single associative array to hold the values needed by the library +function(s), or "package." This significantly decreases the number of +actual global names in use. For example, the functions described in +*note Passwd Functions::, might have used array elements +`PW_data["inited"]', `PW_data["total"]', `PW_data["count"]', and +`PW_data["awklib"]', instead of `_pw_inited', `_pw_awklib', `_pw_total', +and `_pw_count'. + + The conventions presented in this minor node are exactly that: +conventions. You are not required to write your programs this way--we +merely recommend that you do so. + + ---------- Footnotes ---------- + + (1) While all the library routines could have been rewritten to use +this convention, this was not done, in order to show how my own `awk' +programming style has evolved and to provide some basis for this +discussion. + + (2) `gawk''s `--dump-variables' command-line option is useful for +verifying this. + + +File: gawk.info, Node: General Functions, Next: Data File Management, Prev: Library Names, Up: Library Functions + +12.2 General Programming +======================== + +This minor node presents a number of functions that are of general +programming use. + +* Menu: + +* Nextfile Function:: Two implementations of a `nextfile' + function. +* Strtonum Function:: A replacement for the built-in `strtonum' + function. +* Assert Function:: A function for assertions in `awk' + programs. +* Round Function:: A function for rounding if `sprintf' does + not do it correctly. +* Cliff Random Function:: The Cliff Random Number Generator. +* Ordinal Functions:: Functions for using characters as numbers and + vice versa. +* Join Function:: A function to join an array into a string. +* Gettimeofday Function:: A function to get formatted times. + + +File: gawk.info, Node: Nextfile Function, Next: Strtonum Function, Up: General Functions + +12.2.1 Implementing `nextfile' as a Function +-------------------------------------------- + +The `nextfile' statement, presented in *note Nextfile Statement::, is a +`gawk'-specific extension--it is not available in most other +implementations of `awk'. This minor node shows two versions of a +`nextfile' function that you can use to simulate `gawk''s `nextfile' +statement if you cannot use `gawk'. + + A first attempt at writing a `nextfile' function is as follows: + + # nextfile --- skip remaining records in current file + # this should be read in before the "main" awk program + + function nextfile() { _abandon_ = FILENAME; next } + _abandon_ == FILENAME { next } + + Because it supplies a rule that must be executed first, this file +should be included before the main program. This rule compares the +current data file's name (which is always in the `FILENAME' variable) to +a private variable named `_abandon_'. If the file name matches, then +the action part of the rule executes a `next' statement to go on to the +next record. (The use of `_' in the variable name is a convention. It +is discussed more fully in *note Library Names::.) + + The use of the `next' statement effectively creates a loop that reads +all the records from the current data file. The end of the file is +eventually reached and a new data file is opened, changing the value of +`FILENAME'. Once this happens, the comparison of `_abandon_' to +`FILENAME' fails, and execution continues with the first rule of the +"real" program. + + The `nextfile' function itself simply sets the value of `_abandon_' +and then executes a `next' statement to start the loop. + + This initial version has a subtle problem. If the same data file is +listed _twice_ on the command line, one right after the other or even +with just a variable assignment between them, this code skips right +through the file a second time, even though it should stop when it gets +to the end of the first occurrence. A second version of `nextfile' +that remedies this problem is shown here: + + # nextfile --- skip remaining records in current file + # correctly handle successive occurrences of the same file + # this should be read in before the "main" awk program + + function nextfile() { _abandon_ = FILENAME; next } + + _abandon_ == FILENAME { + if (FNR == 1) + _abandon_ = "" + else + next + } + + The `nextfile' function has not changed. It makes `_abandon_' equal +to the current file name and then executes a `next' statement. The +`next' statement reads the next record and increments `FNR' so that +`FNR' is guaranteed to have a value of at least two. However, if +`nextfile' is called for the last record in the file, then `awk' closes +the current data file and moves on to the next one. Upon doing so, +`FILENAME' is set to the name of the new file and `FNR' is reset to +one. If this next file is the same as the previous one, `_abandon_' is +still equal to `FILENAME'. However, `FNR' is equal to one, telling us +that this is a new occurrence of the file and not the one we were +reading when the `nextfile' function was executed. In that case, +`_abandon_' is reset to the empty string, so that further executions of +this rule fail (until the next time that `nextfile' is called). + + If `FNR' is not one, then we are still in the original data file and +the program executes a `next' statement to skip through it. + + An important question to ask at this point is: given that the +functionality of `nextfile' can be provided with a library file, why is +it built into `gawk'? Adding features for little reason leads to +larger, slower programs that are harder to maintain. The answer is +that building `nextfile' into `gawk' provides significant gains in +efficiency. If the `nextfile' function is executed at the beginning of +a large data file, `awk' still has to scan the entire file, splitting +it up into records, just to skip over it. The built-in `nextfile' can +simply close the file immediately and proceed to the next one, which +saves a lot of time. This is particularly important in `awk', because +`awk' programs are generally I/O-bound (i.e., they spend most of their +time doing input and output, instead of performing computations). + + +File: gawk.info, Node: Strtonum Function, Next: Assert Function, Prev: Nextfile Function, Up: General Functions + +12.2.2 Converting Strings To Numbers +------------------------------------ + +The `strtonum' function (*note String Functions::) is a `gawk' +extension. The following function provides an implementation for other +versions of `awk': + + # strtonum --- convert string to number + function mystrtonum(str, ret, chars, n, i, k, c) + { + if (str ~ /^0[0-7]*$/) { + # octal + n = length(str) + ret = 0 + for (i = 1; i <= n; i++) { + c = substr(str, i, 1) + if ((k = index("01234567", c)) > 0) + k-- # adjust for 1-basing in awk + + ret = ret * 8 + k + } + } else if (str ~ /^0[xX][0-9a-fA-f]+/) { + # hexadecimal + str = substr(str, 3) # lop off leading 0x + n = length(str) + ret = 0 + for (i = 1; i <= n; i++) { + c = substr(str, i, 1) + c = tolower(c) + if ((k = index("0123456789", c)) > 0) + k-- # adjust for 1-basing in awk + else if ((k = index("abcdef", c)) > 0) + k += 9 + + ret = ret * 16 + k + } + } else if (str ~ /^[-+]?([0-9]+([.][0-9]*([Ee][0-9]+)?)?|([.][0-9]+([Ee][-+]?[0-9]+)?))$/) { + # decimal number, possibly floating point + ret = str + 0 + } else + ret = "NOT-A-NUMBER" + + return ret + } + + # BEGIN { # gawk test harness + # a[1] = "25" + # a[2] = ".31" + # a[3] = "0123" + # a[4] = "0xdeadBEEF" + # a[5] = "123.45" + # a[6] = "1.e3" + # a[7] = "1.32" + # a[7] = "1.32E2" + # + # for (i = 1; i in a; i++) + # print a[i], strtonum(a[i]), mystrtonum(a[i]) + # } + + The function first looks for C-style octal numbers (base 8). If the +input string matches a regular expression describing octal numbers, +then `mystrtonum' loops through each character in the string. It sets +`k' to the index in `"01234567"' of the current octal digit. Since the +return value is one-based, the `k--' adjusts `k' so it can be used in +computing the return value. + + Similar logic applies to the code that checks for and converts a +hexadecimal value, which starts with `0x' or `0X'. The use of +`tolower' simplifies the computation for finding the correct numeric +value for each hexadecimal digit. + + Finally, if the string matches the (rather complicated) regex for a +regular decimal integer or floating-point number, the computation `ret += str + 0' lets `awk' convert the value to a number. + + A commented-out test program is included, so that the function can +be tested with `gawk' and the results compared to the built-in +`strtonum' function. + + +File: gawk.info, Node: Assert Function, Next: Round Function, Prev: Strtonum Function, Up: General Functions + +12.2.3 Assertions +----------------- + +When writing large programs, it is often useful to know that a +condition or set of conditions is true. Before proceeding with a +particular computation, you make a statement about what you believe to +be the case. Such a statement is known as an "assertion". The C +language provides an `<assert.h>' header file and corresponding +`assert' macro that the programmer can use to make assertions. If an +assertion fails, the `assert' macro arranges to print a diagnostic +message describing the condition that should have been true but was +not, and then it kills the program. In C, using `assert' looks this: + + #include <assert.h> + + int myfunc(int a, double b) + { + assert(a <= 5 && b >= 17.1); + ... + } + + If the assertion fails, the program prints a message similar to this: + + prog.c:5: assertion failed: a <= 5 && b >= 17.1 + + The C language makes it possible to turn the condition into a string +for use in printing the diagnostic message. This is not possible in +`awk', so this `assert' function also requires a string version of the +condition that is being tested. Following is the function: + + # assert --- assert that a condition is true. Otherwise exit. + function assert(condition, string) + { + if (! condition) { + printf("%s:%d: assertion failed: %s\n", + FILENAME, FNR, string) > "/dev/stderr" + _assert_exit = 1 + exit 1 + } + } + + END { + if (_assert_exit) + exit 1 + } + + The `assert' function tests the `condition' parameter. If it is +false, it prints a message to standard error, using the `string' +parameter to describe the failed condition. It then sets the variable +`_assert_exit' to one and executes the `exit' statement. The `exit' +statement jumps to the `END' rule. If the `END' rules finds +`_assert_exit' to be true, it exits immediately. + + The purpose of the test in the `END' rule is to keep any other `END' +rules from running. When an assertion fails, the program should exit +immediately. If no assertions fail, then `_assert_exit' is still false +when the `END' rule is run normally, and the rest of the program's +`END' rules execute. For all of this to work correctly, `assert.awk' +must be the first source file read by `awk'. The function can be used +in a program in the following way: + + function myfunc(a, b) + { + assert(a <= 5 && b >= 17.1, "a <= 5 && b >= 17.1") + ... + } + +If the assertion fails, you see a message similar to the following: + + mydata:1357: assertion failed: a <= 5 && b >= 17.1 + + There is a small problem with this version of `assert'. An `END' +rule is automatically added to the program calling `assert'. Normally, +if a program consists of just a `BEGIN' rule, the input files and/or +standard input are not read. However, now that the program has an `END' +rule, `awk' attempts to read the input data files or standard input +(*note Using BEGIN/END::), most likely causing the program to hang as +it waits for input. + + There is a simple workaround to this: make sure the `BEGIN' rule +always ends with an `exit' statement. + + +File: gawk.info, Node: Round Function, Next: Cliff Random Function, Prev: Assert Function, Up: General Functions + +12.2.4 Rounding Numbers +----------------------- + +The way `printf' and `sprintf' (*note Printf::) perform rounding often +depends upon the system's C `sprintf' subroutine. On many machines, +`sprintf' rounding is "unbiased," which means it doesn't always round a +trailing `.5' up, contrary to naive expectations. In unbiased +rounding, `.5' rounds to even, rather than always up, so 1.5 rounds to +2 but 4.5 rounds to 4. This means that if you are using a format that +does rounding (e.g., `"%.0f"'), you should check what your system does. +The following function does traditional rounding; it might be useful if +your awk's `printf' does unbiased rounding: + + # round.awk --- do normal rounding + function round(x, ival, aval, fraction) + { + ival = int(x) # integer part, int() truncates + + # see if fractional part + if (ival == x) # no fraction + return x + + if (x < 0) { + aval = -x # absolute value + ival = int(aval) + fraction = aval - ival + if (fraction >= .5) + return int(x) - 1 # -2.5 --> -3 + else + return int(x) # -2.3 --> -2 + } else { + fraction = x - ival + if (fraction >= .5) + return ival + 1 + else + return ival + } + } + + # test harness + { print $0, round($0) } + + +File: gawk.info, Node: Cliff Random Function, Next: Ordinal Functions, Prev: Round Function, Up: General Functions + +12.2.5 The Cliff Random Number Generator +---------------------------------------- + +The Cliff random number generator(1) is a very simple random number +generator that "passes the noise sphere test for randomness by showing +no structure." It is easily programmed, in less than 10 lines of `awk' +code: + + # cliff_rand.awk --- generate Cliff random numbers + BEGIN { _cliff_seed = 0.1 } + + function cliff_rand() + { + _cliff_seed = (100 * log(_cliff_seed)) % 1 + if (_cliff_seed < 0) + _cliff_seed = - _cliff_seed + return _cliff_seed + } + + This algorithm requires an initial "seed" of 0.1. Each new value +uses the current seed as input for the calculation. If the built-in +`rand' function (*note Numeric Functions::) isn't random enough, you +might try using this function instead. + + ---------- Footnotes ---------- + + (1) `http://mathworld.wolfram.com/CliffRandomNumberGenerator.html' + + +File: gawk.info, Node: Ordinal Functions, Next: Join Function, Prev: Cliff Random Function, Up: General Functions + +12.2.6 Translating Between Characters and Numbers +------------------------------------------------- + +One commercial implementation of `awk' supplies a built-in function, +`ord', which takes a character and returns the numeric value for that +character in the machine's character set. If the string passed to +`ord' has more than one character, only the first one is used. + + The inverse of this function is `chr' (from the function of the same +name in Pascal), which takes a number and returns the corresponding +character. Both functions are written very nicely in `awk'; there is +no real reason to build them into the `awk' interpreter: + + # ord.awk --- do ord and chr + + # Global identifiers: + # _ord_: numerical values indexed by characters + # _ord_init: function to initialize _ord_ + BEGIN { _ord_init() } + + function _ord_init( low, high, i, t) + { + low = sprintf("%c", 7) # BEL is ascii 7 + if (low == "\a") { # regular ascii + low = 0 + high = 127 + } else if (sprintf("%c", 128 + 7) == "\a") { + # ascii, mark parity + low = 128 + high = 255 + } else { # ebcdic(!) + low = 0 + high = 255 + } + + for (i = low; i <= high; i++) { + t = sprintf("%c", i) + _ord_[t] = i + } + } + + Some explanation of the numbers used by `chr' is worthwhile. The +most prominent character set in use today is ASCII. Although an 8-bit +byte can hold 256 distinct values (from 0 to 255), ASCII only defines +characters that use the values from 0 to 127.(1) In the now distant +past, at least one minicomputer manufacturer used ASCII, but with mark +parity, meaning that the leftmost bit in the byte is always 1. This +means that on those systems, characters have numeric values from 128 to +255. Finally, large mainframe systems use the EBCDIC character set, +which uses all 256 values. While there are other character sets in use +on some older systems, they are not really worth worrying about: + + function ord(str, c) + { + # only first character is of interest + c = substr(str, 1, 1) + return _ord_[c] + } + + function chr(c) + { + # force c to be numeric by adding 0 + return sprintf("%c", c + 0) + } + + #### test code #### + # BEGIN \ + # { + # for (;;) { + # printf("enter a character: ") + # if (getline var <= 0) + # break + # printf("ord(%s) = %d\n", var, ord(var)) + # } + # } + + An obvious improvement to these functions is to move the code for the +`_ord_init' function into the body of the `BEGIN' rule. It was written +this way initially for ease of development. There is a "test program" +in a `BEGIN' rule, to test the function. It is commented out for +production use. + + ---------- Footnotes ---------- + + (1) ASCII has been extended in many countries to use the values from +128 to 255 for country-specific characters. If your system uses these +extensions, you can simplify `_ord_init' to simply loop from 0 to 255. + + +File: gawk.info, Node: Join Function, Next: Gettimeofday Function, Prev: Ordinal Functions, Up: General Functions + +12.2.7 Merging an Array into a String +------------------------------------- + +When doing string processing, it is often useful to be able to join all +the strings in an array into one long string. The following function, +`join', accomplishes this task. It is used later in several of the +application programs (*note Sample Programs::). + + Good function design is important; this function needs to be general +but it should also have a reasonable default behavior. It is called +with an array as well as the beginning and ending indices of the +elements in the array to be merged. This assumes that the array +indices are numeric--a reasonable assumption since the array was likely +created with `split' (*note String Functions::): + + # join.awk --- join an array into a string + function join(array, start, end, sep, result, i) + { + if (sep == "") + sep = " " + else if (sep == SUBSEP) # magic value + sep = "" + result = array[start] + for (i = start + 1; i <= end; i++) + result = result sep array[i] + return result + } + + An optional additional argument is the separator to use when joining +the strings back together. If the caller supplies a nonempty value, +`join' uses it; if it is not supplied, it has a null value. In this +case, `join' uses a single blank as a default separator for the +strings. If the value is equal to `SUBSEP', then `join' joins the +strings with no separator between them. `SUBSEP' serves as a "magic" +value to indicate that there should be no separation between the +component strings.(1) + + ---------- Footnotes ---------- + + (1) It would be nice if `awk' had an assignment operator for +concatenation. The lack of an explicit operator for concatenation +makes string operations more difficult than they really need to be. + + +File: gawk.info, Node: Gettimeofday Function, Prev: Join Function, Up: General Functions + +12.2.8 Managing the Time of Day +------------------------------- + +The `systime' and `strftime' functions described in *note Time +Functions::, provide the minimum functionality necessary for dealing +with the time of day in human readable form. While `strftime' is +extensive, the control formats are not necessarily easy to remember or +intuitively obvious when reading a program. + + The following function, `gettimeofday', populates a user-supplied +array with preformatted time information. It returns a string with the +current time formatted in the same way as the `date' utility: + + # gettimeofday.awk --- get the time of day in a usable format + + # Returns a string in the format of output of date(1) + # Populates the array argument time with individual values: + # time["second"] -- seconds (0 - 59) + # time["minute"] -- minutes (0 - 59) + # time["hour"] -- hours (0 - 23) + # time["althour"] -- hours (0 - 12) + # time["monthday"] -- day of month (1 - 31) + # time["month"] -- month of year (1 - 12) + # time["monthname"] -- name of the month + # time["shortmonth"] -- short name of the month + # time["year"] -- year modulo 100 (0 - 99) + # time["fullyear"] -- full year + # time["weekday"] -- day of week (Sunday = 0) + # time["altweekday"] -- day of week (Monday = 0) + # time["dayname"] -- name of weekday + # time["shortdayname"] -- short name of weekday + # time["yearday"] -- day of year (0 - 365) + # time["timezone"] -- abbreviation of timezone name + # time["ampm"] -- AM or PM designation + # time["weeknum"] -- week number, Sunday first day + # time["altweeknum"] -- week number, Monday first day + + function gettimeofday(time, ret, now, i) + { + # get time once, avoids unnecessary system calls + now = systime() + + # return date(1)-style output + ret = strftime("%a %b %d %H:%M:%S %Z %Y", now) + + # clear out target array + delete time + + # fill in values, force numeric values to be + # numeric by adding 0 + time["second"] = strftime("%S", now) + 0 + time["minute"] = strftime("%M", now) + 0 + time["hour"] = strftime("%H", now) + 0 + time["althour"] = strftime("%I", now) + 0 + time["monthday"] = strftime("%d", now) + 0 + time["month"] = strftime("%m", now) + 0 + time["monthname"] = strftime("%B", now) + time["shortmonth"] = strftime("%b", now) + time["year"] = strftime("%y", now) + 0 + time["fullyear"] = strftime("%Y", now) + 0 + time["weekday"] = strftime("%w", now) + 0 + time["altweekday"] = strftime("%u", now) + 0 + time["dayname"] = strftime("%A", now) + time["shortdayname"] = strftime("%a", now) + time["yearday"] = strftime("%j", now) + 0 + time["timezone"] = strftime("%Z", now) + time["ampm"] = strftime("%p", now) + time["weeknum"] = strftime("%U", now) + 0 + time["altweeknum"] = strftime("%W", now) + 0 + + return ret + } + + The string indices are easier to use and read than the various +formats required by `strftime'. The `alarm' program presented in *note +Alarm Program::, uses this function. A more general design for the +`gettimeofday' function would have allowed the user to supply an +optional timestamp value to use instead of the current time. + + +File: gawk.info, Node: Data File Management, Next: Getopt Function, Prev: General Functions, Up: Library Functions + +12.3 Data File Management +========================= + +This minor node presents functions that are useful for managing +command-line data files. + +* Menu: + +* Filetrans Function:: A function for handling data file transitions. +* Rewind Function:: A function for rereading the current file. +* File Checking:: Checking that data files are readable. +* Empty Files:: Checking for zero-length files. +* Ignoring Assigns:: Treating assignments as file names. + + +File: gawk.info, Node: Filetrans Function, Next: Rewind Function, Up: Data File Management + +12.3.1 Noting Data File Boundaries +---------------------------------- + +The `BEGIN' and `END' rules are each executed exactly once at the +beginning and end of your `awk' program, respectively (*note +BEGIN/END::). We (the `gawk' authors) once had a user who mistakenly +thought that the `BEGIN' rule is executed at the beginning of each data +file and the `END' rule is executed at the end of each data file. When +informed that this was not the case, the user requested that we add new +special patterns to `gawk', named `BEGIN_FILE' and `END_FILE', that +would have the desired behavior. He even supplied us the code to do so. + + Adding these special patterns to `gawk' wasn't necessary; the job +can be done cleanly in `awk' itself, as illustrated by the following +library program. It arranges to call two user-supplied functions, +`beginfile' and `endfile', at the beginning and end of each data file. +Besides solving the problem in only nine(!) lines of code, it does so +_portably_; this works with any implementation of `awk': + + # transfile.awk + # + # Give the user a hook for filename transitions + # + # The user must supply functions beginfile() and endfile() + # that each take the name of the file being started or + # finished, respectively. + + FILENAME != _oldfilename \ + { + if (_oldfilename != "") + endfile(_oldfilename) + _oldfilename = FILENAME + beginfile(FILENAME) + } + + END { endfile(FILENAME) } + + This file must be loaded before the user's "main" program, so that +the rule it supplies is executed first. + + This rule relies on `awk''s `FILENAME' variable that automatically +changes for each new data file. The current file name is saved in a +private variable, `_oldfilename'. If `FILENAME' does not equal +`_oldfilename', then a new data file is being processed and it is +necessary to call `endfile' for the old file. Because `endfile' should +only be called if a file has been processed, the program first checks +to make sure that `_oldfilename' is not the null string. The program +then assigns the current file name to `_oldfilename' and calls +`beginfile' for the file. Because, like all `awk' variables, +`_oldfilename' is initialized to the null string, this rule executes +correctly even for the first data file. + + The program also supplies an `END' rule to do the final processing +for the last file. Because this `END' rule comes before any `END' rules +supplied in the "main" program, `endfile' is called first. Once again +the value of multiple `BEGIN' and `END' rules should be clear. + + This version has same problem as the first version of `nextfile' +(*note Nextfile Function::). If the same data file occurs twice in a +row on the command line, then `endfile' and `beginfile' are not +executed at the end of the first pass and at the beginning of the +second pass. The following version solves the problem: + + # ftrans.awk --- handle data file transitions + # + # user supplies beginfile() and endfile() functions + FNR == 1 { + if (_filename_ != "") + endfile(_filename_) + _filename_ = FILENAME + beginfile(FILENAME) + } + + END { endfile(_filename_) } + + *note Wc Program::, shows how this library function can be used and +how it simplifies writing the main program. + + +File: gawk.info, Node: Rewind Function, Next: File Checking, Prev: Filetrans Function, Up: Data File Management + +12.3.2 Rereading the Current File +--------------------------------- + +Another request for a new built-in function was for a `rewind' function +that would make it possible to reread the current file. The requesting +user didn't want to have to use `getline' (*note Getline::) inside a +loop. + + However, as long as you are not in the `END' rule, it is quite easy +to arrange to immediately close the current input file and then start +over with it from the top. For lack of a better name, we'll call it +`rewind': + + # rewind.awk --- rewind the current file and start over + function rewind( i) + { + # shift remaining arguments up + for (i = ARGC; i > ARGIND; i--) + ARGV[i] = ARGV[i-1] + + # make sure gawk knows to keep going + ARGC++ + + # make current file next to get done + ARGV[ARGIND+1] = FILENAME + + # do it + nextfile + } + + This code relies on the `ARGIND' variable (*note Auto-set::), which +is specific to `gawk'. If you are not using `gawk', you can use ideas +presented in *note Filetrans Function::, to either update `ARGIND' on +your own or modify this code as appropriate. + + The `rewind' function also relies on the `nextfile' keyword (*note +Nextfile Statement::). *Note Nextfile Function::, for a function +version of `nextfile'. + + +File: gawk.info, Node: File Checking, Next: Empty Files, Prev: Rewind Function, Up: Data File Management + +12.3.3 Checking for Readable Data Files +--------------------------------------- + +Normally, if you give `awk' a data file that isn't readable, it stops +with a fatal error. There are times when you might want to just ignore +such files and keep going. You can do this by prepending the following +program to your `awk' program: + + # readable.awk --- library file to skip over unreadable files + BEGIN { + for (i = 1; i < ARGC; i++) { + if (ARGV[i] ~ /^[A-Za-z_][A-Za-z0-9_]*=.*/ \ + || ARGV[i] == "-") + continue # assignment or standard input + else if ((getline junk < ARGV[i]) < 0) # unreadable + delete ARGV[i] + else + close(ARGV[i]) + } + } + + In `gawk', the `getline' won't be fatal (unless `--posix' is in +force). Removing the element from `ARGV' with `delete' skips the file +(since it's no longer in the list). + + +File: gawk.info, Node: Empty Files, Next: Ignoring Assigns, Prev: File Checking, Up: Data File Management + +12.3.4 Checking For Zero-length Files +------------------------------------- + +All known `awk' implementations silently skip over zero-length files. +This is a by-product of `awk''s implicit +read-a-record-and-match-against-the-rules loop: when `awk' tries to +read a record from an empty file, it immediately receives an end of +file indication, closes the file, and proceeds on to the next +command-line data file, _without_ executing any user-level `awk' +program code. + + Using `gawk''s `ARGIND' variable (*note Built-in Variables::), it is +possible to detect when an empty data file has been skipped. Similar +to the library file presented in *note Filetrans Function::, the +following library file calls a function named `zerofile' that the user +must provide. The arguments passed are the file name and the position +in `ARGV' where it was found: + + # zerofile.awk --- library file to process empty input files + BEGIN { Argind = 0 } + + ARGIND > Argind + 1 { + for (Argind++; Argind < ARGIND; Argind++) + zerofile(ARGV[Argind], Argind) + } + + ARGIND != Argind { Argind = ARGIND } + + END { + if (ARGIND > Argind) + for (Argind++; Argind <= ARGIND; Argind++) + zerofile(ARGV[Argind], Argind) + } + + The user-level variable `Argind' allows the `awk' program to track +its progress through `ARGV'. Whenever the program detects that +`ARGIND' is greater than `Argind + 1', it means that one or more empty +files were skipped. The action then calls `zerofile' for each such +file, incrementing `Argind' along the way. + + The `Argind != ARGIND' rule simply keeps `Argind' up to date in the +normal case. + + Finally, the `END' rule catches the case of any empty files at the +end of the command-line arguments. Note that the test in the condition +of the `for' loop uses the `<=' operator, not `<'. + + As an exercise, you might consider whether this same problem can be +solved without relying on `gawk''s `ARGIND' variable. + + As a second exercise, revise this code to handle the case where an +intervening value in `ARGV' is a variable assignment. + + +File: gawk.info, Node: Ignoring Assigns, Prev: Empty Files, Up: Data File Management + +12.3.5 Treating Assignments as File Names +----------------------------------------- + +Occasionally, you might not want `awk' to process command-line variable +assignments (*note Assignment Options::). In particular, if you have +file names that contain an `=' character, `awk' treats the file name as +an assignment, and does not process it. + + Some users have suggested an additional command-line option for +`gawk' to disable command-line assignments. However, some simple +programming with a library file does the trick: + + # noassign.awk --- library file to avoid the need for a + # special option that disables command-line assignments + function disable_assigns(argc, argv, i) + { + for (i = 1; i < argc; i++) + if (argv[i] ~ /^[A-Za-z_][A-Za-z_0-9]*=.*/) + argv[i] = ("./" argv[i]) + } + + BEGIN { + if (No_command_assign) + disable_assigns(ARGC, ARGV) + } + + You then run your program this way: + + awk -v No_command_assign=1 -f noassign.awk -f yourprog.awk * + + The function works by looping through the arguments. It prepends +`./' to any argument that matches the form of a variable assignment, +turning that argument into a file name. + + The use of `No_command_assign' allows you to disable command-line +assignments at invocation time, by giving the variable a true value. +When not set, it is initially zero (i.e., false), so the command-line +arguments are left alone. + + +File: gawk.info, Node: Getopt Function, Next: Passwd Functions, Prev: Data File Management, Up: Library Functions + +12.4 Processing Command-Line Options +==================================== + +Most utilities on POSIX compatible systems take options, or "switches," +on the command line that can be used to change the way a program +behaves. `awk' is an example of such a program (*note Options::). +Often, options take "arguments"; i.e., data that the program needs to +correctly obey the command-line option. For example, `awk''s `-F' +option requires a string to use as the field separator. The first +occurrence on the command line of either `--' or a string that does not +begin with `-' ends the options. + + Modern Unix systems provide a C function named `getopt' for +processing command-line arguments. The programmer provides a string +describing the one-letter options. If an option requires an argument, +it is followed in the string with a colon. `getopt' is also passed the +count and values of the command-line arguments and is called in a loop. +`getopt' processes the command-line arguments for option letters. Each +time around the loop, it returns a single character representing the +next option letter that it finds, or `?' if it finds an invalid option. +When it returns -1, there are no options left on the command line. + + When using `getopt', options that do not take arguments can be +grouped together. Furthermore, options that take arguments require +that the argument is present. The argument can immediately follow the +option letter, or it can be a separate command-line argument. + + Given a hypothetical program that takes three command-line options, +`-a', `-b', and `-c', where `-b' requires an argument, all of the +following are valid ways of invoking the program: + + prog -a -b foo -c data1 data2 data3 + prog -ac -bfoo -- data1 data2 data3 + prog -acbfoo data1 data2 data3 + + Notice that when the argument is grouped with its option, the rest of +the argument is considered to be the option's argument. In this +example, `-acbfoo' indicates that all of the `-a', `-b', and `-c' +options were supplied, and that `foo' is the argument to the `-b' +option. + + `getopt' provides four external variables that the programmer can +use: + +`optind' + The index in the argument value array (`argv') where the first + nonoption command-line argument can be found. + +`optarg' + The string value of the argument to an option. + +`opterr' + Usually `getopt' prints an error message when it finds an invalid + option. Setting `opterr' to zero disables this feature. (An + application might want to print its own error message.) + +`optopt' + The letter representing the command-line option. + + The following C fragment shows how `getopt' might process +command-line arguments for `awk': + + int + main(int argc, char *argv[]) + { + ... + /* print our own message */ + opterr = 0; + while ((c = getopt(argc, argv, "v:f:F:W:")) != -1) { + switch (c) { + case 'f': /* file */ + ... + break; + case 'F': /* field separator */ + ... + break; + case 'v': /* variable assignment */ + ... + break; + case 'W': /* extension */ + ... + break; + case '?': + default: + usage(); + break; + } + } + ... + } + + As a side point, `gawk' actually uses the GNU `getopt_long' function +to process both normal and GNU-style long options (*note Options::). + + The abstraction provided by `getopt' is very useful and is quite +handy in `awk' programs as well. Following is an `awk' version of +`getopt'. This function highlights one of the greatest weaknesses in +`awk', which is that it is very poor at manipulating single characters. +Repeated calls to `substr' are necessary for accessing individual +characters (*note String Functions::).(1) + + The discussion that follows walks through the code a bit at a time: + + # getopt.awk --- do C library getopt(3) function in awk + # External variables: + # Optind -- index in ARGV of first nonoption argument + # Optarg -- string value of argument to current option + # Opterr -- if nonzero, print our own diagnostic + # Optopt -- current option letter + + # Returns: + # -1 at end of options + # ? for unrecognized option + # <c> a character representing the current option + + # Private Data: + # _opti -- index in multi-flag option, e.g., -abc + + The function starts out with a list of the global variables it uses, +what the return values are, what they mean, and any global variables +that are "private" to this library function. Such documentation is +essential for any program, and particularly for library functions. + + The `getopt' function first checks that it was indeed called with a +string of options (the `options' parameter). If `options' has a zero +length, `getopt' immediately returns -1: + + function getopt(argc, argv, options, thisopt, i) + { + if (length(options) == 0) # no options given + return -1 + + if (argv[Optind] == "--") { # all done + Optind++ + _opti = 0 + return -1 + } else if (argv[Optind] !~ /^-[^: \t\n\f\r\v\b]/) { + _opti = 0 + return -1 + } + + The next thing to check for is the end of the options. A `--' ends +the command-line options, as does any command-line argument that does +not begin with a `-'. `Optind' is used to step through the array of +command-line arguments; it retains its value across calls to `getopt', +because it is a global variable. + + The regular expression that is used, `/^-[^: \t\n\f\r\v\b]/', is +perhaps a bit of overkill; it checks for a `-' followed by anything +that is not whitespace and not a colon. If the current command-line +argument does not match this pattern, it is not an option, and it ends +option processing: + + if (_opti == 0) + _opti = 2 + thisopt = substr(argv[Optind], _opti, 1) + Optopt = thisopt + i = index(options, thisopt) + if (i == 0) { + if (Opterr) + printf("%c -- invalid option\n", + thisopt) > "/dev/stderr" + if (_opti >= length(argv[Optind])) { + Optind++ + _opti = 0 + } else + _opti++ + return "?" + } + + The `_opti' variable tracks the position in the current command-line +argument (`argv[Optind]'). If multiple options are grouped together +with one `-' (e.g., `-abx'), it is necessary to return them to the user +one at a time. + + If `_opti' is equal to zero, it is set to two, which is the index in +the string of the next character to look at (we skip the `-', which is +at position one). The variable `thisopt' holds the character, obtained +with `substr'. It is saved in `Optopt' for the main program to use. + + If `thisopt' is not in the `options' string, then it is an invalid +option. If `Opterr' is nonzero, `getopt' prints an error message on +the standard error that is similar to the message from the C version of +`getopt'. + + Because the option is invalid, it is necessary to skip it and move +on to the next option character. If `_opti' is greater than or equal +to the length of the current command-line argument, it is necessary to +move on to the next argument, so `Optind' is incremented and `_opti' is +reset to zero. Otherwise, `Optind' is left alone and `_opti' is merely +incremented. + + In any case, because the option is invalid, `getopt' returns `?'. +The main program can examine `Optopt' if it needs to know what the +invalid option letter actually is. Continuing on: + + if (substr(options, i + 1, 1) == ":") { + # get option argument + if (length(substr(argv[Optind], _opti + 1)) > 0) + Optarg = substr(argv[Optind], _opti + 1) + else + Optarg = argv[++Optind] + _opti = 0 + } else + Optarg = "" + + If the option requires an argument, the option letter is followed by +a colon in the `options' string. If there are remaining characters in +the current command-line argument (`argv[Optind]'), then the rest of +that string is assigned to `Optarg'. Otherwise, the next command-line +argument is used (`-xFOO' versus `-x FOO'). In either case, `_opti' is +reset to zero, because there are no more characters left to examine in +the current command-line argument. Continuing: + + if (_opti == 0 || _opti >= length(argv[Optind])) { + Optind++ + _opti = 0 + } else + _opti++ + return thisopt + } + + Finally, if `_opti' is either zero or greater than the length of the +current command-line argument, it means this element in `argv' is +through being processed, so `Optind' is incremented to point to the +next element in `argv'. If neither condition is true, then only +`_opti' is incremented, so that the next option letter can be processed +on the next call to `getopt'. + + The `BEGIN' rule initializes both `Opterr' and `Optind' to one. +`Opterr' is set to one, since the default behavior is for `getopt' to +print a diagnostic message upon seeing an invalid option. `Optind' is +set to one, since there's no reason to look at the program name, which +is in `ARGV[0]': + + BEGIN { + Opterr = 1 # default is to diagnose + Optind = 1 # skip ARGV[0] + + # test program + if (_getopt_test) { + while ((_go_c = getopt(ARGC, ARGV, "ab:cd")) != -1) + printf("c = <%c>, optarg = <%s>\n", + _go_c, Optarg) + printf("non-option arguments:\n") + for (; Optind < ARGC; Optind++) + printf("\tARGV[%d] = <%s>\n", + Optind, ARGV[Optind]) + } + } + + The rest of the `BEGIN' rule is a simple test program. Here is the +result of two sample runs of the test program: + + $ awk -f getopt.awk -v _getopt_test=1 -- -a -cbARG bax -x + -| c = <a>, optarg = <> + -| c = <c>, optarg = <> + -| c = <b>, optarg = <ARG> + -| non-option arguments: + -| ARGV[3] = <bax> + -| ARGV[4] = <-x> + + $ awk -f getopt.awk -v _getopt_test=1 -- -a -x -- xyz abc + -| c = <a>, optarg = <> + error--> x -- invalid option + -| c = <?>, optarg = <> + -| non-option arguments: + -| ARGV[4] = <xyz> + -| ARGV[5] = <abc> + + In both runs, the first `--' terminates the arguments to `awk', so +that it does not try to interpret the `-a', etc., as its own options. + + NOTE: After `getopt' is through, it is the responsibility of the + user level code to clear out all the elements of `ARGV' from 1 to + `Optind', so that `awk' does not try to process the command-line + options as file names. + + Several of the sample programs presented in *note Sample Programs::, +use `getopt' to process their arguments. + + ---------- Footnotes ---------- + + (1) This function was written before `gawk' acquired the ability to +split strings into single characters using `""' as the separator. We +have left it alone, since using `substr' is more portable. + + +File: gawk.info, Node: Passwd Functions, Next: Group Functions, Prev: Getopt Function, Up: Library Functions + +12.5 Reading the User Database +============================== + +The `PROCINFO' array (*note Built-in Variables::) provides access to +the current user's real and effective user and group ID numbers, and if +available, the user's supplementary group set. However, because these +are numbers, they do not provide very useful information to the average +user. There needs to be some way to find the user information +associated with the user and group ID numbers. This minor node +presents a suite of functions for retrieving information from the user +database. *Note Group Functions::, for a similar suite that retrieves +information from the group database. + + The POSIX standard does not define the file where user information is +kept. Instead, it provides the `<pwd.h>' header file and several C +language subroutines for obtaining user information. The primary +function is `getpwent', for "get password entry." The "password" comes +from the original user database file, `/etc/passwd', which stores user +information, along with the encrypted passwords (hence the name). + + While an `awk' program could simply read `/etc/passwd' directly, +this file may not contain complete information about the system's set +of users.(1) To be sure you are able to produce a readable and complete +version of the user database, it is necessary to write a small C +program that calls `getpwent'. `getpwent' is defined as returning a +pointer to a `struct passwd'. Each time it is called, it returns the +next entry in the database. When there are no more entries, it returns +`NULL', the null pointer. When this happens, the C program should call +`endpwent' to close the database. Following is `pwcat', a C program +that "cats" the password database: + + /* + * pwcat.c + * + * Generate a printable version of the password database + */ + #include <stdio.h> + #include <pwd.h> + + int + main(argc, argv) + int argc; + char **argv; + { + struct passwd *p; + + while ((p = getpwent()) != NULL) + printf("%s:%s:%ld:%ld:%s:%s:%s\n", + p->pw_name, p->pw_passwd, (long) p->pw_uid, + (long) p->pw_gid, p->pw_gecos, p->pw_dir, p->pw_shell); + + endpwent(); + return 0; + } + + If you don't understand C, don't worry about it. The output from +`pwcat' is the user database, in the traditional `/etc/passwd' format +of colon-separated fields. The fields are: + +Login name The user's login name. +Encrypted password The user's encrypted password. This may not be + available on some systems. +User-ID The user's numeric user ID number. +Group-ID The user's numeric group ID number. +Full name The user's full name, and perhaps other + information associated with the user. +Home directory The user's login (or "home") directory + (familiar to shell programmers as `$HOME'). +Login shell The program that is run when the user logs in. + This is usually a shell, such as `bash'. + + A few lines representative of `pwcat''s output are as follows: + + $ pwcat + -| root:3Ov02d5VaUPB6:0:1:Operator:/:/bin/sh + -| nobody:*:65534:65534::/: + -| daemon:*:1:1::/: + -| sys:*:2:2::/:/bin/csh + -| bin:*:3:3::/bin: + -| arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/sh + -| miriam:yxaay:112:10:Miriam Robbins:/home/miriam:/bin/sh + -| andy:abcca2:113:10:Andy Jacobs:/home/andy:/bin/sh + ... + + With that introduction, following is a group of functions for +getting user information. There are several functions here, +corresponding to the C functions of the same names: + + # passwd.awk --- access password file information + BEGIN { + # tailor this to suit your system + _pw_awklib = "/usr/local/libexec/awk/" + } + + function _pw_init( oldfs, oldrs, olddol0, pwcat, using_fw) + { + if (_pw_inited) + return + + oldfs = FS + oldrs = RS + olddol0 = $0 + using_fw = (PROCINFO["FS"] == "FIELDWIDTHS") + FS = ":" + RS = "\n" + + pwcat = _pw_awklib "pwcat" + while ((pwcat | getline) > 0) { + _pw_byname[$1] = $0 + _pw_byuid[$3] = $0 + _pw_bycount[++_pw_total] = $0 + } + close(pwcat) + _pw_count = 0 + _pw_inited = 1 + FS = oldfs + if (using_fw) + FIELDWIDTHS = FIELDWIDTHS + RS = oldrs + $0 = olddol0 + } + + The `BEGIN' rule sets a private variable to the directory where +`pwcat' is stored. Because it is used to help out an `awk' library +routine, we have chosen to put it in `/usr/local/libexec/awk'; however, +you might want it to be in a different directory on your system. + + The function `_pw_init' keeps three copies of the user information +in three associative arrays. The arrays are indexed by username +(`_pw_byname'), by user ID number (`_pw_byuid'), and by order of +occurrence (`_pw_bycount'). The variable `_pw_inited' is used for +efficiency; `_pw_init' needs only to be called once. + + Because this function uses `getline' to read information from +`pwcat', it first saves the values of `FS', `RS', and `$0'. It notes +in the variable `using_fw' whether field splitting with `FIELDWIDTHS' +is in effect or not. Doing so is necessary, since these functions +could be called from anywhere within a user's program, and the user may +have his or her own way of splitting records and fields. + + The `using_fw' variable checks `PROCINFO["FS"]', which is +`"FIELDWIDTHS"' if field splitting is being done with `FIELDWIDTHS'. +This makes it possible to restore the correct field-splitting mechanism +later. The test can only be true for `gawk'. It is false if using +`FS' or on some other `awk' implementation. + + The main part of the function uses a loop to read database lines, +split the line into fields, and then store the line into each array as +necessary. When the loop is done, `_pw_init' cleans up by closing the +pipeline, setting `_pw_inited' to one, and restoring `FS' (and +`FIELDWIDTHS' if necessary), `RS', and `$0'. The use of `_pw_count' is +explained shortly. + + The `getpwnam' function takes a username as a string argument. If +that user is in the database, it returns the appropriate line. +Otherwise, it returns the null string: + + function getpwnam(name) + { + _pw_init() + if (name in _pw_byname) + return _pw_byname[name] + return "" + } + + Similarly, the `getpwuid' function takes a user ID number argument. +If that user number is in the database, it returns the appropriate +line. Otherwise, it returns the null string: + + function getpwuid(uid) + { + _pw_init() + if (uid in _pw_byuid) + return _pw_byuid[uid] + return "" + } + + The `getpwent' function simply steps through the database, one entry +at a time. It uses `_pw_count' to track its current position in the +`_pw_bycount' array: + + function getpwent() + { + _pw_init() + if (_pw_count < _pw_total) + return _pw_bycount[++_pw_count] + return "" + } + + The `endpwent' function resets `_pw_count' to zero, so that +subsequent calls to `getpwent' start over again: + + function endpwent() + { + _pw_count = 0 + } + + A conscious design decision in this suite was made that each +subroutine calls `_pw_init' to initialize the database arrays. The +overhead of running a separate process to generate the user database, +and the I/O to scan it, are only incurred if the user's main program +actually calls one of these functions. If this library file is loaded +along with a user's program, but none of the routines are ever called, +then there is no extra runtime overhead. (The alternative is move the +body of `_pw_init' into a `BEGIN' rule, which always runs `pwcat'. +This simplifies the code but runs an extra process that may never be +needed.) + + In turn, calling `_pw_init' is not too expensive, because the +`_pw_inited' variable keeps the program from reading the data more than +once. If you are worried about squeezing every last cycle out of your +`awk' program, the check of `_pw_inited' could be moved out of +`_pw_init' and duplicated in all the other functions. In practice, +this is not necessary, since most `awk' programs are I/O-bound, and it +clutters up the code. + + The `id' program in *note Id Program::, uses these functions. + + ---------- Footnotes ---------- + + (1) It is often the case that password information is stored in a +network database. + + +File: gawk.info, Node: Group Functions, Prev: Passwd Functions, Up: Library Functions + +12.6 Reading the Group Database +=============================== + +Much of the discussion presented in *note Passwd Functions::, applies +to the group database as well. Although there has traditionally been a +well-known file (`/etc/group') in a well-known format, the POSIX +standard only provides a set of C library routines (`<grp.h>' and +`getgrent') for accessing the information. Even though this file may +exist, it likely does not have complete information. Therefore, as +with the user database, it is necessary to have a small C program that +generates the group database as its output. + + `grcat', a C program that "cats" the group database, is as follows: + + /* + * grcat.c + * + * Generate a printable version of the group database + */ + #include <stdio.h> + #include <grp.h> + + int + main(argc, argv) + int argc; + char **argv; + { + struct group *g; + int i; + + while ((g = getgrent()) != NULL) { + printf("%s:%s:%ld:", g->gr_name, g->gr_passwd, + (long) g->gr_gid); + for (i = 0; g->gr_mem[i] != NULL; i++) { + printf("%s", g->gr_mem[i]); + if (g->gr_mem[i+1] != NULL) + putchar(','); + } + putchar('\n'); + } + endgrent(); + return 0; + } + + Each line in the group database represents one group. The fields are +separated with colons and represent the following information: + +Group name The group's name. +Group password The group's encrypted password. In practice, + this field is never used; it is usually empty + or set to `*'. +Group-ID The group's numeric group ID number; this + number should be unique within the file. +Group member list A comma-separated list of user names. These + users are members of the group. Modern Unix + systems allow users to be members of several + groups simultaneously. If your system does, + then there are elements `"group1"' through + `"groupN"' in `PROCINFO' for those group ID + numbers. (Note that `PROCINFO' is a `gawk' + extension; *note Built-in Variables::.) + + Here is what running `grcat' might produce: + + $ grcat + -| wheel:*:0:arnold + -| nogroup:*:65534: + -| daemon:*:1: + -| kmem:*:2: + -| staff:*:10:arnold,miriam,andy + -| other:*:20: + ... + + Here are the functions for obtaining information from the group +database. There are several, modeled after the C library functions of +the same names: + + # group.awk --- functions for dealing with the group file + BEGIN \ + { + # Change to suit your system + _gr_awklib = "/usr/local/libexec/awk/" + } + + function _gr_init( oldfs, oldrs, olddol0, grcat, + using_fw, n, a, i) + { + if (_gr_inited) + return + + oldfs = FS + oldrs = RS + olddol0 = $0 + using_fw = (PROCINFO["FS"] == "FIELDWIDTHS") + FS = ":" + RS = "\n" + + grcat = _gr_awklib "grcat" + while ((grcat | getline) > 0) { + if ($1 in _gr_byname) + _gr_byname[$1] = _gr_byname[$1] "," $4 + else + _gr_byname[$1] = $0 + if ($3 in _gr_bygid) + _gr_bygid[$3] = _gr_bygid[$3] "," $4 + else + _gr_bygid[$3] = $0 + + n = split($4, a, "[ \t]*,[ \t]*") + for (i = 1; i <= n; i++) + if (a[i] in _gr_groupsbyuser) + _gr_groupsbyuser[a[i]] = \ + _gr_groupsbyuser[a[i]] " " $1 + else + _gr_groupsbyuser[a[i]] = $1 + + _gr_bycount[++_gr_count] = $0 + } + close(grcat) + _gr_count = 0 + _gr_inited++ + FS = oldfs + if (using_fw) + FIELDWIDTHS = FIELDWIDTHS + RS = oldrs + $0 = olddol0 + } + + The `BEGIN' rule sets a private variable to the directory where +`grcat' is stored. Because it is used to help out an `awk' library +routine, we have chosen to put it in `/usr/local/libexec/awk'. You +might want it to be in a different directory on your system. + + These routines follow the same general outline as the user database +routines (*note Passwd Functions::). The `_gr_inited' variable is used +to ensure that the database is scanned no more than once. The +`_gr_init' function first saves `FS', `FIELDWIDTHS', `RS', and `$0', +and then sets `FS' and `RS' to the correct values for scanning the +group information. + + The group information is stored is several associative arrays. The +arrays are indexed by group name (`_gr_byname'), by group ID number +(`_gr_bygid'), and by position in the database (`_gr_bycount'). There +is an additional array indexed by user name (`_gr_groupsbyuser'), which +is a space-separated list of groups to which each user belongs. + + Unlike the user database, it is possible to have multiple records in +the database for the same group. This is common when a group has a +large number of members. A pair of such entries might look like the +following: + + tvpeople:*:101:johnny,jay,arsenio + tvpeople:*:101:david,conan,tom,joan + + For this reason, `_gr_init' looks to see if a group name or group ID +number is already seen. If it is, then the user names are simply +concatenated onto the previous list of users. (There is actually a +subtle problem with the code just presented. Suppose that the first +time there were no names. This code adds the names with a leading +comma. It also doesn't check that there is a `$4'.) + + Finally, `_gr_init' closes the pipeline to `grcat', restores `FS' +(and `FIELDWIDTHS' if necessary), `RS', and `$0', initializes +`_gr_count' to zero (it is used later), and makes `_gr_inited' nonzero. + + The `getgrnam' function takes a group name as its argument, and if +that group exists, it is returned. Otherwise, `getgrnam' returns the +null string: + + function getgrnam(group) + { + _gr_init() + if (group in _gr_byname) + return _gr_byname[group] + return "" + } + + The `getgrgid' function is similar, it takes a numeric group ID and +looks up the information associated with that group ID: + + function getgrgid(gid) + { + _gr_init() + if (gid in _gr_bygid) + return _gr_bygid[gid] + return "" + } + + The `getgruser' function does not have a C counterpart. It takes a +user name and returns the list of groups that have the user as a member: + + function getgruser(user) + { + _gr_init() + if (user in _gr_groupsbyuser) + return _gr_groupsbyuser[user] + return "" + } + + The `getgrent' function steps through the database one entry at a +time. It uses `_gr_count' to track its position in the list: + + function getgrent() + { + _gr_init() + if (++_gr_count in _gr_bycount) + return _gr_bycount[_gr_count] + return "" + } + + The `endgrent' function resets `_gr_count' to zero so that +`getgrent' can start over again: + + function endgrent() + { + _gr_count = 0 + } + + As with the user database routines, each function calls `_gr_init' to +initialize the arrays. Doing so only incurs the extra overhead of +running `grcat' if these functions are used (as opposed to moving the +body of `_gr_init' into a `BEGIN' rule). + + Most of the work is in scanning the database and building the various +associative arrays. The functions that the user calls are themselves +very simple, relying on `awk''s associative arrays to do work. + + The `id' program in *note Id Program::, uses these functions. + + +File: gawk.info, Node: Sample Programs, Next: Language History, Prev: Library Functions, Up: Top + +13 Practical `awk' Programs +*************************** + +*note Library Functions::, presents the idea that reading programs in a +language contributes to learning that language. This major node +continues that theme, presenting a potpourri of `awk' programs for your +reading enjoyment. + + Many of these programs use the library functions presented in *note +Library Functions::. + +* Menu: + +* Running Examples:: How to run these examples. +* Clones:: Clones of common utilities. +* Miscellaneous Programs:: Some interesting `awk' programs. + + +File: gawk.info, Node: Running Examples, Next: Clones, Up: Sample Programs + +13.1 Running the Example Programs +================================= + +To run a given program, you would typically do something like this: + + awk -f PROGRAM -- OPTIONS FILES + +Here, PROGRAM is the name of the `awk' program (such as `cut.awk'), +OPTIONS are any command-line options for the program that start with a +`-', and FILES are the actual data files. + + If your system supports the `#!' executable interpreter mechanism +(*note Executable Scripts::), you can instead run your program directly: + + cut.awk -c1-8 myfiles > results + + If your `awk' is not `gawk', you may instead need to use this: + + cut.awk -- -c1-8 myfiles > results + + +File: gawk.info, Node: Clones, Next: Miscellaneous Programs, Prev: Running Examples, Up: Sample Programs + +13.2 Reinventing Wheels for Fun and Profit +========================================== + +This minor node presents a number of POSIX utilities that are +implemented in `awk'. Reinventing these programs in `awk' is often +enjoyable, because the algorithms can be very clearly expressed, and +the code is usually very concise and simple. This is true because +`awk' does so much for you. + + It should be noted that these programs are not necessarily intended +to replace the installed versions on your system. Instead, their +purpose is to illustrate `awk' language programming for "real world" +tasks. + + The programs are presented in alphabetical order. + +* Menu: + +* Cut Program:: The `cut' utility. +* Egrep Program:: The `egrep' utility. +* Id Program:: The `id' utility. +* Split Program:: The `split' utility. +* Tee Program:: The `tee' utility. +* Uniq Program:: The `uniq' utility. +* Wc Program:: The `wc' utility. + + +File: gawk.info, Node: Cut Program, Next: Egrep Program, Up: Clones + +13.2.1 Cutting out Fields and Columns +------------------------------------- + +The `cut' utility selects, or "cuts," characters or fields from its +standard input and sends them to its standard output. Fields are +separated by tabs by default, but you may supply a command-line option +to change the field "delimiter" (i.e., the field-separator character). +`cut''s definition of fields is less general than `awk''s. + + A common use of `cut' might be to pull out just the login name of +logged-on users from the output of `who'. For example, the following +pipeline generates a sorted, unique list of the logged-on users: + + who | cut -c1-8 | sort | uniq + + The options for `cut' are: + +`-c LIST' + Use LIST as the list of characters to cut out. Items within the + list may be separated by commas, and ranges of characters can be + separated with dashes. The list `1-8,15,22-35' specifies + characters 1 through 8, 15, and 22 through 35. + +`-f LIST' + Use LIST as the list of fields to cut out. + +`-d DELIM' + Use DELIM as the field-separator character instead of the tab + character. + +`-s' + Suppress printing of lines that do not contain the field delimiter. + + The `awk' implementation of `cut' uses the `getopt' library function +(*note Getopt Function::) and the `join' library function (*note Join +Function::). + + The program begins with a comment describing the options, the library +functions needed, and a `usage' function that prints out a usage +message and exits. `usage' is called if invalid arguments are supplied: + + # cut.awk --- implement cut in awk + # Options: + # -f list Cut fields + # -d c Field delimiter character + # -c list Cut characters + # + # -s Suppress lines without the delimiter + # + # Requires getopt and join library functions + + function usage( e1, e2) + { + e1 = "usage: cut [-f list] [-d c] [-s] [files...]" + e2 = "usage: cut [-c list] [files...]" + print e1 > "/dev/stderr" + print e2 > "/dev/stderr" + exit 1 + } + +The variables `e1' and `e2' are used so that the function fits nicely +on the screen. + + Next comes a `BEGIN' rule that parses the command-line options. It +sets `FS' to a single TAB character, because that is `cut''s default +field separator. The output field separator is also set to be the same +as the input field separator. Then `getopt' is used to step through +the command-line options. Exactly one of the variables `by_fields' or +`by_chars' is set to true, to indicate that processing should be done +by fields or by characters, respectively. When cutting by characters, +the output field separator is set to the null string: + + BEGIN \ + { + FS = "\t" # default + OFS = FS + while ((c = getopt(ARGC, ARGV, "sf:c:d:")) != -1) { + if (c == "f") { + by_fields = 1 + fieldlist = Optarg + } else if (c == "c") { + by_chars = 1 + fieldlist = Optarg + OFS = "" + } else if (c == "d") { + if (length(Optarg) > 1) { + printf("Using first character of %s" \ + " for delimiter\n", Optarg) > "/dev/stderr" + Optarg = substr(Optarg, 1, 1) + } + FS = Optarg + OFS = FS + if (FS == " ") # defeat awk semantics + FS = "[ ]" + } else if (c == "s") + suppress++ + else + usage() + } + + for (i = 1; i < Optind; i++) + ARGV[i] = "" + + Special care is taken when the field delimiter is a space. Using a +single space (`" "') for the value of `FS' is incorrect--`awk' would +separate fields with runs of spaces, tabs, and/or newlines, and we want +them to be separated with individual spaces. Also remember that after +`getopt' is through (as described in *note Getopt Function::), we have +to clear out all the elements of `ARGV' from 1 to `Optind', so that +`awk' does not try to process the command-line options as file names. + + After dealing with the command-line options, the program verifies +that the options make sense. Only one or the other of `-c' and `-f' +should be used, and both require a field list. Then the program calls +either `set_fieldlist' or `set_charlist' to pull apart the list of +fields or characters: + + if (by_fields && by_chars) + usage() + + if (by_fields == 0 && by_chars == 0) + by_fields = 1 # default + + if (fieldlist == "") { + print "cut: needs list for -c or -f" > "/dev/stderr" + exit 1 + } + + if (by_fields) + set_fieldlist() + else + set_charlist() + } + + `set_fieldlist' is used to split the field list apart at the commas +and into an array. Then, for each element of the array, it looks to +see if it is actually a range, and if so, splits it apart. The range is +verified to make sure the first number is smaller than the second. +Each number in the list is added to the `flist' array, which simply +lists the fields that will be printed. Normal field splitting is used. +The program lets `awk' handle the job of doing the field splitting: + + function set_fieldlist( n, m, i, j, k, f, g) + { + n = split(fieldlist, f, ",") + j = 1 # index in flist + for (i = 1; i <= n; i++) { + if (index(f[i], "-") != 0) { # a range + m = split(f[i], g, "-") + if (m != 2 || g[1] >= g[2]) { + printf("bad field list: %s\n", + f[i]) > "/dev/stderr" + exit 1 + } + for (k = g[1]; k <= g[2]; k++) + flist[j++] = k + } else + flist[j++] = f[i] + } + nfields = j - 1 + } + + The `set_charlist' function is more complicated than `set_fieldlist'. +The idea here is to use `gawk''s `FIELDWIDTHS' variable (*note Constant +Size::), which describes constant-width input. When using a character +list, that is exactly what we have. + + Setting up `FIELDWIDTHS' is more complicated than simply listing the +fields that need to be printed. We have to keep track of the fields to +print and also the intervening characters that have to be skipped. For +example, suppose you wanted characters 1 through 8, 15, and 22 through +35. You would use `-c 1-8,15,22-35'. The necessary value for +`FIELDWIDTHS' is `"8 6 1 6 14"'. This yields five fields, and the +fields to print are `$1', `$3', and `$5'. The intermediate fields are +"filler", which is stuff in between the desired data. `flist' lists +the fields to print, and `t' tracks the complete field list, including +filler fields: + + function set_charlist( field, i, j, f, g, t, + filler, last, len) + { + field = 1 # count total fields + n = split(fieldlist, f, ",") + j = 1 # index in flist + for (i = 1; i <= n; i++) { + if (index(f[i], "-") != 0) { # range + m = split(f[i], g, "-") + if (m != 2 || g[1] >= g[2]) { + printf("bad character list: %s\n", + f[i]) > "/dev/stderr" + exit 1 + } + len = g[2] - g[1] + 1 + if (g[1] > 1) # compute length of filler + filler = g[1] - last - 1 + else + filler = 0 + if (filler) + t[field++] = filler + t[field++] = len # length of field + last = g[2] + flist[j++] = field - 1 + } else { + if (f[i] > 1) + filler = f[i] - last - 1 + else + filler = 0 + if (filler) + t[field++] = filler + t[field++] = 1 + last = f[i] + flist[j++] = field - 1 + } + } + FIELDWIDTHS = join(t, 1, field - 1) + nfields = j - 1 + } + + Next is the rule that actually processes the data. If the `-s' +option is given, then `suppress' is true. The first `if' statement +makes sure that the input record does have the field separator. If +`cut' is processing fields, `suppress' is true, and the field separator +character is not in the record, then the record is skipped. + + If the record is valid, then `gawk' has split the data into fields, +either using the character in `FS' or using fixed-length fields and +`FIELDWIDTHS'. The loop goes through the list of fields that should be +printed. The corresponding field is printed if it contains data. If +the next field also has data, then the separator character is written +out between the fields: + + { + if (by_fields && suppress && index($0, FS) != 0) + next + + for (i = 1; i <= nfields; i++) { + if ($flist[i] != "") { + printf "%s", $flist[i] + if (i < nfields && $flist[i+1] != "") + printf "%s", OFS + } + } + print "" + } + + This version of `cut' relies on `gawk''s `FIELDWIDTHS' variable to +do the character-based cutting. While it is possible in other `awk' +implementations to use `substr' (*note String Functions::), it is also +extremely painful. The `FIELDWIDTHS' variable supplies an elegant +solution to the problem of picking the input line apart by characters. + + +File: gawk.info, Node: Egrep Program, Next: Id Program, Prev: Cut Program, Up: Clones + +13.2.2 Searching for Regular Expressions in Files +------------------------------------------------- + +The `egrep' utility searches files for patterns. It uses regular +expressions that are almost identical to those available in `awk' +(*note Regexp::). It is used in the following manner: + + egrep [ OPTIONS ] 'PATTERN' FILES ... + + The PATTERN is a regular expression. In typical usage, the regular +expression is quoted to prevent the shell from expanding any of the +special characters as file name wildcards. Normally, `egrep' prints +the lines that matched. If multiple file names are provided on the +command line, each output line is preceded by the name of the file and +a colon. + + The options to `egrep' are as follows: + +`-c' + Print out a count of the lines that matched the pattern, instead + of the lines themselves. + +`-s' + Be silent. No output is produced and the exit value indicates + whether the pattern was matched. + +`-v' + Invert the sense of the test. `egrep' prints the lines that do + _not_ match the pattern and exits successfully if the pattern is + not matched. + +`-i' + Ignore case distinctions in both the pattern and the input data. + +`-l' + Only print (list) the names of the files that matched, not the + lines that matched. + +`-e PATTERN' + Use PATTERN as the regexp to match. The purpose of the `-e' + option is to allow patterns that start with a `-'. + + This version uses the `getopt' library function (*note Getopt +Function::) and the file transition library program (*note Filetrans +Function::). + + The program begins with a descriptive comment and then a `BEGIN' rule +that processes the command-line arguments with `getopt'. The `-i' +(ignore case) option is particularly easy with `gawk'; we just use the +`IGNORECASE' built-in variable (*note Built-in Variables::): + + # egrep.awk --- simulate egrep in awk + # Options: + # -c count of lines + # -s silent - use exit value + # -v invert test, success if no match + # -i ignore case + # -l print filenames only + # -e argument is pattern + # + # Requires getopt and file transition library functions + + BEGIN { + while ((c = getopt(ARGC, ARGV, "ce:svil")) != -1) { + if (c == "c") + count_only++ + else if (c == "s") + no_print++ + else if (c == "v") + invert++ + else if (c == "i") + IGNORECASE = 1 + else if (c == "l") + filenames_only++ + else if (c == "e") + pattern = Optarg + else + usage() + } + + Next comes the code that handles the `egrep'-specific behavior. If no +pattern is supplied with `-e', the first nonoption on the command line +is used. The `awk' command-line arguments up to `ARGV[Optind]' are +cleared, so that `awk' won't try to process them as files. If no files +are specified, the standard input is used, and if multiple files are +specified, we make sure to note this so that the file names can precede +the matched lines in the output: + + if (pattern == "") + pattern = ARGV[Optind++] + + for (i = 1; i < Optind; i++) + ARGV[i] = "" + if (Optind >= ARGC) { + ARGV[1] = "-" + ARGC = 2 + } else if (ARGC - Optind > 1) + do_filenames++ + + # if (IGNORECASE) + # pattern = tolower(pattern) + } + + The last two lines are commented out, since they are not needed in +`gawk'. They should be uncommented if you have to use another version +of `awk'. + + The next set of lines should be uncommented if you are not using +`gawk'. This rule translates all the characters in the input line into +lowercase if the `-i' option is specified.(1) The rule is commented out +since it is not necessary with `gawk': + + #{ + # if (IGNORECASE) + # $0 = tolower($0) + #} + + The `beginfile' function is called by the rule in `ftrans.awk' when +each new file is processed. In this case, it is very simple; all it +does is initialize a variable `fcount' to zero. `fcount' tracks how +many lines in the current file matched the pattern (naming the +parameter `junk' shows we know that `beginfile' is called with a +parameter, but that we're not interested in its value): + + function beginfile(junk) + { + fcount = 0 + } + + The `endfile' function is called after each file has been processed. +It affects the output only when the user wants a count of the number of +lines that matched. `no_print' is true only if the exit status is +desired. `count_only' is true if line counts are desired. `egrep' +therefore only prints line counts if printing and counting are enabled. +The output format must be adjusted depending upon the number of files to +process. Finally, `fcount' is added to `total', so that we know the +total number of lines that matched the pattern: + + function endfile(file) + { + if (! no_print && count_only) + if (do_filenames) + print file ":" fcount + else + print fcount + + total += fcount + } + + The following rule does most of the work of matching lines. The +variable `matches' is true if the line matched the pattern. If the user +wants lines that did not match, the sense of `matches' is inverted +using the `!' operator. `fcount' is incremented with the value of +`matches', which is either one or zero, depending upon a successful or +unsuccessful match. If the line does not match, the `next' statement +just moves on to the next record. + + A number of additional tests are made, but they are only done if we +are not counting lines. First, if the user only wants exit status +(`no_print' is true), then it is enough to know that _one_ line in this +file matched, and we can skip on to the next file with `nextfile'. +Similarly, if we are only printing file names, we can print the file +name, and then skip to the next file with `nextfile'. Finally, each +line is printed, with a leading file name and colon if necessary: + + { + matches = ($0 ~ pattern) + if (invert) + matches = ! matches + + fcount += matches # 1 or 0 + + if (! matches) + next + + if (! count_only) { + if (no_print) + nextfile + + if (filenames_only) { + print FILENAME + nextfile + } + + if (do_filenames) + print FILENAME ":" $0 + else + print + } + } + + The `END' rule takes care of producing the correct exit status. If +there are no matches, the exit status is one; otherwise it is zero: + + END \ + { + if (total == 0) + exit 1 + exit 0 + } + + The `usage' function prints a usage message in case of invalid +options, and then exits: + + function usage( e) + { + e = "Usage: egrep [-csvil] [-e pat] [files ...]" + e = e "\n\tegrep [-csvil] pat [files ...]" + print e > "/dev/stderr" + exit 1 + } + + The variable `e' is used so that the function fits nicely on the +printed page. + + Just a note on programming style: you may have noticed that the `END' +rule uses backslash continuation, with the open brace on a line by +itself. This is so that it more closely resembles the way functions +are written. Many of the examples in this major node use this style. +You can decide for yourself if you like writing your `BEGIN' and `END' +rules this way or not. + + ---------- Footnotes ---------- + + (1) It also introduces a subtle bug; if a match happens, we output +the translated line, not the original. + + +File: gawk.info, Node: Id Program, Next: Split Program, Prev: Egrep Program, Up: Clones + +13.2.3 Printing out User Information +------------------------------------ + +The `id' utility lists a user's real and effective user ID numbers, +real and effective group ID numbers, and the user's group set, if any. +`id' only prints the effective user ID and group ID if they are +different from the real ones. If possible, `id' also supplies the +corresponding user and group names. The output might look like this: + + $ id + -| uid=2076(arnold) gid=10(staff) groups=10(staff),4(tty) + + This information is part of what is provided by `gawk''s `PROCINFO' +array (*note Built-in Variables::). However, the `id' utility provides +a more palatable output than just individual numbers. + + Here is a simple version of `id' written in `awk'. It uses the user +database library functions (*note Passwd Functions::) and the group +database library functions (*note Group Functions::): + + The program is fairly straightforward. All the work is done in the +`BEGIN' rule. The user and group ID numbers are obtained from +`PROCINFO'. The code is repetitive. The entry in the user database +for the real user ID number is split into parts at the `:'. The name is +the first field. Similar code is used for the effective user ID number +and the group numbers: + + # id.awk --- implement id in awk + # + # Requires user and group library functions + # output is: + # uid=12(foo) euid=34(bar) gid=3(baz) \ + # egid=5(blat) groups=9(nine),2(two),1(one) + + BEGIN \ + { + uid = PROCINFO["uid"] + euid = PROCINFO["euid"] + gid = PROCINFO["gid"] + egid = PROCINFO["egid"] + + printf("uid=%d", uid) + pw = getpwuid(uid) + if (pw != "") { + split(pw, a, ":") + printf("(%s)", a[1]) + } + + if (euid != uid) { + printf(" euid=%d", euid) + pw = getpwuid(euid) + if (pw != "") { + split(pw, a, ":") + printf("(%s)", a[1]) + } + } + + printf(" gid=%d", gid) + pw = getgrgid(gid) + if (pw != "") { + split(pw, a, ":") + printf("(%s)", a[1]) + } + + if (egid != gid) { + printf(" egid=%d", egid) + pw = getgrgid(egid) + if (pw != "") { + split(pw, a, ":") + printf("(%s)", a[1]) + } + } + + for (i = 1; ("group" i) in PROCINFO; i++) { + if (i == 1) + printf(" groups=") + group = PROCINFO["group" i] + printf("%d", group) + pw = getgrgid(group) + if (pw != "") { + split(pw, a, ":") + printf("(%s)", a[1]) + } + if (("group" (i+1)) in PROCINFO) + printf(",") + } + + print "" + } + + The test in the `for' loop is worth noting. Any supplementary +groups in the `PROCINFO' array have the indices `"group1"' through +`"groupN"' for some N, i.e., the total number of supplementary groups. +However, we don't know in advance how many of these groups there are. + + This loop works by starting at one, concatenating the value with +`"group"', and then using `in' to see if that value is in the array. +Eventually, `i' is incremented past the last group in the array and the +loop exits. + + The loop is also correct if there are _no_ supplementary groups; +then the condition is false the first time it's tested, and the loop +body never executes. + + +File: gawk.info, Node: Split Program, Next: Tee Program, Prev: Id Program, Up: Clones + +13.2.4 Splitting a Large File into Pieces +----------------------------------------- + +The `split' program splits large text files into smaller pieces. Usage +is as follows: + + split [-COUNT] file [ PREFIX ] + + By default, the output files are named `xaa', `xab', and so on. Each +file has 1000 lines in it, with the likely exception of the last file. +To change the number of lines in each file, supply a number on the +command line preceded with a minus; e.g., `-500' for files with 500 +lines in them instead of 1000. To change the name of the output files +to something like `myfileaa', `myfileab', and so on, supply an +additional argument that specifies the file name prefix. + + Here is a version of `split' in `awk'. It uses the `ord' and `chr' +functions presented in *note Ordinal Functions::. + + The program first sets its defaults, and then tests to make sure +there are not too many arguments. It then looks at each argument in +turn. The first argument could be a minus sign followed by a number. +If it is, this happens to look like a negative number, so it is made +positive, and that is the count of lines. The data file name is +skipped over and the final argument is used as the prefix for the +output file names: + + # split.awk --- do split in awk + # + # Requires ord and chr library functions + # usage: split [-num] [file] [outname] + + BEGIN { + outfile = "x" # default + count = 1000 + if (ARGC > 4) + usage() + + i = 1 + if (ARGV[i] ~ /^-[0-9]+$/) { + count = -ARGV[i] + ARGV[i] = "" + i++ + } + # test argv in case reading from stdin instead of file + if (i in ARGV) + i++ # skip data file name + if (i in ARGV) { + outfile = ARGV[i] + ARGV[i] = "" + } + + s1 = s2 = "a" + out = (outfile s1 s2) + } + + The next rule does most of the work. `tcount' (temporary count) +tracks how many lines have been printed to the output file so far. If +it is greater than `count', it is time to close the current file and +start a new one. `s1' and `s2' track the current suffixes for the file +name. If they are both `z', the file is just too big. Otherwise, `s1' +moves to the next letter in the alphabet and `s2' starts over again at +`a': + + { + if (++tcount > count) { + close(out) + if (s2 == "z") { + if (s1 == "z") { + printf("split: %s is too large to split\n", + FILENAME) > "/dev/stderr" + exit 1 + } + s1 = chr(ord(s1) + 1) + s2 = "a" + } + else + s2 = chr(ord(s2) + 1) + out = (outfile s1 s2) + tcount = 1 + } + print > out + } + +The `usage' function simply prints an error message and exits: + + function usage( e) + { + e = "usage: split [-num] [file] [outname]" + print e > "/dev/stderr" + exit 1 + } + +The variable `e' is used so that the function fits nicely on the screen. + + This program is a bit sloppy; it relies on `awk' to automatically +close the last file instead of doing it in an `END' rule. It also +assumes that letters are contiguous in the character set, which isn't +true for EBCDIC systems. + + +File: gawk.info, Node: Tee Program, Next: Uniq Program, Prev: Split Program, Up: Clones + +13.2.5 Duplicating Output into Multiple Files +--------------------------------------------- + +The `tee' program is known as a "pipe fitting." `tee' copies its +standard input to its standard output and also duplicates it to the +files named on the command line. Its usage is as follows: + + tee [-a] file ... + + The `-a' option tells `tee' to append to the named files, instead of +truncating them and starting over. + + The `BEGIN' rule first makes a copy of all the command-line arguments +into an array named `copy'. `ARGV[0]' is not copied, since it is not +needed. `tee' cannot use `ARGV' directly, since `awk' attempts to +process each file name in `ARGV' as input data. + + If the first argument is `-a', then the flag variable `append' is +set to true, and both `ARGV[1]' and `copy[1]' are deleted. If `ARGC' is +less than two, then no file names were supplied and `tee' prints a +usage message and exits. Finally, `awk' is forced to read the standard +input by setting `ARGV[1]' to `"-"' and `ARGC' to two: + + # tee.awk --- tee in awk + BEGIN \ + { + for (i = 1; i < ARGC; i++) + copy[i] = ARGV[i] + + if (ARGV[1] == "-a") { + append = 1 + delete ARGV[1] + delete copy[1] + ARGC-- + } + if (ARGC < 2) { + print "usage: tee [-a] file ..." > "/dev/stderr" + exit 1 + } + ARGV[1] = "-" + ARGC = 2 + } + + The single rule does all the work. Since there is no pattern, it is +executed for each line of input. The body of the rule simply prints the +line into each file on the command line, and then to the standard +output: + + { + # moving the if outside the loop makes it run faster + if (append) + for (i in copy) + print >> copy[i] + else + for (i in copy) + print > copy[i] + print + } + +It is also possible to write the loop this way: + + for (i in copy) + if (append) + print >> copy[i] + else + print > copy[i] + +This is more concise but it is also less efficient. The `if' is tested +for each record and for each output file. By duplicating the loop +body, the `if' is only tested once for each input record. If there are +N input records and M output files, the first method only executes N +`if' statements, while the second executes N`*'M `if' statements. + + Finally, the `END' rule cleans up by closing all the output files: + + END \ + { + for (i in copy) + close(copy[i]) + } + + +File: gawk.info, Node: Uniq Program, Next: Wc Program, Prev: Tee Program, Up: Clones + +13.2.6 Printing Nonduplicated Lines of Text +------------------------------------------- + +The `uniq' utility reads sorted lines of data on its standard input, +and by default removes duplicate lines. In other words, it only prints +unique lines--hence the name. `uniq' has a number of options. The +usage is as follows: + + uniq [-udc [-N]] [+N] [ INPUT FILE [ OUTPUT FILE ]] + + The options for `uniq' are: + +`-d' + Pnly print only repeated lines. + +`-u' + Print only nonrepeated lines. + +`-c' + Count lines. This option overrides `-d' and `-u'. Both repeated + and nonrepeated lines are counted. + +`-N' + Skip N fields before comparing lines. The definition of fields is + similar to `awk''s default: nonwhitespace characters separated by + runs of spaces and/or tabs. + +`+N' + Skip N characters before comparing lines. Any fields specified + with `-N' are skipped first. + +`INPUT FILE' + Data is read from the input file named on the command line, + instead of from the standard input. + +`OUTPUT FILE' + The generated output is sent to the named output file, instead of + to the standard output. + + Normally `uniq' behaves as if both the `-d' and `-u' options are +provided. + + `uniq' uses the `getopt' library function (*note Getopt Function::) +and the `join' library function (*note Join Function::). + + The program begins with a `usage' function and then a brief outline +of the options and their meanings in a comment. The `BEGIN' rule deals +with the command-line arguments and options. It uses a trick to get +`getopt' to handle options of the form `-25', treating such an option +as the option letter `2' with an argument of `5'. If indeed two or more +digits are supplied (`Optarg' looks like a number), `Optarg' is +concatenated with the option digit and then the result is added to zero +to make it into a number. If there is only one digit in the option, +then `Optarg' is not needed. In this case, `Optind' must be decremented +so that `getopt' processes it next time. This code is admittedly a bit +tricky. + + If no options are supplied, then the default is taken, to print both +repeated and nonrepeated lines. The output file, if provided, is +assigned to `outputfile'. Early on, `outputfile' is initialized to the +standard output, `/dev/stdout': + + # uniq.awk --- do uniq in awk + # + # Requires getopt and join library functions + function usage( e) + { + e = "Usage: uniq [-udc [-n]] [+n] [ in [ out ]]" + print e > "/dev/stderr" + exit 1 + } + + # -c count lines. overrides -d and -u + # -d only repeated lines + # -u only non-repeated lines + # -n skip n fields + # +n skip n characters, skip fields first + + BEGIN \ + { + count = 1 + outputfile = "/dev/stdout" + opts = "udc0:1:2:3:4:5:6:7:8:9:" + while ((c = getopt(ARGC, ARGV, opts)) != -1) { + if (c == "u") + non_repeated_only++ + else if (c == "d") + repeated_only++ + else if (c == "c") + do_count++ + else if (index("0123456789", c) != 0) { + # getopt requires args to options + # this messes us up for things like -5 + if (Optarg ~ /^[0-9]+$/) + fcount = (c Optarg) + 0 + else { + fcount = c + 0 + Optind-- + } + } else + usage() + } + + if (ARGV[Optind] ~ /^\+[0-9]+$/) { + charcount = substr(ARGV[Optind], 2) + 0 + Optind++ + } + + for (i = 1; i < Optind; i++) + ARGV[i] = "" + + if (repeated_only == 0 && non_repeated_only == 0) + repeated_only = non_repeated_only = 1 + + if (ARGC - Optind == 2) { + outputfile = ARGV[ARGC - 1] + ARGV[ARGC - 1] = "" + } + } + + The following function, `are_equal', compares the current line, +`$0', to the previous line, `last'. It handles skipping fields and +characters. If no field count and no character count are specified, +`are_equal' simply returns one or zero depending upon the result of a +simple string comparison of `last' and `$0'. Otherwise, things get more +complicated. If fields have to be skipped, each line is broken into an +array using `split' (*note String Functions::); the desired fields are +then joined back into a line using `join'. The joined lines are stored +in `clast' and `cline'. If no fields are skipped, `clast' and `cline' +are set to `last' and `$0', respectively. Finally, if characters are +skipped, `substr' is used to strip off the leading `charcount' +characters in `clast' and `cline'. The two strings are then compared +and `are_equal' returns the result: + + function are_equal( n, m, clast, cline, alast, aline) + { + if (fcount == 0 && charcount == 0) + return (last == $0) + + if (fcount > 0) { + n = split(last, alast) + m = split($0, aline) + clast = join(alast, fcount+1, n) + cline = join(aline, fcount+1, m) + } else { + clast = last + cline = $0 + } + if (charcount) { + clast = substr(clast, charcount + 1) + cline = substr(cline, charcount + 1) + } + + return (clast == cline) + } + + The following two rules are the body of the program. The first one +is executed only for the very first line of data. It sets `last' equal +to `$0', so that subsequent lines of text have something to be compared +to. + + The second rule does the work. The variable `equal' is one or zero, +depending upon the results of `are_equal''s comparison. If `uniq' is +counting repeated lines, and the lines are equal, then it increments +the `count' variable. Otherwise, it prints the line and resets `count', +since the two lines are not equal. + + If `uniq' is not counting, and if the lines are equal, `count' is +incremented. Nothing is printed, since the point is to remove +duplicates. Otherwise, if `uniq' is counting repeated lines and more +than one line is seen, or if `uniq' is counting nonrepeated lines and +only one line is seen, then the line is printed, and `count' is reset. + + Finally, similar logic is used in the `END' rule to print the final +line of input data: + + NR == 1 { + last = $0 + next + } + + { + equal = are_equal() + + if (do_count) { # overrides -d and -u + if (equal) + count++ + else { + printf("%4d %s\n", count, last) > outputfile + last = $0 + count = 1 # reset + } + next + } + + if (equal) + count++ + else { + if ((repeated_only && count > 1) || + (non_repeated_only && count == 1)) + print last > outputfile + last = $0 + count = 1 + } + } + + END { + if (do_count) + printf("%4d %s\n", count, last) > outputfile + else if ((repeated_only && count > 1) || + (non_repeated_only && count == 1)) + print last > outputfile + } + + +File: gawk.info, Node: Wc Program, Prev: Uniq Program, Up: Clones + +13.2.7 Counting Things +---------------------- + +The `wc' (word count) utility counts lines, words, and characters in +one or more input files. Its usage is as follows: + + wc [-lwc] [ FILES ... ] + + If no files are specified on the command line, `wc' reads its +standard input. If there are multiple files, it also prints total +counts for all the files. The options and their meanings are shown in +the following list: + +`-l' + Count only lines. + +`-w' + Count only words. A "word" is a contiguous sequence of + nonwhitespace characters, separated by spaces and/or tabs. + Luckily, this is the normal way `awk' separates fields in its + input data. + +`-c' + Count only characters. + + Implementing `wc' in `awk' is particularly elegant, since `awk' does +a lot of the work for us; it splits lines into words (i.e., fields) and +counts them, it counts lines (i.e., records), and it can easily tell us +how long a line is. + + This uses the `getopt' library function (*note Getopt Function::) +and the file-transition functions (*note Filetrans Function::). + + This version has one notable difference from traditional versions of +`wc': it always prints the counts in the order lines, words, and +characters. Traditional versions note the order of the `-l', `-w', and +`-c' options on the command line, and print the counts in that order. + + The `BEGIN' rule does the argument processing. The variable +`print_total' is true if more than one file is named on the command +line: + + # wc.awk --- count lines, words, characters + + # Options: + # -l only count lines + # -w only count words + # -c only count characters + # + # Default is to count lines, words, characters + # + # Requires getopt and file transition library functions + + BEGIN { + # let getopt print a message about + # invalid options. we ignore them + while ((c = getopt(ARGC, ARGV, "lwc")) != -1) { + if (c == "l") + do_lines = 1 + else if (c == "w") + do_words = 1 + else if (c == "c") + do_chars = 1 + } + for (i = 1; i < Optind; i++) + ARGV[i] = "" + + # if no options, do all + if (! do_lines && ! do_words && ! do_chars) + do_lines = do_words = do_chars = 1 + + print_total = (ARGC - i > 2) + } + + The `beginfile' function is simple; it just resets the counts of +lines, words, and characters to zero, and saves the current file name in +`fname': + + function beginfile(file) + { + chars = lines = words = 0 + fname = FILENAME + } + + The `endfile' function adds the current file's numbers to the running +totals of lines, words, and characters.(1) It then prints out those +numbers for the file that was just read. It relies on `beginfile' to +reset the numbers for the following data file: + + function endfile(file) + { + tchars += chars + tlines += lines + twords += words + if (do_lines) + printf "\t%d", lines + if (do_words) + printf "\t%d", words + if (do_chars) + printf "\t%d", chars + printf "\t%s\n", fname + } + + There is one rule that is executed for each line. It adds the length +of the record, plus one, to `chars'. Adding one plus the record length +is needed because the newline character separating records (the value +of `RS') is not part of the record itself, and thus not included in its +length. Next, `lines' is incremented for each line read, and `words' +is incremented by the value of `NF', which is the number of "words" on +this line: + + # do per line + { + chars += length($0) + 1 # get newline + lines++ + words += NF + } + + Finally, the `END' rule simply prints the totals for all the files: + + END { + if (print_total) { + if (do_lines) + printf "\t%d", tlines + if (do_words) + printf "\t%d", twords + if (do_chars) + printf "\t%d", tchars + print "\ttotal" + } + } + + ---------- Footnotes ---------- + + (1) `wc' can't just use the value of `FNR' in `endfile'. If you +examine the code in *note Filetrans Function::, you will see that `FNR' +has already been reset by the time `endfile' is called. + + +File: gawk.info, Node: Miscellaneous Programs, Prev: Clones, Up: Sample Programs + +13.3 A Grab Bag of `awk' Programs +================================= + +This minor node is a large "grab bag" of miscellaneous programs. We +hope you find them both interesting and enjoyable. + +* Menu: + +* Dupword Program:: Finding duplicated words in a document. +* Alarm Program:: An alarm clock. +* Translate Program:: A program similar to the `tr' utility. +* Labels Program:: Printing mailing labels. +* Word Sorting:: A program to produce a word usage count. +* History Sorting:: Eliminating duplicate entries from a history + file. +* Extract Program:: Pulling out programs from Texinfo source + files. +* Simple Sed:: A Simple Stream Editor. +* Igawk Program:: A wrapper for `awk' that includes + files. + + +File: gawk.info, Node: Dupword Program, Next: Alarm Program, Up: Miscellaneous Programs + +13.3.1 Finding Duplicated Words in a Document +--------------------------------------------- + +A common error when writing large amounts of prose is to accidentally +duplicate words. Typically you will see this in text as something like +"the the program does the following..." When the text is online, often +the duplicated words occur at the end of one line and the beginning of +another, making them very difficult to spot. + + This program, `dupword.awk', scans through a file one line at a time +and looks for adjacent occurrences of the same word. It also saves the +last word on a line (in the variable `prev') for comparison with the +first word on the next line. + + The first two statements make sure that the line is all lowercase, +so that, for example, "The" and "the" compare equal to each other. The +next statement replaces nonalphanumeric and nonwhitespace characters +with spaces, so that punctuation does not affect the comparison either. +The characters are replaced with spaces so that formatting controls +don't create nonsense words (e.g., the Texinfo `@code{NF}' becomes +`codeNF' if punctuation is simply deleted). The record is then resplit +into fields, yielding just the actual words on the line, and ensuring +that there are no empty fields. + + If there are no fields left after removing all the punctuation, the +current record is skipped. Otherwise, the program loops through each +word, comparing it to the previous one: + + # dupword.awk --- find duplicate words in text + { + $0 = tolower($0) + gsub(/[^[:alnum:][:blank:]]/, " "); + $0 = $0 # re-split + if (NF == 0) + next + if ($1 == prev) + printf("%s:%d: duplicate %s\n", + FILENAME, FNR, $1) + for (i = 2; i <= NF; i++) + if ($i == $(i-1)) + printf("%s:%d: duplicate %s\n", + FILENAME, FNR, $i) + prev = $NF + } + + +File: gawk.info, Node: Alarm Program, Next: Translate Program, Prev: Dupword Program, Up: Miscellaneous Programs + +13.3.2 An Alarm Clock Program +----------------------------- + + Nothing cures insomnia like a ringing alarm clock. + Arnold Robbins + + The following program is a simple "alarm clock" program. You give +it a time of day and an optional message. At the specified time, it +prints the message on the standard output. In addition, you can give it +the number of times to repeat the message as well as a delay between +repetitions. + + This program uses the `gettimeofday' function from *note +Gettimeofday Function::. + + All the work is done in the `BEGIN' rule. The first part is argument +checking and setting of defaults: the delay, the count, and the message +to print. If the user supplied a message without the ASCII BEL +character (known as the "alert" character, `"\a"'), then it is added to +the message. (On many systems, printing the ASCII BEL generates an +audible alert. Thus when the alarm goes off, the system calls attention +to itself in case the user is not looking at the computer or terminal.) +Here is the program: + + # alarm.awk --- set an alarm + # + # Requires gettimeofday library function + # usage: alarm time [ "message" [ count [ delay ] ] ] + + BEGIN \ + { + # Initial argument sanity checking + usage1 = "usage: alarm time ['message' [count [delay]]]" + usage2 = sprintf("\t(%s) time ::= hh:mm", ARGV[1]) + + if (ARGC < 2) { + print usage1 > "/dev/stderr" + print usage2 > "/dev/stderr" + exit 1 + } else if (ARGC == 5) { + delay = ARGV[4] + 0 + count = ARGV[3] + 0 + message = ARGV[2] + } else if (ARGC == 4) { + count = ARGV[3] + 0 + message = ARGV[2] + } else if (ARGC == 3) { + message = ARGV[2] + } else if (ARGV[1] !~ /[0-9]?[0-9]:[0-9][0-9]/) { + print usage1 > "/dev/stderr" + print usage2 > "/dev/stderr" + exit 1 + } + + # set defaults for once we reach the desired time + if (delay == 0) + delay = 180 # 3 minutes + if (count == 0) + count = 5 + if (message == "") + message = sprintf("\aIt is now %s!\a", ARGV[1]) + else if (index(message, "\a") == 0) + message = "\a" message "\a" + + The next minor node of code turns the alarm time into hours and +minutes, converts it (if necessary) to a 24-hour clock, and then turns +that time into a count of the seconds since midnight. Next it turns +the current time into a count of seconds since midnight. The +difference between the two is how long to wait before setting off the +alarm: + + # split up alarm time + split(ARGV[1], atime, ":") + hour = atime[1] + 0 # force numeric + minute = atime[2] + 0 # force numeric + + # get current broken down time + gettimeofday(now) + + # if time given is 12-hour hours and it's after that + # hour, e.g., `alarm 5:30' at 9 a.m. means 5:30 p.m., + # then add 12 to real hour + if (hour < 12 && now["hour"] > hour) + hour += 12 + + # set target time in seconds since midnight + target = (hour * 60 * 60) + (minute * 60) + + # get current time in seconds since midnight + current = (now["hour"] * 60 * 60) + \ + (now["minute"] * 60) + now["second"] + + # how long to sleep for + naptime = target - current + if (naptime <= 0) { + print "time is in the past!" > "/dev/stderr" + exit 1 + } + + Finally, the program uses the `system' function (*note I/O +Functions::) to call the `sleep' utility. The `sleep' utility simply +pauses for the given number of seconds. If the exit status is not zero, +the program assumes that `sleep' was interrupted and exits. If `sleep' +exited with an OK status (zero), then the program prints the message in +a loop, again using `sleep' to delay for however many seconds are +necessary: + + # zzzzzz..... go away if interrupted + if (system(sprintf("sleep %d", naptime)) != 0) + exit 1 + + # time to notify! + command = sprintf("sleep %d", delay) + for (i = 1; i <= count; i++) { + print message + # if sleep command interrupted, go away + if (system(command) != 0) + break + } + + exit 0 + } + + +File: gawk.info, Node: Translate Program, Next: Labels Program, Prev: Alarm Program, Up: Miscellaneous Programs + +13.3.3 Transliterating Characters +--------------------------------- + +The system `tr' utility transliterates characters. For example, it is +often used to map uppercase letters into lowercase for further +processing: + + GENERATE DATA | tr 'A-Z' 'a-z' | PROCESS DATA ... + + `tr' requires two lists of characters.(1) When processing the +input, the first character in the first list is replaced with the first +character in the second list, the second character in the first list is +replaced with the second character in the second list, and so on. If +there are more characters in the "from" list than in the "to" list, the +last character of the "to" list is used for the remaining characters in +the "from" list. + + Some time ago, a user proposed that a transliteration function should +be added to `gawk'. The following program was written to prove that +character transliteration could be done with a user-level function. +This program is not as complete as the system `tr' utility but it does +most of the job. + + The `translate' program demonstrates one of the few weaknesses of +standard `awk': dealing with individual characters is very painful, +requiring repeated use of the `substr', `index', and `gsub' built-in +functions (*note String Functions::).(2) There are two functions. The +first, `stranslate', takes three arguments: + +`from' + A list of characters from which to translate. + +`to' + A list of characters to which to translate. + +`target' + The string on which to do the translation. + + Associative arrays make the translation part fairly easy. `t_ar' +holds the "to" characters, indexed by the "from" characters. Then a +simple loop goes through `from', one character at a time. For each +character in `from', if the character appears in `target', `gsub' is +used to change it to the corresponding `to' character. + + The `translate' function simply calls `stranslate' using `$0' as the +target. The main program sets two global variables, `FROM' and `TO', +from the command line, and then changes `ARGV' so that `awk' reads from +the standard input. + + Finally, the processing rule simply calls `translate' for each +record: + + # translate.awk --- do tr-like stuff + # Bugs: does not handle things like: tr A-Z a-z, it has + # to be spelled out. However, if `to' is shorter than `from', + # the last character in `to' is used for the rest of `from'. + + function stranslate(from, to, target, lf, lt, t_ar, i, c) + { + lf = length(from) + lt = length(to) + for (i = 1; i <= lt; i++) + t_ar[substr(from, i, 1)] = substr(to, i, 1) + if (lt < lf) + for (; i <= lf; i++) + t_ar[substr(from, i, 1)] = substr(to, lt, 1) + for (i = 1; i <= lf; i++) { + c = substr(from, i, 1) + if (index(target, c) > 0) + gsub(c, t_ar[c], target) + } + return target + } + + function translate(from, to) + { + return $0 = stranslate(from, to, $0) + } + + # main program + BEGIN { + if (ARGC < 3) { + print "usage: translate from to" > "/dev/stderr" + exit + } + FROM = ARGV[1] + TO = ARGV[2] + ARGC = 2 + ARGV[1] = "-" + } + + { + translate(FROM, TO) + print + } + + While it is possible to do character transliteration in a user-level +function, it is not necessarily efficient, and we (the `gawk' authors) +started to consider adding a built-in function. However, shortly after +writing this program, we learned that the System V Release 4 `awk' had +added the `toupper' and `tolower' functions (*note String Functions::). +These functions handle the vast majority of the cases where character +transliteration is necessary, and so we chose to simply add those +functions to `gawk' as well and then leave well enough alone. + + An obvious improvement to this program would be to set up the `t_ar' +array only once, in a `BEGIN' rule. However, this assumes that the +"from" and "to" lists will never change throughout the lifetime of the +program. + + ---------- Footnotes ---------- + + (1) On some older System V systems, `tr' may require that the lists +be written as range expressions enclosed in square brackets (`[a-z]') +and quoted, to prevent the shell from attempting a file name expansion. +This is not a feature. + + (2) This program was written before `gawk' acquired the ability to +split each character in a string into separate array elements. + + +File: gawk.info, Node: Labels Program, Next: Word Sorting, Prev: Translate Program, Up: Miscellaneous Programs + +13.3.4 Printing Mailing Labels +------------------------------ + +Here is a "real world"(1) program. This script reads lists of names and +addresses and generates mailing labels. Each page of labels has 20 +labels on it, 2 across and 10 down. The addresses are guaranteed to be +no more than 5 lines of data. Each address is separated from the next +by a blank line. + + The basic idea is to read 20 labels worth of data. Each line of +each label is stored in the `line' array. The single rule takes care +of filling the `line' array and printing the page when 20 labels have +been read. + + The `BEGIN' rule simply sets `RS' to the empty string, so that `awk' +splits records at blank lines (*note Records::). It sets `MAXLINES' to +100, since 100 is the maximum number of lines on the page (20 * 5 = +100). + + Most of the work is done in the `printpage' function. The label +lines are stored sequentially in the `line' array. But they have to +print horizontally; `line[1]' next to `line[6]', `line[2]' next to +`line[7]', and so on. Two loops are used to accomplish this. The +outer loop, controlled by `i', steps through every 10 lines of data; +this is each row of labels. The inner loop, controlled by `j', goes +through the lines within the row. As `j' goes from 0 to 4, `i+j' is +the `j'-th line in the row, and `i+j+5' is the entry next to it. The +output ends up looking something like this: + + line 1 line 6 + line 2 line 7 + line 3 line 8 + line 4 line 9 + line 5 line 10 + ... + + As a final note, an extra blank line is printed at lines 21 and 61, +to keep the output lined up on the labels. This is dependent on the +particular brand of labels in use when the program was written. You +will also note that there are 2 blank lines at the top and 2 blank +lines at the bottom. + + The `END' rule arranges to flush the final page of labels; there may +not have been an even multiple of 20 labels in the data: + + # labels.awk --- print mailing labels + + # Each label is 5 lines of data that may have blank lines. + # The label sheets have 2 blank lines at the top and 2 at + # the bottom. + + BEGIN { RS = "" ; MAXLINES = 100 } + + function printpage( i, j) + { + if (Nlines <= 0) + return + + printf "\n\n" # header + + for (i = 1; i <= Nlines; i += 10) { + if (i == 21 || i == 61) + print "" + for (j = 0; j < 5; j++) { + if (i + j > MAXLINES) + break + printf " %-41s %s\n", line[i+j], line[i+j+5] + } + print "" + } + + printf "\n\n" # footer + + for (i in line) + line[i] = "" + } + + # main rule + { + if (Count >= 20) { + printpage() + Count = 0 + Nlines = 0 + } + n = split($0, a, "\n") + for (i = 1; i <= n; i++) + line[++Nlines] = a[i] + for (; i <= 5; i++) + line[++Nlines] = "" + Count++ + } + + END \ + { + printpage() + } + + ---------- Footnotes ---------- + + (1) "Real world" is defined as "a program actually used to get +something done." + + +File: gawk.info, Node: Word Sorting, Next: History Sorting, Prev: Labels Program, Up: Miscellaneous Programs + +13.3.5 Generating Word-Usage Counts +----------------------------------- + +The following `awk' program prints the number of occurrences of each +word in its input. It illustrates the associative nature of `awk' +arrays by using strings as subscripts. It also demonstrates the `for +INDEX in ARRAY' mechanism. Finally, it shows how `awk' is used in +conjunction with other utility programs to do a useful task of some +complexity with a minimum of effort. Some explanations follow the +program listing: + + # Print list of word frequencies + { + for (i = 1; i <= NF; i++) + freq[$i]++ + } + + END { + for (word in freq) + printf "%s\t%d\n", word, freq[word] + } + + This program has two rules. The first rule, because it has an empty +pattern, is executed for every input line. It uses `awk''s +field-accessing mechanism (*note Fields::) to pick out the individual +words from the line, and the built-in variable `NF' (*note Built-in +Variables::) to know how many fields are available. For each input +word, it increments an element of the array `freq' to reflect that the +word has been seen an additional time. + + The second rule, because it has the pattern `END', is not executed +until the input has been exhausted. It prints out the contents of the +`freq' table that has been built up inside the first action. This +program has several problems that would prevent it from being useful by +itself on real text files: + + * Words are detected using the `awk' convention that fields are + separated just by whitespace. Other characters in the input + (except newlines) don't have any special meaning to `awk'. This + means that punctuation characters count as part of words. + + * The `awk' language considers upper- and lowercase characters to be + distinct. Therefore, "bartender" and "Bartender" are not treated + as the same word. This is undesirable, since in normal text, words + are capitalized if they begin sentences, and a frequency analyzer + should not be sensitive to capitalization. + + * The output does not come out in any useful order. You're more + likely to be interested in which words occur most frequently or in + having an alphabetized table of how frequently each word occurs. + + The way to solve these problems is to use some of `awk''s more +advanced features. First, we use `tolower' to remove case +distinctions. Next, we use `gsub' to remove punctuation characters. +Finally, we use the system `sort' utility to process the output of the +`awk' script. Here is the new version of the program: + + # wordfreq.awk --- print list of word frequencies + + { + $0 = tolower($0) # remove case distinctions + # remove punctuation + gsub(/[^[:alnum:]_[:blank:]]/, "", $0) + for (i = 1; i <= NF; i++) + freq[$i]++ + } + + END { + for (word in freq) + printf "%s\t%d\n", word, freq[word] + } + + Assuming we have saved this program in a file named `wordfreq.awk', +and that the data is in `file1', the following pipeline: + + awk -f wordfreq.awk file1 | sort -k 2nr + +produces a table of the words appearing in `file1' in order of +decreasing frequency. The `awk' program suitably massages the data and +produces a word frequency table, which is not ordered. + + The `awk' script's output is then sorted by the `sort' utility and +printed on the terminal. The options given to `sort' specify a sort +that uses the second field of each input line (skipping one field), +that the sort keys should be treated as numeric quantities (otherwise +`15' would come before `5'), and that the sorting should be done in +descending (reverse) order. + + The `sort' could even be done from within the program, by changing +the `END' action to: + + END { + sort = "sort -k 2nr" + for (word in freq) + printf "%s\t%d\n", word, freq[word] | sort + close(sort) + } + + This way of sorting must be used on systems that do not have true +pipes at the command-line (or batch-file) level. See the general +operating system documentation for more information on how to use the +`sort' program. + + +File: gawk.info, Node: History Sorting, Next: Extract Program, Prev: Word Sorting, Up: Miscellaneous Programs + +13.3.6 Removing Duplicates from Unsorted Text +--------------------------------------------- + +The `uniq' program (*note Uniq Program::), removes duplicate lines from +_sorted_ data. + + Suppose, however, you need to remove duplicate lines from a data +file but that you want to preserve the order the lines are in. A good +example of this might be a shell history file. The history file keeps +a copy of all the commands you have entered, and it is not unusual to +repeat a command several times in a row. Occasionally you might want +to compact the history by removing duplicate entries. Yet it is +desirable to maintain the order of the original commands. + + This simple program does the job. It uses two arrays. The `data' +array is indexed by the text of each line. For each line, `data[$0]' +is incremented. If a particular line has not been seen before, then +`data[$0]' is zero. In this case, the text of the line is stored in +`lines[count]'. Each element of `lines' is a unique command, and the +indices of `lines' indicate the order in which those lines are +encountered. The `END' rule simply prints out the lines, in order: + + # histsort.awk --- compact a shell history file + # Thanks to Byron Rakitzis for the general idea + { + if (data[$0]++ == 0) + lines[++count] = $0 + } + + END { + for (i = 1; i <= count; i++) + print lines[i] + } + + This program also provides a foundation for generating other useful +information. For example, using the following `print' statement in the +`END' rule indicates how often a particular command is used: + + print data[lines[i]], lines[i] + + This works because `data[$0]' is incremented each time a line is +seen. + + +File: gawk.info, Node: Extract Program, Next: Simple Sed, Prev: History Sorting, Up: Miscellaneous Programs + +13.3.7 Extracting Programs from Texinfo Source Files +---------------------------------------------------- + +The nodes *note Library Functions::, and *note Sample Programs::, are +the top level nodes for a large number of `awk' programs. If you want +to experiment with these programs, it is tedious to have to type them +in by hand. Here we present a program that can extract parts of a +Texinfo input file into separate files. + +This Info file is written in Texinfo, the GNU project's document +formatting language. A single Texinfo source file can be used to +produce both printed and online documentation. The Texinfo language is +described fully, starting with *note Top::. + + For our purposes, it is enough to know three things about Texinfo +input files: + + * The "at" symbol (`@') is special in Texinfo, much as the backslash + (`\') is in C or `awk'. Literal `@' symbols are represented in + Texinfo source files as `@@'. + + * Comments start with either `@c' or `@comment'. The + file-extraction program works by using special comments that start + at the beginning of a line. + + * Lines containing `@group' and `@end group' commands bracket + example text that should not be split across a page boundary. + (Unfortunately, TeX isn't always smart enough to do things exactly + right, and we have to give it some help.) + + The following program, `extract.awk', reads through a Texinfo source +file and does two things, based on the special comments. Upon seeing +`@c system ...', it runs a command, by extracting the command text from +the control line and passing it on to the `system' function (*note I/O +Functions::). Upon seeing `@c file FILENAME', each subsequent line is +sent to the file FILENAME, until `@c endfile' is encountered. The +rules in `extract.awk' match either `@c' or `@comment' by letting the +`omment' part be optional. Lines containing `@group' and `@end group' +are simply removed. `extract.awk' uses the `join' library function +(*note Join Function::). + + The example programs in the online Texinfo source for `GAWK: +Effective AWK Programming' (`gawk.texi') have all been bracketed inside +`file' and `endfile' lines. The `gawk' distribution uses a copy of +`extract.awk' to extract the sample programs and install many of them +in a standard directory where `gawk' can find them. The Texinfo file +looks something like this: + + ... + This program has a @code{BEGIN} rule, + that prints a nice message: + + @example + @c file examples/messages.awk + BEGIN @{ print "Don't panic!" @} + @c end file + @end example + + It also prints some final advice: + + @example + @c file examples/messages.awk + END @{ print "Always avoid bored archeologists!" @} + @c end file + @end example + ... + + `extract.awk' begins by setting `IGNORECASE' to one, so that mixed +upper- and lowercase letters in the directives won't matter. + + The first rule handles calling `system', checking that a command is +given (`NF' is at least three) and also checking that the command exits +with a zero exit status, signifying OK: + + # extract.awk --- extract files and run programs + # from texinfo files + BEGIN { IGNORECASE = 1 } + + /^@c(omment)?[ \t]+system/ \ + { + if (NF < 3) { + e = (FILENAME ":" FNR) + e = (e ": badly formed `system' line") + print e > "/dev/stderr" + next + } + $1 = "" + $2 = "" + stat = system($0) + if (stat != 0) { + e = (FILENAME ":" FNR) + e = (e ": warning: system returned " stat) + print e > "/dev/stderr" + } + } + +The variable `e' is used so that the function fits nicely on the screen. + + The second rule handles moving data into files. It verifies that a +file name is given in the directive. If the file named is not the +current file, then the current file is closed. Keeping the current file +open until a new file is encountered allows the use of the `>' +redirection for printing the contents, keeping open file management +simple. + + The `for' loop does the work. It reads lines using `getline' (*note +Getline::). For an unexpected end of file, it calls the +`unexpected_eof' function. If the line is an "endfile" line, then it +breaks out of the loop. If the line is an `@group' or `@end group' +line, then it ignores it and goes on to the next line. Similarly, +comments within examples are also ignored. + + Most of the work is in the following few lines. If the line has no +`@' symbols, the program can print it directly. Otherwise, each +leading `@' must be stripped off. To remove the `@' symbols, the line +is split into separate elements of the array `a', using the `split' +function (*note String Functions::). The `@' symbol is used as the +separator character. Each element of `a' that is empty indicates two +successive `@' symbols in the original line. For each two empty +elements (`@@' in the original file), we have to add a single `@' +symbol back in. + + When the processing of the array is finished, `join' is called with +the value of `SUBSEP', to rejoin the pieces back into a single line. +That line is then printed to the output file: + + /^@c(omment)?[ \t]+file/ \ + { + if (NF != 3) { + e = (FILENAME ":" FNR ": badly formed `file' line") + print e > "/dev/stderr" + next + } + if ($3 != curfile) { + if (curfile != "") + close(curfile) + curfile = $3 + } + + for (;;) { + if ((getline line) <= 0) + unexpected_eof() + if (line ~ /^@c(omment)?[ \t]+endfile/) + break + else if (line ~ /^@(end[ \t]+)?group/) + continue + else if (line ~ /^@c(omment+)?[ \t]+/) + continue + if (index(line, "@") == 0) { + print line > curfile + continue + } + n = split(line, a, "@") + # if a[1] == "", means leading @, + # don't add one back in. + for (i = 2; i <= n; i++) { + if (a[i] == "") { # was an @@ + a[i] = "@" + if (a[i+1] == "") + i++ + } + } + print join(a, 1, n, SUBSEP) > curfile + } + } + + An important thing to note is the use of the `>' redirection. +Output done with `>' only opens the file once; it stays open and +subsequent output is appended to the file (*note Redirection::). This +makes it easy to mix program text and explanatory prose for the same +sample source file (as has been done here!) without any hassle. The +file is only closed when a new data file name is encountered or at the +end of the input file. + + Finally, the function `unexpected_eof' prints an appropriate error +message and then exits. The `END' rule handles the final cleanup, +closing the open file: + + function unexpected_eof() { + printf("%s:%d: unexpected EOF or error\n", + FILENAME, FNR) > "/dev/stderr" + exit 1 + } + + END { + if (curfile) + close(curfile) + } + + +File: gawk.info, Node: Simple Sed, Next: Igawk Program, Prev: Extract Program, Up: Miscellaneous Programs + +13.3.8 A Simple Stream Editor +----------------------------- + +The `sed' utility is a stream editor, a program that reads a stream of +data, makes changes to it, and passes it on. It is often used to make +global changes to a large file or to a stream of data generated by a +pipeline of commands. While `sed' is a complicated program in its own +right, its most common use is to perform global substitutions in the +middle of a pipeline: + + command1 < orig.data | sed 's/old/new/g' | command2 > result + + Here, `s/old/new/g' tells `sed' to look for the regexp `old' on each +input line and globally replace it with the text `new', i.e., all the +occurrences on a line. This is similar to `awk''s `gsub' function +(*note String Functions::). + + The following program, `awksed.awk', accepts at least two +command-line arguments: the pattern to look for and the text to replace +it with. Any additional arguments are treated as data file names to +process. If none are provided, the standard input is used: + + # awksed.awk --- do s/foo/bar/g using just print + # Thanks to Michael Brennan for the idea + function usage() + { + print "usage: awksed pat repl [files...]" > "/dev/stderr" + exit 1 + } + + BEGIN { + # validate arguments + if (ARGC < 3) + usage() + + RS = ARGV[1] + ORS = ARGV[2] + + # don't use arguments as files + ARGV[1] = ARGV[2] = "" + } + + # look ma, no hands! + { + if (RT == "") + printf "%s", $0 + else + print + } + + The program relies on `gawk''s ability to have `RS' be a regexp, as +well as on the setting of `RT' to the actual text that terminates the +record (*note Records::). + + The idea is to have `RS' be the pattern to look for. `gawk' +automatically sets `$0' to the text between matches of the pattern. +This is text that we want to keep, unmodified. Then, by setting `ORS' +to the replacement text, a simple `print' statement outputs the text we +want to keep, followed by the replacement text. + + There is one wrinkle to this scheme, which is what to do if the last +record doesn't end with text that matches `RS'. Using a `print' +statement unconditionally prints the replacement text, which is not +correct. However, if the file did not end in text that matches `RS', +`RT' is set to the null string. In this case, we can print `$0' using +`printf' (*note Printf::). + + The `BEGIN' rule handles the setup, checking for the right number of +arguments and calling `usage' if there is a problem. Then it sets `RS' +and `ORS' from the command-line arguments and sets `ARGV[1]' and +`ARGV[2]' to the null string, so that they are not treated as file names +(*note ARGC and ARGV::). + + The `usage' function prints an error message and exits. Finally, +the single rule handles the printing scheme outlined above, using +`print' or `printf' as appropriate, depending upon the value of `RT'. + + +File: gawk.info, Node: Igawk Program, Prev: Simple Sed, Up: Miscellaneous Programs + +13.3.9 An Easy Way to Use Library Functions +------------------------------------------- + +Using library functions in `awk' can be very beneficial. It encourages +code reuse and the writing of general functions. Programs are smaller +and therefore clearer. However, using library functions is only easy +when writing `awk' programs; it is painful when running them, requiring +multiple `-f' options. If `gawk' is unavailable, then so too is the +`AWKPATH' environment variable and the ability to put `awk' functions +into a library directory (*note Options::). It would be nice to be +able to write programs in the following manner: + + # library functions + @include getopt.awk + @include join.awk + ... + + # main program + BEGIN { + while ((c = getopt(ARGC, ARGV, "a:b:cde")) != -1) + ... + ... + } + + The following program, `igawk.sh', provides this service. It +simulates `gawk''s searching of the `AWKPATH' variable and also allows +"nested" includes; i.e., a file that is included with `@include' can +contain further `@include' statements. `igawk' makes an effort to only +include files once, so that nested includes don't accidentally include +a library function twice. + + `igawk' should behave just like `gawk' externally. This means it +should accept all of `gawk''s command-line arguments, including the +ability to have multiple source files specified via `-f', and the +ability to mix command-line and library source files. + + The program is written using the POSIX Shell (`sh') command +language.(1) It works as follows: + + 1. Loop through the arguments, saving anything that doesn't represent + `awk' source code for later, when the expanded program is run. + + 2. For any arguments that do represent `awk' text, put the arguments + into a shell variable that will be expanded. There are two cases: + + a. Literal text, provided with `--source' or `--source='. This + text is just appended directly. + + b. Source file names, provided with `-f'. We use a neat trick + and append `@include FILENAME' to the shell variable's + contents. Since the file-inclusion program works the way + `gawk' does, this gets the text of the file included into the + program at the correct point. + + 3. Run an `awk' program (naturally) over the shell variable's + contents to expand `@include' statements. The expanded program is + placed in a second shell variable. + + 4. Run the expanded program with `gawk' and any other original + command-line arguments that the user supplied (such as the data + file names). + + This program uses shell variables extensively; for storing command +line arguments, the text of the `awk' program that will expand the +user's program, for the user's original program, and for the expanded +program. Doing so removes some potential problems that might arise +were we to use temporary files instead, at the cost of making the +script somewhat more complicated. + + The initial part of the program turns on shell tracing if the first +argument is `debug'. + + The next part loops through all the command-line arguments. There +are several cases of interest: + +`--' + This ends the arguments to `igawk'. Anything else should be + passed on to the user's `awk' program without being evaluated. + +`-W' + This indicates that the next option is specific to `gawk'. To make + argument processing easier, the `-W' is appended to the front of + the remaining arguments and the loop continues. (This is an `sh' + programming trick. Don't worry about it if you are not familiar + with `sh'.) + +`-v, -F' + These are saved and passed on to `gawk'. + +`-f, --file, --file=, -Wfile=' + The file name is appended to the shell variable `program' with an + `@include' statement. The `expr' utility is used to remove the + leading option part of the argument (e.g., `--file='). (Typical + `sh' usage would be to use the `echo' and `sed' utilities to do + this work. Unfortunately, some versions of `echo' evaluate escape + sequences in their arguments, possibly mangling the program text. + Using `expr' avoids this problem.) + +`--source, --source=, -Wsource=' + The source text is appended to `program'. + +`--version, -Wversion' + `igawk' prints its version number, runs `gawk --version' to get + the `gawk' version information, and then exits. + + If none of the `-f', `--file', `-Wfile', `--source', or `-Wsource' +arguments are supplied, then the first nonoption argument should be the +`awk' program. If there are no command-line arguments left, `igawk' +prints an error message and exits. Otherwise, the first argument is +appended to `program'. In any case, after the arguments have been +processed, `program' contains the complete text of the original `awk' +program. + + The program is as follows: + + #! /bin/sh + # igawk --- like gawk but do @include processing + if [ "$1" = debug ] + then + set -x + shift + fi + + # A literal newline, so that program text is formatted correctly + n=' + ' + + # Initialize variables to empty + program= + opts= + + while [ $# -ne 0 ] # loop over arguments + do + case $1 in + --) shift; break;; + + -W) shift + # The ${x?'message here'} construct prints a + # diagnostic if $x is the null string + set -- -W"${@?'missing operand'}" + continue;; + + -[vF]) opts="$opts $1 '${2?'missing operand'}'" + shift;; + + -[vF]*) opts="$opts '$1'" ;; + + -f) program="$program$n@include ${2?'missing operand'}" + shift;; + + -f*) f=`expr "$1" : '-f\(.*\)'` + program="$program$n@include $f";; + + -[W-]file=*) + f=`expr "$1" : '-.file=\(.*\)'` + program="$program$n@include $f";; + + -[W-]file) + program="$program$n@include ${2?'missing operand'}" + shift;; + + -[W-]source=*) + t=`expr "$1" : '-.source=\(.*\)'` + program="$program$n$t";; + + -[W-]source) + program="$program$n${2?'missing operand'}" + shift;; + + -[W-]version) + echo igawk: version 2.0 1>&2 + gawk --version + exit 0 ;; + + -[W-]*) opts="$opts '$1'" ;; + + *) break;; + esac + shift + done + + if [ -z "$program" ] + then + program=${1?'missing program'} + shift + fi + + # At this point, `program' has the program. + + The `awk' program to process `@include' directives is stored in the +shell variable `expand_prog'. Doing this keeps the shell script +readable. The `awk' program reads through the user's program, one line +at a time, using `getline' (*note Getline::). The input file names and +`@include' statements are managed using a stack. As each `@include' is +encountered, the current file name is "pushed" onto the stack and the +file named in the `@include' directive becomes the current file name. +As each file is finished, the stack is "popped," and the previous input +file becomes the current input file again. The process is started by +making the original file the first one on the stack. + + The `pathto' function does the work of finding the full path to a +file. It simulates `gawk''s behavior when searching the `AWKPATH' +environment variable (*note AWKPATH Variable::). If a file name has a +`/' in it, no path search is done. Otherwise, the file name is +concatenated with the name of each directory in the path, and an +attempt is made to open the generated file name. The only way to test +if a file can be read in `awk' is to go ahead and try to read it with +`getline'; this is what `pathto' does.(2) If the file can be read, it +is closed and the file name is returned: + + expand_prog=' + + function pathto(file, i, t, junk) + { + if (index(file, "/") != 0) + return file + + for (i = 1; i <= ndirs; i++) { + t = (pathlist[i] "/" file) + if ((getline junk < t) > 0) { + # found it + close(t) + return t + } + } + return "" + } + + The main program is contained inside one `BEGIN' rule. The first +thing it does is set up the `pathlist' array that `pathto' uses. After +splitting the path on `:', null elements are replaced with `"."', which +represents the current directory: + + BEGIN { + path = ENVIRON["AWKPATH"] + ndirs = split(path, pathlist, ":") + for (i = 1; i <= ndirs; i++) { + if (pathlist[i] == "") + pathlist[i] = "." + } + + The stack is initialized with `ARGV[1]', which will be `/dev/stdin'. +The main loop comes next. Input lines are read in succession. Lines +that do not start with `@include' are printed verbatim. If the line +does start with `@include', the file name is in `$2'. `pathto' is +called to generate the full path. If it cannot, then we print an error +message and continue. + + The next thing to check is if the file is included already. The +`processed' array is indexed by the full file name of each included +file and it tracks this information for us. If the file is seen again, +a warning message is printed. Otherwise, the new file name is pushed +onto the stack and processing continues. + + Finally, when `getline' encounters the end of the input file, the +file is closed and the stack is popped. When `stackptr' is less than +zero, the program is done: + + stackptr = 0 + input[stackptr] = ARGV[1] # ARGV[1] is first file + + for (; stackptr >= 0; stackptr--) { + while ((getline < input[stackptr]) > 0) { + if (tolower($1) != "@include") { + print + continue + } + fpath = pathto($2) + if (fpath == "") { + printf("igawk:%s:%d: cannot find %s\n", + input[stackptr], FNR, $2) > "/dev/stderr" + continue + } + if (! (fpath in processed)) { + processed[fpath] = input[stackptr] + input[++stackptr] = fpath # push onto stack + } else + print $2, "included in", input[stackptr], + "already included in", + processed[fpath] > "/dev/stderr" + } + close(input[stackptr]) + } + }' # close quote ends `expand_prog' variable + + processed_program=`gawk -- "$expand_prog" /dev/stdin <<EOF + $program + EOF + ` + + The shell construct `COMMAND << MARKER' is called a "here document". +Everything in the shell script up to the MARKER is fed to COMMAND as +input. The shell processes the contents of the here document for +variable and command substitution (and possibly other things as well, +depending upon the shell). + + The shell construct ``...`' is called "command substitution". The +output of the command between the two backquotes (grave accents) is +substituted into the command line. It is saved as a single string, +even if the results contain whitespace. + + The expanded program is saved in the variable `processed_program'. +It's done in these steps: + + 1. Run `gawk' with the `@include'-processing program (the value of + the `expand_prog' shell variable) on standard input. + + 2. Standard input is the contents of the user's program, from the + shell variable `program'. Its contents are fed to `gawk' via a + here document. + + 3. The results of this processing are saved in the shell variable + `processed_program' by using command substitution. + + The last step is to call `gawk' with the expanded program, along +with the original options and command-line arguments that the user +supplied. + + eval gawk $opts -- '"$processed_program"' '"$@"' + + The `eval' command is a shell construct that reruns the shell's +parsing process. This keeps things properly quoted. + + This version of `igawk' represents my fourth attempt at this program. +There are four key simplifications that make the program work better: + + * Using `@include' even for the files named with `-f' makes building + the initial collected `awk' program much simpler; all the + `@include' processing can be done once. + + * Not trying to save the line read with `getline' in the `pathto' + function when testing for the file's accessibility for use with + the main program simplifies things considerably. + + * Using a `getline' loop in the `BEGIN' rule does it all in one + place. It is not necessary to call out to a separate loop for + processing nested `@include' statements. + + * Instead of saving the expanded program in a temporary file, + putting it in a shell variable avoids some potential security + problems. This has the disadvantage that the script relies upon + more features of the `sh' language, making it harder to follow for + those who aren't familiar with `sh'. + + Also, this program illustrates that it is often worthwhile to combine +`sh' and `awk' programming together. You can usually accomplish quite +a lot, without having to resort to low-level programming in C or C++, +and it is frequently easier to do certain kinds of string and argument +manipulation using the shell than it is in `awk'. + + Finally, `igawk' shows that it is not always necessary to add new +features to a program; they can often be layered on top. With `igawk', +there is no real reason to build `@include' processing into `gawk' +itself. + + As an additional example of this, consider the idea of having two +files in a directory in the search path: + +`default.awk' + This file contains a set of default library functions, such as + `getopt' and `assert'. + +`site.awk' + This file contains library functions that are specific to a site or + installation; i.e., locally developed functions. Having a + separate file allows `default.awk' to change with new `gawk' + releases, without requiring the system administrator to update it + each time by adding the local functions. + + One user suggested that `gawk' be modified to automatically read +these files upon startup. Instead, it would be very simple to modify +`igawk' to do this. Since `igawk' can process nested `@include' +directives, `default.awk' could simply contain `@include' statements +for the desired library functions. + + ---------- Footnotes ---------- + + (1) Fully explaining the `sh' language is beyond the scope of this +book. We provide some minimal explanations, but see a good shell +programming book if you wish to understand things in more depth. + + (2) On some very old versions of `awk', the test `getline junk < t' +can loop forever if the file exists but is empty. Caveat emptor. + + +File: gawk.info, Node: Language History, Next: Installation, Prev: Sample Programs, Up: Top + +Appendix A The Evolution of the `awk' Language +********************************************** + +This Info file describes the GNU implementation of `awk', which follows +the POSIX specification. Many long-time `awk' users learned `awk' +programming with the original `awk' implementation in Version 7 Unix. +(This implementation was the basis for `awk' in Berkeley Unix, through +4.3-Reno. Subsequent versions of Berkeley Unix, and systems derived +from 4.4BSD-Lite, use various versions of `gawk' for their `awk'.) +This major node briefly describes the evolution of the `awk' language, +with cross-references to other parts of the Info file where you can +find more information. + +* Menu: + +* V7/SVR3.1:: The major changes between V7 and System V + Release 3.1. +* SVR4:: Minor changes between System V Releases 3.1 + and 4. +* POSIX:: New features from the POSIX standard. +* BTL:: New features from the Bell Laboratories + version of `awk'. +* POSIX/GNU:: The extensions in `gawk' not in POSIX + `awk'. +* Contributors:: The major contributors to `gawk'. + + +File: gawk.info, Node: V7/SVR3.1, Next: SVR4, Up: Language History + +A.1 Major Changes Between V7 and SVR3.1 +======================================= + +The `awk' language evolved considerably between the release of Version +7 Unix (1978) and the new version that was first made generally +available in System V Release 3.1 (1987). This minor node summarizes +the changes, with cross-references to further details: + + * The requirement for `;' to separate rules on a line (*note + Statements/Lines::). + + * User-defined functions and the `return' statement (*note + User-defined::). + + * The `delete' statement (*note Delete::). + + * The `do'-`while' statement (*note Do Statement::). + + * The built-in functions `atan2', `cos', `sin', `rand', and `srand' + (*note Numeric Functions::). + + * The built-in functions `gsub', `sub', and `match' (*note String + Functions::). + + * The built-in functions `close' and `system' (*note I/O + Functions::). + + * The `ARGC', `ARGV', `FNR', `RLENGTH', `RSTART', and `SUBSEP' + built-in variables (*note Built-in Variables::). + + * Assignable `$0'. + + * The conditional expression using the ternary operator `?:' (*note + Conditional Exp::). + + * The expression `INDEX in ARRAY' outside of `for' statements (*note + Reference to Elements::). + + * The exponentiation operator `^' (*note Arithmetic Ops::) and its + assignment operator form `^=' (*note Assignment Ops::). + + * C-compatible operator precedence, which breaks some old `awk' + programs (*note Precedence::). + + * Regexps as the value of `FS' (*note Field Separators::) and as the + third argument to the `split' function (*note String Functions::), + rather than using only the first character of `FS'. + + * Dynamic regexps as operands of the `~' and `!~' operators (*note + Regexp Usage::). + + * The escape sequences `\b', `\f', and `\r' (*note Escape + Sequences::). (Some vendors have updated their old versions of + `awk' to recognize `\b', `\f', and `\r', but this is not something + you can rely on.) + + * Redirection of input for the `getline' function (*note Getline::). + + * Multiple `BEGIN' and `END' rules (*note BEGIN/END::). + + * Multidimensional arrays (*note Multi-dimensional::). + + +File: gawk.info, Node: SVR4, Next: POSIX, Prev: V7/SVR3.1, Up: Language History + +A.2 Changes Between SVR3.1 and SVR4 +=================================== + +The System V Release 4 (1989) version of Unix `awk' added these features +(some of which originated in `gawk'): + + * The `ENVIRON' variable (*note Built-in Variables::). + + * Multiple `-f' options on the command line (*note Options::). + + * The `-v' option for assigning variables before program execution + begins (*note Options::). + + * The `--' option for terminating command-line options. + + * The `\a', `\v', and `\x' escape sequences (*note Escape + Sequences::). + + * A defined return value for the `srand' built-in function (*note + Numeric Functions::). + + * The `toupper' and `tolower' built-in string functions for case + translation (*note String Functions::). + + * A cleaner specification for the `%c' format-control letter in the + `printf' function (*note Control Letters::). + + * The ability to dynamically pass the field width and precision + (`"%*.*d"') in the argument list of the `printf' function (*note + Control Letters::). + + * The use of regexp constants, such as `/foo/', as expressions, where + they are equivalent to using the matching operator, as in `$0 ~ + /foo/' (*note Using Constant Regexps::). + + * Processing of escape sequences inside command-line variable + assignments (*note Assignment Options::). + + +File: gawk.info, Node: POSIX, Next: BTL, Prev: SVR4, Up: Language History + +A.3 Changes Between SVR4 and POSIX `awk' +======================================== + +The POSIX Command Language and Utilities standard for `awk' (1992) +introduced the following changes into the language: + + * The use of `-W' for implementation-specific options (*note + Options::). + + * The use of `CONVFMT' for controlling the conversion of numbers to + strings (*note Conversion::). + + * The concept of a numeric string and tighter comparison rules to go + with it (*note Typing and Comparison::). + + * More complete documentation of many of the previously undocumented + features of the language. + + The following common extensions are not permitted by the POSIX +standard: + + * `\x' escape sequences are not recognized (*note Escape + Sequences::). + + * Newlines do not act as whitespace to separate fields when `FS' is + equal to a single space (*note Fields::). + + * Newlines are not allowed after `?' or `:' (*note Conditional + Exp::). + + * The synonym `func' for the keyword `function' is not recognized + (*note Definition Syntax::). + + * The operators `**' and `**=' cannot be used in place of `^' and + `^=' (*note Arithmetic Ops::, and *note Assignment Ops::). + + * Specifying `-Ft' on the command line does not set the value of + `FS' to be a single TAB character (*note Field Separators::). + + * The locale's decimal point character is used for parsing input + data (*note Locales::). + + * The `fflush' built-in function is not supported (*note I/O + Functions::). + + +File: gawk.info, Node: BTL, Next: POSIX/GNU, Prev: POSIX, Up: Language History + +A.4 Extensions in the Bell Laboratories `awk' +============================================= + +Brian Kernighan, one of the original designers of Unix `awk', has made +his version available via his home page (*note Other Versions::). This +minor node describes extensions in his version of `awk' that are not in +POSIX `awk': + + * The `-mf N' and `-mr N' command-line options to set the maximum + number of fields and the maximum record size, respectively (*note + Options::). As a side note, his `awk' no longer needs these + options; it continues to accept them to avoid breaking old + programs. + + * The `fflush' built-in function for flushing buffered output (*note + I/O Functions::). + + * The `**' and `**=' operators (*note Arithmetic Ops:: and *note + Assignment Ops::). + + * The use of `func' as an abbreviation for `function' (*note + Definition Syntax::). + + + The Bell Laboratories `awk' also incorporates the following +extensions, originally developed for `gawk': + + * The `\x' escape sequence (*note Escape Sequences::). + + * The `/dev/stdin', `/dev/stdout', and `/dev/stderr' special files + (*note Special Files::). + + * The ability for `FS' and for the third argument to `split' to be + null strings (*note Single Character Fields::). + + * The `nextfile' statement (*note Nextfile Statement::). + + * The ability to delete all of an array at once with `delete ARRAY' + (*note Delete::). + + +File: gawk.info, Node: POSIX/GNU, Next: Contributors, Prev: BTL, Up: Language History + +A.5 Extensions in `gawk' Not in POSIX `awk' +=========================================== + +The GNU implementation, `gawk', adds a large number of features. This +minor node lists them in the order they were added to `gawk'. They can +all be disabled with either the `--traditional' or `--posix' options +(*note Options::). + + Version 2.10 of `gawk' introduced the following features: + + * The `AWKPATH' environment variable for specifying a path search for + the `-f' command-line option (*note Options::). + + * The `IGNORECASE' variable and its effects (*note + Case-sensitivity::). + + * The `/dev/stdin', `/dev/stdout', `/dev/stderr' and `/dev/fd/N' + special file names (*note Special Files::). + + Version 2.13 of `gawk' introduced the following features: + + * The `FIELDWIDTHS' variable and its effects (*note Constant Size::). + + * The `systime' and `strftime' built-in functions for obtaining and + printing timestamps (*note Time Functions::). + + * The `-W lint' option to provide error and portability checking for + both the source code and at runtime (*note Options::). + + * The `-W compat' option to turn off the GNU extensions (*note + Options::). + + * The `-W posix' option for full POSIX compliance (*note Options::). + + Version 2.14 of `gawk' introduced the following feature: + + * The `next file' statement for skipping to the next data file + (*note Nextfile Statement::). + + Version 2.15 of `gawk' introduced the following features: + + * The `ARGIND' variable, which tracks the movement of `FILENAME' + through `ARGV' (*note Built-in Variables::). + + * The `ERRNO' variable, which contains the system error message when + `getline' returns -1 or `close' fails (*note Built-in Variables::). + + * The `/dev/pid', `/dev/ppid', `/dev/pgrpid', and `/dev/user' file + name interpretation (*note Special Files::). + + * The ability to delete all of an array at once with `delete ARRAY' + (*note Delete::). + + * The ability to use GNU-style long-named options that start with + `--' (*note Options::). + + * The `--source' option for mixing command-line and library-file + source code (*note Options::). + + Version 3.0 of `gawk' introduced the following features: + + * `IGNORECASE' changed, now applying to string comparison as well as + regexp operations (*note Case-sensitivity::). + + * The `RT' variable that contains the input text that matched `RS' + (*note Records::). + + * Full support for both POSIX and GNU regexps (*note Regexp::). + + * The `gensub' function for more powerful text manipulation (*note + String Functions::). + + * The `strftime' function acquired a default time format, allowing + it to be called with no arguments (*note Time Functions::). + + * The ability for `FS' and for the third argument to `split' to be + null strings (*note Single Character Fields::). + + * The ability for `RS' to be a regexp (*note Records::). + + * The `next file' statement became `nextfile' (*note Nextfile + Statement::). + + * The `--lint-old' option to warn about constructs that are not + available in the original Version 7 Unix version of `awk' (*note + V7/SVR3.1::). + + * The `-m' option and the `fflush' function from the Bell + Laboratories research version of `awk' (*note Options::; also + *note I/O Functions::). + + * The `--re-interval' option to provide interval expressions in + regexps (*note Regexp Operators::). + + * The `--traditional' option was added as a better name for + `--compat' (*note Options::). + + * The use of GNU Autoconf to control the configuration process + (*note Quick Installation::). + + * Amiga support (*note Amiga Installation::). + + + Version 3.1 of `gawk' introduced the following features: + + * The `BINMODE' special variable for non-POSIX systems, which allows + binary I/O for input and/or output files (*note PC Using::). + + * The `LINT' special variable, which dynamically controls lint + warnings (*note Built-in Variables::). + + * The `PROCINFO' array for providing process-related information + (*note Built-in Variables::). + + * The `TEXTDOMAIN' special variable for setting an application's + internationalization text domain (*note Built-in Variables::, and + *note Internationalization::). + + * The ability to use octal and hexadecimal constants in `awk' + program source code (*note Nondecimal-numbers::). + + * The `|&' operator for two-way I/O to a coprocess (*note Two-way + I/O::). + + * The `/inet' special files for TCP/IP networking using `|&' (*note + TCP/IP Networking::). + + * The optional second argument to `close' that allows closing one end + of a two-way pipe to a coprocess (*note Two-way I/O::). + + * The optional third argument to the `match' function for capturing + text-matching subexpressions within a regexp (*note String + Functions::). + + * Positional specifiers in `printf' formats for making translations + easier (*note Printf Ordering::). + + * The `asort' and `asorti' functions for sorting arrays (*note Array + Sorting::). + + * The `bindtextdomain', `dcgettext' and `dcngettext' functions for + internationalization (*note Programmer i18n::). + + * The `extension' built-in function and the ability to add new + built-in functions dynamically (*note Dynamic Extensions::). + + * The `mktime' built-in function for creating timestamps (*note Time + Functions::). + + * The `and', `or', `xor', `compl', `lshift', `rshift', and + `strtonum' built-in functions (*note Bitwise Functions::). + + * The support for `next file' as two words was removed completely + (*note Nextfile Statement::). + + * The `--dump-variables' option to print a list of all global + variables (*note Options::). + + * The `--gen-po' command-line option and the use of a leading + underscore to mark strings that should be translated (*note String + Extraction::). + + * The `--non-decimal-data' option to allow non-decimal input data + (*note Nondecimal Data::). + + * The `--profile' option and `pgawk', the profiling version of + `gawk', for producing execution profiles of `awk' programs (*note + Profiling::). + + * The `--use-lc-numeric' option to force `gawk' to use the locale's + decimal point for parsing input data (*note Conversion::). + + * The `--enable-portals' configuration option to enable special + treatment of pathnames that begin with `/p' as BSD portals (*note + Portal Files::). + + * The `--disable-directories-fatal' configuration option which + causes `gawk' to silently skip directories named on the command + line (*note Additional Configuration Options::). + + * The use of GNU Automake to help in standardizing the configuration + process (*note Quick Installation::). + + * The use of GNU `gettext' for `gawk''s own message output (*note + Gawk I18N::). + + * BeOS support (*note BeOS Installation::). + + * Tandem support (*note Tandem Installation::). + + * The Atari port became officially unsupported (*note Atari + Installation::). + + * The source code now uses new-style function definitions, with + `ansi2knr' to convert the code on systems with old compilers. + + * The `--disable-lint' configuration option to disable lint checking + at compile time (*note Additional Configuration Options::). + + * POSIX compliance for `sub' and `gsub' (*note Gory Details::). + + * The `--exec' option, for use in CGI scripts (*note Options::). + + * The `length' function was extended to accept an array argument and + return the number of elements in the array (*note String + Functions::). + + * The `strftime' function acquired a third argument to enable + printing times as UTC (*note Time Functions::). + + + +File: gawk.info, Node: Contributors, Prev: POSIX/GNU, Up: Language History + +A.6 Major Contributors to `gawk' +================================ + + Always give credit where credit is due. + Anonymous + + This minor node names the major contributors to `gawk' and/or this +Info file, in approximate chronological order: + + * Dr. Alfred V. Aho, Dr. Peter J. Weinberger, and Dr. Brian W. + Kernighan, all of Bell Laboratories, designed and implemented Unix + `awk', from which `gawk' gets the majority of its feature set. + + * Paul Rubin did the initial design and implementation in 1986, and + wrote the first draft (around 40 pages) of this Info file. + + * Jay Fenlason finished the initial implementation. + + * Diane Close revised the first draft of this Info file, bringing it + to around 90 pages. + + * Richard Stallman helped finish the implementation and the initial + draft of this Info file. He is also the founder of the FSF and + the GNU project. + + * John Woods contributed parts of the code (mostly fixes) in the + initial version of `gawk'. + + * In 1988, David Trueman took over primary maintenance of `gawk', + making it compatible with "new" `awk', and greatly improving its + performance. + + * Pat Rankin provided the VMS port and its documentation. + + * Conrad Kwok, Scott Garfinkle, and Kent Williams did the initial + ports to MS-DOS with various versions of MSC. + + * Hal Peterson provided help in porting `gawk' to Cray systems. + + * Kai Uwe Rommel provided the initial port to OS/2 and its + documentation. + + * Michal Jaegermann provided the port to Atari systems and its + documentation. He continues to provide portability checking with + DEC Alpha systems, and has done a lot of work to make sure `gawk' + works on non-32-bit systems. + + * Fred Fish provided the port to Amiga systems and its documentation. + + * Scott Deifik currently maintains the MS-DOS port. + + * Juan Grigera maintains the port to Windows32 systems. + + * Dr. Darrel Hankerson acts as coordinator for the various ports to + different PC platforms and creates binary distributions for + various PC operating systems. He is also instrumental in keeping + the documentation up to date for the various PC platforms. + + * Christos Zoulas provided the `extension' built-in function for + dynamically adding new modules. + + * Ju"rgen Kahrs contributed the initial version of the TCP/IP + networking code and documentation, and motivated the inclusion of + the `|&' operator. + + * Stephen Davies provided the initial port to Tandem systems and its + documentation. Matthew Woehlke provided improvements for Tandem's + POSIX-compliant systems. + + * Martin Brown provided the port to BeOS and its documentation. + + * Arno Peters did the initial work to convert `gawk' to use GNU + Automake and `gettext'. + + * Alan J. Broder provided the initial version of the `asort' function + as well as the code for the new optional third argument to the + `match' function. + + * Andreas Buening updated the `gawk' port for OS/2. + + Isamu Hasegawa, of IBM in Japan, contributed support for multibyte + characters. + + Michael Benzinger contributed the initial code for `switch' + statements. + + Patrick T.J. McPhee contributed the code for dynamic loading in + Windows32 environments. + + * Arnold Robbins has been working on `gawk' since 1988, at first + helping David Trueman, and as the primary maintainer since around + 1994. + + +File: gawk.info, Node: Installation, Next: Notes, Prev: Language History, Up: Top + +Appendix B Installing `gawk' +**************************** + +This appendix provides instructions for installing `gawk' on the +various platforms that are supported by the developers. The primary +developer supports GNU/Linux (and Unix), whereas the other ports are +contributed. *Note Bugs::, for the electronic mail addresses of the +people who did the respective ports. + +* Menu: + +* Gawk Distribution:: What is in the `gawk' distribution. +* Unix Installation:: Installing `gawk' under various + versions of Unix. +* Non-Unix Installation:: Installation on Other Operating Systems. +* Unsupported:: Systems whose ports are no longer supported. +* Bugs:: Reporting Problems and Bugs. +* Other Versions:: Other freely available `awk' + implementations. + + +File: gawk.info, Node: Gawk Distribution, Next: Unix Installation, Up: Installation + +B.1 The `gawk' Distribution +=========================== + +This minor node describes how to get the `gawk' distribution, how to +extract it, and then what is in the various files and subdirectories. + +* Menu: + +* Getting:: How to get the distribution. +* Extracting:: How to extract the distribution. +* Distribution contents:: What is in the distribution. + + +File: gawk.info, Node: Getting, Next: Extracting, Up: Gawk Distribution + +B.1.1 Getting the `gawk' Distribution +------------------------------------- + +There are three ways to get GNU software: + + * Copy it from someone else who already has it. + + * Order `gawk' directly from the Free Software Foundation. Software + distributions are available for Gnu/Linux, Unix, and MS-Windows, + in several CD packages. Their address is: + + Free Software Foundation + 51 Franklin Street, Fifth Floor + Boston, MA 02110-1301 USA + Phone: +1-617-542-5942 + Fax (including Japan): +1-617-542-2652 + Email: <gnu@gnu.org> + URL: `http://www.gnu.org' + + Ordering from the FSF directly contributes to the support of the + foundation and to the production of more free software. + + * Retrieve `gawk' by using anonymous `ftp' to the Internet host + `ftp.gnu.org', in the directory `/gnu/gawk'. + + The GNU software archive is mirrored around the world. The +up-to-date list of mirror sites is available from the main FSF web site +(http://www.gnu.org/order/ftp.html). Try to use one of the mirrors; +they will be less busy, and you can usually find one closer to your +site. + + +File: gawk.info, Node: Extracting, Next: Distribution contents, Prev: Getting, Up: Gawk Distribution + +B.1.2 Extracting the Distribution +--------------------------------- + +`gawk' is distributed as a `tar' file compressed with the GNU Zip +program, `gzip'. + + Once you have the distribution (for example, `gawk-3.1.6.tar.gz'), +use `gzip' to expand the file and then use `tar' to extract it. You +can use the following pipeline to produce the `gawk' distribution: + + # Under System V, add 'o' to the tar options + gzip -d -c gawk-3.1.6.tar.gz | tar -xvpf - + +This creates a directory named `gawk-3.1.6' in the current directory. + + The distribution file name is of the form `gawk-V.R.P.tar.gz'. The +V represents the major version of `gawk', the R represents the current +release of version V, and the P represents a "patch level", meaning +that minor bugs have been fixed in the release. The current patch +level is 6, but when retrieving distributions, you should get the +version with the highest version, release, and patch level. (Note, +however, that patch levels greater than or equal to 80 denote "beta" or +nonproduction software; you might not want to retrieve such a version +unless you don't mind experimenting.) If you are not on a Unix system, +you need to make other arrangements for getting and extracting the +`gawk' distribution. You should consult a local expert. + + +File: gawk.info, Node: Distribution contents, Prev: Extracting, Up: Gawk Distribution + +B.1.3 Contents of the `gawk' Distribution +----------------------------------------- + +The `gawk' distribution has a number of C source files, documentation +files, subdirectories, and files related to the configuration process +(*note Unix Installation::), as well as several subdirectories related +to different non-Unix operating systems: + +Various `.c', `.y', and `.h' files + The actual `gawk' source code. + +`README' +`README_d/README.*' + Descriptive files: `README' for `gawk' under Unix and the rest for + the various hardware and software combinations. + +`INSTALL' + A file providing an overview of the configuration and installation + process. + +`ChangeLog' + A detailed list of source code changes as bugs are fixed or + improvements made. + +`NEWS' + A list of changes to `gawk' since the last release or patch. + +`COPYING' + The GNU General Public License. + +`FUTURES' + A brief list of features and changes being contemplated for future + releases, with some indication of the time frame for the feature, + based on its difficulty. + +`LIMITATIONS' + A list of those factors that limit `gawk''s performance. Most of + these depend on the hardware or operating system software and are + not limits in `gawk' itself. + +`POSIX.STD' + A description of one area in which the POSIX standard for `awk' is + incorrect as well as how `gawk' handles the problem. + +`doc/awkforai.txt' + A short article describing why `gawk' is a good language for AI + (Artificial Intelligence) programming. + +`doc/README.card' +`doc/ad.block' +`doc/awkcard.in' +`doc/cardfonts' +`doc/colors' +`doc/macros' +`doc/no.colors' +`doc/setter.outline' + The `troff' source for a five-color `awk' reference card. A + modern version of `troff' such as GNU `troff' (`groff') is needed + to produce the color version. See the file `README.card' for + instructions if you have an older `troff'. + +`doc/gawk.1' + The `troff' source for a manual page describing `gawk'. This is + distributed for the convenience of Unix users. + +`doc/gawk.texi' + The Texinfo source file for this Info file. It should be + processed with TeX to produce a printed document, and with + `makeinfo' to produce an Info or HTML file. + +`doc/gawk.info' + The generated Info file for this Info file. + +`doc/gawkinet.texi' + The Texinfo source file for *Note Top::. It should be processed + with TeX to produce a printed document and with `makeinfo' to + produce an Info or HTML file. + +`doc/gawkinet.info' + The generated Info file for `TCP/IP Internetworking with `gawk''. + +`doc/igawk.1' + The `troff' source for a manual page describing the `igawk' + program presented in *note Igawk Program::. + +`doc/Makefile.in' + The input file used during the configuration process to generate + the actual `Makefile' for creating the documentation. + +`Makefile.am' +`*/Makefile.am' + Files used by the GNU `automake' software for generating the + `Makefile.in' files used by `autoconf' and `configure'. + +`Makefile.in' +`acconfig.h' +`acinclude.m4' +`aclocal.m4' +`configh.in' +`configure.in' +`configure' +`custom.h' +`missing_d/*' +`m4/*' + These files and subdirectories are used when configuring `gawk' + for various Unix systems. They are explained in *note Unix + Installation::. + +`po/*' + The `po' library contains message translations. + +`awklib/extract.awk' +`awklib/Makefile.am' +`awklib/Makefile.in' +`awklib/eg/*' + The `awklib' directory contains a copy of `extract.awk' (*note + Extract Program::), which can be used to extract the sample + programs from the Texinfo source file for this Info file. It also + contains a `Makefile.in' file, which `configure' uses to generate + a `Makefile'. `Makefile.am' is used by GNU Automake to create + `Makefile.in'. The library functions from *note Library + Functions::, and the `igawk' program from *note Igawk Program::, + are included as ready-to-use files in the `gawk' distribution. + They are installed as part of the installation process. The rest + of the programs in this Info file are available in appropriate + subdirectories of `awklib/eg'. + +`unsupported/atari/*' + Files needed for building `gawk' on an Atari ST (*note Atari + Installation::, for details). + +`unsupported/tandem/*' + Files needed for building `gawk' on a Tandem (*note Tandem + Installation::, for details). + +`posix/*' + Files needed for building `gawk' on POSIX-compliant systems. + +`pc/*' + Files needed for building `gawk' under MS-DOS, MS Windows and OS/2 + (*note PC Installation::, for details). + +`vms/*' + Files needed for building `gawk' under VMS (*note VMS + Installation::, for details). + +`test/*' + A test suite for `gawk'. You can use `make check' from the + top-level `gawk' directory to run your version of `gawk' against + the test suite. If `gawk' successfully passes `make check', then + you can be confident of a successful port. + + +File: gawk.info, Node: Unix Installation, Next: Non-Unix Installation, Prev: Gawk Distribution, Up: Installation + +B.2 Compiling and Installing `gawk' on Unix +=========================================== + +Usually, you can compile and install `gawk' by typing only two +commands. However, if you use an unusual system, you may need to +configure `gawk' for your system yourself. + +* Menu: + +* Quick Installation:: Compiling `gawk' under Unix. +* Additional Configuration Options:: Other compile-time options. +* Configuration Philosophy:: How it's all supposed to work. + + +File: gawk.info, Node: Quick Installation, Next: Additional Configuration Options, Up: Unix Installation + +B.2.1 Compiling `gawk' for Unix +------------------------------- + +After you have extracted the `gawk' distribution, `cd' to +`gawk-3.1.6'. Like most GNU software, `gawk' is configured +automatically for your Unix system by running the `configure' program. +This program is a Bourne shell script that is generated automatically +using GNU `autoconf'. (The `autoconf' software is described fully +starting with *note Top::.) + + To configure `gawk', simply run `configure': + + sh ./configure + + This produces a `Makefile' and `config.h' tailored to your system. +The `config.h' file describes various facts about your system. You +might want to edit the `Makefile' to change the `CFLAGS' variable, +which controls the command-line options that are passed to the C +compiler (such as optimization levels or compiling for debugging). + + Alternatively, you can add your own values for most `make' variables +on the command line, such as `CC' and `CFLAGS', when running +`configure': + + CC=cc CFLAGS=-g sh ./configure + +See the file `INSTALL' in the `gawk' distribution for all the details. + + After you have run `configure' and possibly edited the `Makefile', +type: + + make + +Shortly thereafter, you should have an executable version of `gawk'. +That's all there is to it! To verify that `gawk' is working properly, +run `make check'. All of the tests should succeed. If these steps do +not work, or if any of the tests fail, check the files in the +`README_d' directory to see if you've found a known problem. If the +failure is not described there, please send in a bug report (*note +Bugs::.) + + +File: gawk.info, Node: Additional Configuration Options, Next: Configuration Philosophy, Prev: Quick Installation, Up: Unix Installation + +B.2.2 Additional Configuration Options +-------------------------------------- + +There are several additional options you may use on the `configure' +command line when compiling `gawk' from scratch, including: + +`--enable-portals' + Treat pathnames that begin with `/p' as BSD portal files when + doing two-way I/O with the `|&' operator (*note Portal Files::). + +`--enable-switch' + Enable the recognition and execution of C-style `switch' statements + in `awk' programs (*note Switch Statement::.) + +`--disable-lint' + This option disables all lint checking within `gawk'. The + `--lint' and `--lint-old' options (*note Options::) are accepted, + but silently do nothing. Similarly, setting the `LINT' variable + (*note User-modified::) has no effect on the running `awk' program. + + When used with GCC's automatic dead-code-elimination, this option + cuts almost 200K bytes off the size of the `gawk' executable on + GNU/Linux x86 systems. Results on other systems and with other + compilers are likely to vary. Using this option may bring you + some slight performance improvement. + + Using this option will cause some of the tests in the test suite + to fail. This option may be removed at a later date. + +`--disable-nls' + Disable all message-translation facilities. This is usually not + desirable, but it may bring you some slight performance + improvement. + +`--disable-directories-fatal' + Causes `gawk' to silently skip directories named on the command + line. + + As of version 3.1.5, the `--with-included-gettext' configuration +option is no longer available, since `gawk' expects the GNU `gettext' +library to be installed as an external library. + + +File: gawk.info, Node: Configuration Philosophy, Prev: Additional Configuration Options, Up: Unix Installation + +B.2.3 The Configuration Process +------------------------------- + +This minor node is of interest only if you know something about using +the C language and the Unix operating system. + + The source code for `gawk' generally attempts to adhere to formal +standards wherever possible. This means that `gawk' uses library +routines that are specified by the ISO C standard and by the POSIX +operating system interface standard. When using an ISO C compiler, +function prototypes are used to help improve the compile-time checking. + + Many Unix systems do not support all of either the ISO or the POSIX +standards. The `missing_d' subdirectory in the `gawk' distribution +contains replacement versions of those functions that are most likely +to be missing. + + The `config.h' file that `configure' creates contains definitions +that describe features of the particular operating system where you are +attempting to compile `gawk'. The three things described by this file +are: what header files are available, so that they can be correctly +included, what (supposedly) standard functions are actually available +in your C libraries, and various miscellaneous facts about your variant +of Unix. For example, there may not be an `st_blksize' element in the +`stat' structure. In this case, `HAVE_ST_BLKSIZE' is undefined. + + It is possible for your C compiler to lie to `configure'. It may do +so by not exiting with an error when a library function is not +available. To get around this, edit the file `custom.h'. Use an +`#ifdef' that is appropriate for your system, and either `#define' any +constants that `configure' should have defined but didn't, or `#undef' +any constants that `configure' defined and should not have. `custom.h' +is automatically included by `config.h'. + + It is also possible that the `configure' program generated by +`autoconf' will not work on your system in some other fashion. If you +do have a problem, the file `configure.in' is the input for `autoconf'. +You may be able to change this file and generate a new version of +`configure' that works on your system (*note Bugs::, for information on +how to report problems in configuring `gawk'). The same mechanism may +be used to send in updates to `configure.in' and/or `custom.h'. + + +File: gawk.info, Node: Non-Unix Installation, Next: Unsupported, Prev: Unix Installation, Up: Installation + +B.3 Installation on Other Operating Systems +=========================================== + +This minor node describes how to install `gawk' on various non-Unix +systems. + +* Menu: + +* Amiga Installation:: Installing `gawk' on an Amiga. +* BeOS Installation:: Installing `gawk' on BeOS. +* PC Installation:: Installing and Compiling `gawk' on + MS-DOS and OS/2. +* VMS Installation:: Installing `gawk' on VMS. + + +File: gawk.info, Node: Amiga Installation, Next: BeOS Installation, Up: Non-Unix Installation + +B.3.1 Installing `gawk' on an Amiga +----------------------------------- + +You can install `gawk' on an Amiga system using a Unix emulation +environment, available via anonymous `ftp' from `ftp.ninemoons.com' in +the directory `pub/ade/current'. This includes a shell based on +`pdksh'. The primary component of this environment is a Unix emulation +library, `ixemul.lib'. + + A more complete distribution for the Amiga is available on the Geek +Gadgets CD-ROM, available from: + + CRONUS + 1840 E. Warner Road #105-265 + Tempe, AZ 85284 USA + US Toll Free: (800) 804-0833 + Phone: +1-602-491-0442 + FAX: +1-602-491-0048 + Email: <info@ninemoons.com> + WWW: `http://www.ninemoons.com' + Anonymous `ftp' site: `ftp.ninemoons.com' + + Once you have the distribution, you can configure `gawk' simply by +running `configure': + + configure -v m68k-amigaos + + Then run `make' and you should be all set! If these steps do not +work, please send in a bug report (*note Bugs::). + + +File: gawk.info, Node: BeOS Installation, Next: PC Installation, Prev: Amiga Installation, Up: Non-Unix Installation + +B.3.2 Installing `gawk' on BeOS +------------------------------- + +Since BeOS DR9, all the tools that you should need to build `gawk' are +included with BeOS. The process is basically identical to the Unix +process of running `configure' and then `make'. Full instructions are +given below. + + You can compile `gawk' under BeOS by extracting the standard sources +and running `configure'. You _must_ specify the location prefix for the +installation directory. For BeOS DR9 and beyond, the best directory to +use is `/boot/home/config', so the `configure' command is: + + configure --prefix=/boot/home/config + + This installs the compiled application into `/boot/home/config/bin', +which is already specified in the standard `PATH'. + + Once the configuration process is completed, you can run `make', and +then `make install': + + $ make + ... + $ make install + + BeOS uses `bash' as its shell; thus, you use `gawk' the same way you +would under Unix. If these steps do not work, please send in a bug +report (*note Bugs::). + + +File: gawk.info, Node: PC Installation, Next: VMS Installation, Prev: BeOS Installation, Up: Non-Unix Installation + +B.3.3 Installation on PC Operating Systems +------------------------------------------ + +This minor node covers installation and usage of `gawk' on x86 machines +running DOS, any version of Windows, or OS/2. In this minor node, the +term "Windows32" refers to any of Windows-95/98/ME/NT/2000. + + The limitations of DOS (and DOS shells under Windows or OS/2) has +meant that various "DOS extenders" are often used with programs such as +`gawk'. The varying capabilities of Microsoft Windows 3.1 and +Windows32 can add to the confusion. For an overview of the +considerations, please refer to `README_d/README.pc' in the +distribution. + +* Menu: + +* PC Binary Installation:: Installing a prepared distribution. +* PC Compiling:: Compiling `gawk' for MS-DOS, Windows32, + and OS/2. +* PC Dynamic:: Compiling `gawk' for dynamic libraries. +* PC Using:: Running `gawk' on MS-DOS, Windows32 and + OS/2. +* Cygwin:: Building and running `gawk' for + Cygwin. + + +File: gawk.info, Node: PC Binary Installation, Next: PC Compiling, Up: PC Installation + +B.3.3.1 Installing a Prepared Distribution for PC Systems +......................................................... + +If you have received a binary distribution prepared by the DOS +maintainers, then `gawk' and the necessary support files appear under +the `gnu' directory, with executables in `gnu/bin', libraries in +`gnu/lib/awk', and manual pages under `gnu/man'. This is designed for +easy installation to a `/gnu' directory on your drive--however, the +files can be installed anywhere provided `AWKPATH' is set properly. +Regardless of the installation directory, the first line of `igawk.cmd' +and `igawk.bat' (in `gnu/bin') may need to be edited. + + The binary distribution contains a separate file describing the +contents. In particular, it may include more than one version of the +`gawk' executable. + + OS/2 (32 bit, EMX) binary distributions are prepared for the `/usr' +directory of your preferred drive. Set `UNIXROOT' to your installation +drive (e.g., `e:') if you want to install `gawk' onto another drive +than the hardcoded default `c:'. Executables appear in `/usr/bin', +libraries under `/usr/share/awk', manual pages under `/usr/man', +Texinfo documentation under `/usr/info' and NLS files under +`/usr/share/locale'. If you already have a file `/usr/info/dir' from +another package _do not overwrite it!_ Instead enter the following +commands at your prompt (replace `x:' by your installation drive): + + install-info --info-dir=x:/usr/info x:/usr/info/gawk.info + install-info --info-dir=x:/usr/info x:/usr/info/gawkinet.info + + However, the files can be installed anywhere provided `AWKPATH' is +set properly. + + The binary distribution may contain a separate file containing +additional or more detailed installation instructions. + + +File: gawk.info, Node: PC Compiling, Next: PC Dynamic, Prev: PC Binary Installation, Up: PC Installation + +B.3.3.2 Compiling `gawk' for PC Operating Systems +................................................. + +`gawk' can be compiled for MS-DOS, Windows32, and OS/2 using the GNU +development tools from DJ Delorie (DJGPP; MS-DOS only) or Eberhard +Mattes (EMX; MS-DOS, Windows32 and OS/2). Microsoft Visual C/C++ can +be used to build a Windows32 version, and Microsoft C/C++ can be used +to build 16-bit versions for MS-DOS and OS/2. (As of `gawk' 3.1.2, the +MSC version doesn't work. However, the maintainer is working on fixing +it.) The file `README_d/README.pc' in the `gawk' distribution contains +additional notes, and `pc/Makefile' contains important information on +compilation options. + + To build `gawk' for MS-DOS, Windows32, and OS/2 (16 bit only; for 32 +bit (EMX) you can use the `configure' script and skip the following +paragraphs; for details see below), copy the files in the `pc' +directory (_except_ for `ChangeLog') to the directory with the rest of +the `gawk' sources. The `Makefile' contains a configuration section +with comments and may need to be edited in order to work with your +`make' utility. + + The `Makefile' contains a number of targets for building various +MS-DOS, Windows32, and OS/2 versions. A list of targets is printed if +the `make' command is given without a target. As an example, to build +`gawk' using the DJGPP tools, enter `make djgpp'. (The DJGPP tools may +be found at `ftp://ftp.delorie.com/pub/djgpp/current/v2gnu/'.) + + Using `make' to run the standard tests and to install `gawk' +requires additional Unix-like tools, including `sh', `sed', and `cp'. +In order to run the tests, the `test/*.ok' files may need to be +converted so that they have the usual DOS-style end-of-line markers. +Most of the tests work properly with Stewartson's shell along with the +companion utilities or appropriate GNU utilities. However, some +editing of `test/Makefile' is required. It is recommended that you copy +the file `pc/Makefile.tst' over the file `test/Makefile' as a +replacement. Details can be found in `README_d/README.pc' and in the +file `pc/Makefile.tst'. + + The 32 bit EMX version of `gawk' works "out of the box" under OS/2. +In principle, it is possible to compile `gawk' the following way: + + $ ./configure + $ make + + This is not recommended, though. To get an OMF executable you should +use the following commands at your `sh' prompt: + + $ CPPFLAGS="-D__ST_MT_ERRNO__" + $ export CPPFLAGS + $ CFLAGS="-O2 -Zomf -Zmt" + $ export CFLAGS + $ LDFLAGS="-s -Zcrtdll -Zlinker /exepack:2 -Zlinker /pm:vio -Zstack 0x6000" + $ export LDFLAGS + $ RANLIB="echo" + $ export RANLIB + $ ./configure --prefix=c:/usr --without-included-gettext + $ make AR=emxomfar + + These are just suggestions. You may use any other set of +(self-consistent) environment variables and compiler flags. + + To get an FHS-compliant file hierarchy it is recommended to use the +additional `configure' options `--infodir=c:/usr/share/info', +`--mandir=c:/usr/share/man' and `--libexecdir=c:/usr/lib'. + + If you use GCC 2.95 it is recommended to use also: + + $ LIBS="-lgcc" + $ export LIBS + + You can also get an `a.out' executable if you prefer: + + $ CPPFLAGS="-D__ST_MT_ERRNO__" + $ export CPPFLAGS + $ CFLAGS="-O2 -Zmt" + $ export CFLAGS + $ LDFLAGS="-s -Zstack 0x6000" + $ LIBS="-lgcc" + $ unset RANLIB + $ ./configure --prefix=c:/usr + $ make + + NOTE: Versions later than GCC 2.95, i.e., GCC 3.x using the + Innotek libc were not tested. + + NOTE: Even if the compiled `gawk.exe' (`a.out') executable + contains a DOS header, it does _not_ work under DOS. To compile an + executable that runs under DOS, `"-DPIPES_SIMULATED"' must be + added to `CPPFLAGS'. But then some nonstandard extensions of + `gawk' (e.g., `|&') do not work! + + After compilation the internal tests can be performed. Enter `make +check CMP="diff -a"' at your command prompt. All tests except for the +`pid' test are expected to work properly. The `pid' test fails because +child processes are not started by `fork()'. + + `make install' works as expected. + + NOTE: Most OS/2 ports of GNU `make' are not able to handle the + Makefiles of this package. If you encounter any problems with + `make' try GNU Make 3.79.1 or later versions. You should find the + latest version on `http://www.unixos2.org/sw/pub/binary/make/' or + on `ftp://hobbes.nmsu.edu/pub/os2/'. + + +File: gawk.info, Node: PC Dynamic, Next: PC Using, Prev: PC Compiling, Up: PC Installation + +B.3.3.3 Compiling `gawk' For Dynamic Libraries +.............................................. + +To compile `gawk' with dynamic extension support, uncomment the +definitions of `DYN_FLAGS', `DYN_EXP', `DYN_OBJ', and `DYN_MAKEXP' in +the configuration section of the `Makefile'. There are two definitions +for `DYN_MAKEXP': pick the one that matches your target. + + To build some of the example extension libraries, `cd' to the +extension directory and copy `Makefile.pc' to `Makefile'. You can then +build using the same two targets. To run the example `awk' scripts, +you'll need to either change the call to the `extension' function to +match the name of the library (for instance, change `"./ordchr.so"' to +`"ordchr.dll"' or simply `"ordchr"'), or rename the library to match +the call (for instance, rename `ordchr.dll' to `ordchr.so'). + + If you build `gawk.exe' with one compiler but want to build an +extension library with the other, you need to copy the import library. +Visual C uses a library called `gawk.lib', while MinGW uses a library +called `libgawk.a'. These files are equivalent and will interoperate if +you give them the correct name. The resulting shared libraries are +also interoperable. + + To create your own extension library, you can use the examples as +models, but you're essentially on your own. Post to `comp.lang.awk' or +send electronic mail to <ptjm@interlog.com> if you have problems getting +started. If you need to access functions or variables which are not +exported by `gawk.exe', add them to `gawkw32.def' and rebuild. You +should also add `ATTRIBUTE_EXPORTED' to the declaration in `awk.h' of +any variables you add to `gawkw32.def'. + + Note that extension libraries have the name of the `awk' executable +embedded in them at link time, so they will work only with `gawk.exe'. +In particular, they won't work if you rename `gawk.exe' to `awk.exe' or +if you try to use `pgawk.exe'. You can perform profiling by temporarily +renaming `pgawk.exe' to `gawk.exe'. You can resolve this problem by +changing the program name in the definition of `DYN_MAKEXP' for your +compiler. + + On Windows32, libraries are sought first in the current directory, +then in the directory containing `gawk.exe', and finally through the +`PATH' environment variable. + + +File: gawk.info, Node: PC Using, Next: Cygwin, Prev: PC Dynamic, Up: PC Installation + +B.3.3.4 Using `gawk' on PC Operating Systems +............................................ + +With the exception of the Cygwin environment, the `|&' operator and +TCP/IP networking (*note TCP/IP Networking::) are not supported for +MS-DOS or MS-Windows. EMX (OS/2 only) does support at least the `|&' +operator. + + The OS/2 and MS-DOS versions of `gawk' search for program files as +described in *note AWKPATH Variable::. However, semicolons (rather +than colons) separate elements in the `AWKPATH' variable. If `AWKPATH' +is not set or is empty, then the default search path for OS/2 (16 bit) +and MS-DOS versions is `".;c:/lib/awk;c:/gnu/lib/awk"'. + + The search path for OS/2 (32 bit, EMX) is determined by the prefix +directory (most likely `/usr' or `c:/usr') that has been specified as +an option of the `configure' script like it is the case for the Unix +versions. If `c:/usr' is the prefix directory then the default search +path contains `.' and `c:/usr/share/awk'. Additionally, to support +binary distributions of `gawk' for OS/2 systems whose drive `c:' might +not support long file names or might not exist at all, there is a +special environment variable. If `UNIXROOT' specifies a drive then this +specific drive is also searched for program files. E.g., if `UNIXROOT' +is set to `e:' the complete default search path is +`".;c:/usr/share/awk;e:/usr/share/awk"'. + + An `sh'-like shell (as opposed to `command.com' under MS-DOS or +`cmd.exe' under OS/2) may be useful for `awk' programming. Ian +Stewartson has written an excellent shell for MS-DOS and OS/2, Daisuke +Aoyama has ported GNU `bash' to MS-DOS using the DJGPP tools, and +several shells are available for OS/2, including `ksh'. The file +`README_d/README.pc' in the `gawk' distribution contains information on +these shells. Users of Stewartson's shell on DOS should examine its +documentation for handling command lines; in particular, the setting +for `gawk' in the shell configuration may need to be changed and the +`ignoretype' option may also be of interest. + + Under OS/2 and DOS, `gawk' (and many other text programs) silently +translate end-of-line `"\r\n"' to `"\n"' on input and `"\n"' to +`"\r\n"' on output. A special `BINMODE' variable allows control over +these translations and is interpreted as follows: + + * If `BINMODE' is `"r"', or `(BINMODE & 1)' is nonzero, then binary + mode is set on read (i.e., no translations on reads). + + * If `BINMODE' is `"w"', or `(BINMODE & 2)' is nonzero, then binary + mode is set on write (i.e., no translations on writes). + + * If `BINMODE' is `"rw"' or `"wr"', binary mode is set for both read + and write (same as `(BINMODE & 3)'). + + * `BINMODE=NON-NULL-STRING' is the same as `BINMODE=3' (i.e., no + translations on reads or writes). However, `gawk' issues a warning + message if the string is not one of `"rw"' or `"wr"'. + +The modes for standard input and standard output are set one time only +(after the command line is read, but before processing any of the `awk' +program). Setting `BINMODE' for standard input or standard output is +accomplished by using an appropriate `-v BINMODE=N' option on the +command line. `BINMODE' is set at the time a file or pipe is opened +and cannot be changed mid-stream. + + The name `BINMODE' was chosen to match `mawk' (*note Other +Versions::). Both `mawk' and `gawk' handle `BINMODE' similarly; +however, `mawk' adds a `-W BINMODE=N' option and an environment +variable that can set `BINMODE', `RS', and `ORS'. The files +`binmode[1-3].awk' (under `gnu/lib/awk' in some of the prepared +distributions) have been chosen to match `mawk''s `-W BINMODE=N' +option. These can be changed or discarded; in particular, the setting +of `RS' giving the fewest "surprises" is open to debate. `mawk' uses +`RS = "\r\n"' if binary mode is set on read, which is appropriate for +files with the DOS-style end-of-line. + + To illustrate, the following examples set binary mode on writes for +standard output and other files, and set `ORS' as the "usual" DOS-style +end-of-line: + + gawk -v BINMODE=2 -v ORS="\r\n" ... + +or: + + gawk -v BINMODE=w -f binmode2.awk ... + +These give the same result as the `-W BINMODE=2' option in `mawk'. The +following changes the record separator to `"\r\n"' and sets binary mode +on reads, but does not affect the mode on standard input: + + gawk -v RS="\r\n" --source "BEGIN { BINMODE = 1 }" ... + +or: + + gawk -f binmode1.awk ... + +With proper quoting, in the first example the setting of `RS' can be +moved into the `BEGIN' rule. + + +File: gawk.info, Node: Cygwin, Prev: PC Using, Up: PC Installation + +B.3.3.5 Using `gawk' In The Cygwin Environment +.............................................. + +`gawk' can be used "out of the box" under Windows if you are using the +Cygwin environment.(1) This environment provides an excellent +simulation of Unix, using the GNU tools, such as `bash', the GNU +Compiler Collection (GCC), GNU Make, and other GNU tools. Compilation +and installation for Cygwin is the same as for a Unix system: + + tar -xvpzf gawk-3.1.6.tar.gz + cd gawk-3.1.6 + ./configure + make + + When compared to GNU/Linux on the same system, the `configure' step +on Cygwin takes considerably longer. However, it does finish, and then +the `make' proceeds as usual. + + NOTE: The `|&' operator and TCP/IP networking (*note TCP/IP + Networking::) are fully supported in the Cygwin environment. This + is not true for any other environment for MS-DOS or MS-Windows. + + ---------- Footnotes ---------- + + (1) `http://www.cygwin.com' + + +File: gawk.info, Node: VMS Installation, Prev: PC Installation, Up: Non-Unix Installation + +B.3.4 How to Compile and Install `gawk' on VMS +---------------------------------------------- + +This node describes how to compile and install `gawk' under VMS. + +* Menu: + +* VMS Compilation:: How to compile `gawk' under VMS. +* VMS Installation Details:: How to install `gawk' under VMS. +* VMS Running:: How to run `gawk' under VMS. +* VMS POSIX:: Alternate instructions for VMS POSIX. +* VMS Old Gawk:: An old version comes with some VMS systems. + + +File: gawk.info, Node: VMS Compilation, Next: VMS Installation Details, Up: VMS Installation + +B.3.4.1 Compiling `gawk' on VMS +............................... + +To compile `gawk' under VMS, there is a `DCL' command procedure that +issues all the necessary `CC' and `LINK' commands. There is also a +`Makefile' for use with the `MMS' utility. From the source directory, +use either: + + $ @[.VMS]VMSBUILD.COM + +or: + + $ MMS/DESCRIPTION=[.VMS]DESCRIP.MMS GAWK + + Depending upon which C compiler you are using, follow one of the sets +of instructions in this table: + +VAX C V3.x + Use either `vmsbuild.com' or `descrip.mms' as is. These use + `CC/OPTIMIZE=NOLINE', which is essential for Version 3.0. + +VAX C V2.x + You must have Version 2.3 or 2.4; older ones won't work. Edit + either `vmsbuild.com' or `descrip.mms' according to the comments + in them. For `vmsbuild.com', this just entails removing two `!' + delimiters. Also edit `config.h' (which is a copy of file + `[.config]vms-conf.h') and comment out or delete the two lines + `#define __STDC__ 0' and `#define VAXC_BUILTINS' near the end. + +GNU C + Edit `vmsbuild.com' or `descrip.mms'; the changes are different + from those for VAX C V2.x but equally straightforward. No changes + to `config.h' are needed. + +DEC C + Edit `vmsbuild.com' or `descrip.mms' according to their comments. + No changes to `config.h' are needed. + + `gawk' has been tested under VAX/VMS 5.5-1 using VAX C V3.2, and GNU +C 1.40 and 2.3. It should work without modifications for VMS V4.6 and +up. + + +File: gawk.info, Node: VMS Installation Details, Next: VMS Running, Prev: VMS Compilation, Up: VMS Installation + +B.3.4.2 Installing `gawk' on VMS +................................ + +To install `gawk', all you need is a "foreign" command, which is a +`DCL' symbol whose value begins with a dollar sign. For example: + + $ GAWK :== $disk1:[gnubin]GAWK + +Substitute the actual location of `gawk.exe' for `$disk1:[gnubin]'. The +symbol should be placed in the `login.com' of any user who wants to run +`gawk', so that it is defined every time the user logs on. +Alternatively, the symbol may be placed in the system-wide +`sylogin.com' procedure, which allows all users to run `gawk'. + + Optionally, the help entry can be loaded into a VMS help library: + + $ LIBRARY/HELP SYS$HELP:HELPLIB [.VMS]GAWK.HLP + +(You may want to substitute a site-specific help library rather than +the standard VMS library `HELPLIB'.) After loading the help text, the +command: + + $ HELP GAWK + +provides information about both the `gawk' implementation and the `awk' +programming language. + + The logical name `AWK_LIBRARY' can designate a default location for +`awk' program files. For the `-f' option, if the specified file name +has no device or directory path information in it, `gawk' looks in the +current directory first, then in the directory specified by the +translation of `AWK_LIBRARY' if the file is not found. If, after +searching in both directories, the file still is not found, `gawk' +appends the suffix `.awk' to the filename and retries the file search. +If `AWK_LIBRARY' is not defined, that portion of the file search fails +benignly. + + +File: gawk.info, Node: VMS Running, Next: VMS POSIX, Prev: VMS Installation Details, Up: VMS Installation + +B.3.4.3 Running `gawk' on VMS +............................. + +Command-line parsing and quoting conventions are significantly different +on VMS, so examples in this Info file or from other sources often need +minor changes. They _are_ minor though, and all `awk' programs should +run correctly. + + Here are a couple of trivial tests: + + $ gawk -- "BEGIN {print ""Hello, World!""}" + $ gawk -"W" version + ! could also be -"W version" or "-W version" + +Note that uppercase and mixed-case text must be quoted. + + The VMS port of `gawk' includes a `DCL'-style interface in addition +to the original shell-style interface (see the help entry for details). +One side effect of dual command-line parsing is that if there is only a +single parameter (as in the quoted string program above), the command +becomes ambiguous. To work around this, the normally optional `--' +flag is required to force Unix style rather than `DCL' parsing. If any +other dash-type options (or multiple parameters such as data files to +process) are present, there is no ambiguity and `--' can be omitted. + + The default search path, when looking for `awk' program files +specified by the `-f' option, is `"SYS$DISK:[],AWK_LIBRARY:"'. The +logical name `AWKPATH' can be used to override this default. The format +of `AWKPATH' is a comma-separated list of directory specifications. +When defining it, the value should be quoted so that it retains a single +translation and not a multitranslation `RMS' searchlist. + + +File: gawk.info, Node: VMS POSIX, Next: VMS Old Gawk, Prev: VMS Running, Up: VMS Installation + +B.3.4.4 Building and Using `gawk' on VMS POSIX +.............................................. + +Ignore the instructions above, although `vms/gawk.hlp' should still be +made available in a help library. The source tree should be unpacked +into a container file subsystem rather than into the ordinary VMS +filesystem. Make sure that the two scripts, `configure' and +`vms/posix-cc.sh', are executable; use `chmod +x' on them if necessary. +Then execute the following two commands: + + psx> CC=vms/posix-cc.sh configure + psx> make CC=c89 gawk + +The first command constructs files `config.h' and `Makefile' out of +templates, using a script to make the C compiler fit `configure''s +expectations. The second command compiles and links `gawk' using the C +compiler directly; ignore any warnings from `make' about being unable +to redefine `CC'. `configure' takes a very long time to execute, but +at least it provides incremental feedback as it runs. + + This has been tested with VAX/VMS V6.2, VMS POSIX V2.0, and DEC C +V5.2. + + Once built, `gawk' works like any other shell utility. Unlike the +normal VMS port of `gawk', no special command-line manipulation is +needed in the VMS POSIX environment. + + +File: gawk.info, Node: VMS Old Gawk, Prev: VMS POSIX, Up: VMS Installation + +B.3.4.5 Some VMS Systems Have An Old Version of `gawk' +...................................................... + +Some versions of VMS have an old version of `gawk'. To access it, +define a symbol, as follows: + + $ gawk :== $ sys$common:[syshlp.examples.tcpip.snmp]gawk.exe + + This is apparently version 2.15.6, which is quite old. We recommend +compiling and using the current version. + + +File: gawk.info, Node: Unsupported, Next: Bugs, Prev: Non-Unix Installation, Up: Installation + +B.4 Unsupported Operating System Ports +====================================== + +This sections describes systems for which the `gawk' port is no longer +supported. + +* Menu: + +* Atari Installation:: Installing `gawk' on the Atari ST. +* Tandem Installation:: Installing `gawk' on a Tandem. + + +File: gawk.info, Node: Atari Installation, Next: Tandem Installation, Up: Unsupported + +B.4.1 Installing `gawk' on the Atari ST +--------------------------------------- + +The Atari port is no longer supported. It is included for those who +might want to use it but it is no longer being actively maintained. + + There are no substantial differences when installing `gawk' on +various Atari models. Compiled `gawk' executables do not require a +large amount of memory with most `awk' programs, and should run on all +Motorola processor-based models (called further ST, even if that is not +exactly right). + + In order to use `gawk', you need to have a shell, either text or +graphics, that does not map all the characters of a command line to +uppercase. Maintaining case distinction in option flags is very +important (*note Options::). These days this is the default and it may +only be a problem for some very old machines. If your system does not +preserve the case of option flags, you need to upgrade your tools. +Support for I/O redirection is necessary to make it easy to import +`awk' programs from other environments. Pipes are nice to have but not +vital. + +* Menu: + +* Atari Compiling:: Compiling `gawk' on Atari. +* Atari Using:: Running `gawk' on Atari. + + +File: gawk.info, Node: Atari Compiling, Next: Atari Using, Up: Atari Installation + +B.4.1.1 Compiling `gawk' on the Atari ST +........................................ + +A proper compilation of `gawk' sources when `sizeof(int)' differs from +`sizeof(void *)' requires an ISO C compiler. An initial port was done +with `gcc'. You may actually prefer executables where `int's are four +bytes wide but the other variant works as well. + + You may need quite a bit of memory when trying to recompile the +`gawk' sources, as some source files (`regex.c' in particular) are quite +big. If you run out of memory compiling such a file, try reducing the +optimization level for this particular file, which may help. + + With a reasonable shell (`bash' will do), you have a pretty good +chance that the `configure' utility will succeed, and in particular if +you run GNU/Linux, MiNT or a similar operating system. Otherwise +sample versions of `config.h' and `Makefile.st' are given in the +`atari' subdirectory and can be edited and copied to the corresponding +files in the main source directory. Even if `configure' produces +something, it might be advisable to compare its results with the sample +versions and possibly make adjustments. + + Some `gawk' source code fragments depend on a preprocessor define +`atarist'. This basically assumes the TOS environment with `gcc'. +Modify these sections as appropriate if they are not right for your +environment. Also see the remarks about `AWKPATH' and `envsep' in +*note Atari Using::. + + As shipped, the sample `config.h' claims that the `system' function +is missing from the libraries, which is not true, and an alternative +implementation of this function is provided in +`unsupported/atari/system.c'. Depending upon your particular +combination of shell and operating system, you might want to change the +file to indicate that `system' is available. + + +File: gawk.info, Node: Atari Using, Prev: Atari Compiling, Up: Atari Installation + +B.4.1.2 Running `gawk' on the Atari ST +...................................... + +An executable version of `gawk' should be placed, as usual, anywhere in +your `PATH' where your shell can find it. + + While executing, the Atari version of `gawk' creates a number of +temporary files. When using `gcc' libraries for TOS, `gawk' looks for +either of the environment variables, `TEMP' or `TMPDIR', in that order. +If either one is found, its value is assumed to be a directory for +temporary files. This directory must exist, and if you can spare the +memory, it is a good idea to put it on a RAM drive. If neither `TEMP' +nor `TMPDIR' are found, then `gawk' uses the current directory for its +temporary files. + + The ST version of `gawk' searches for its program files, as +described in *note AWKPATH Variable::. The default value for the +`AWKPATH' variable is taken from `DEFPATH' defined in `Makefile'. The +sample `gcc'/TOS `Makefile' for the ST in the distribution sets +`DEFPATH' to `".,c:\lib\awk,c:\gnu\lib\awk"'. The search path can be +modified by explicitly setting `AWKPATH' to whatever you want. Note +that colons cannot be used on the ST to separate elements in the +`AWKPATH' variable, since they have another reserved meaning. Instead, +you must use a comma to separate elements in the path. When +recompiling, the separating character can be modified by initializing +the `envsep' variable in `unsupported/atari/gawkmisc.atr' to another +value. + + Although `awk' allows great flexibility in doing I/O redirections +from within a program, this facility should be used with care on the ST +running under TOS. In some circumstances, the OS routines for +file-handle pool processing lose track of certain events, causing the +computer to crash and requiring a reboot. Often a warm reboot is +sufficient. Fortunately, this happens infrequently and in rather +esoteric situations. In particular, avoid having one part of an `awk' +program using `print' statements explicitly redirected to +`/dev/stdout', while other `print' statements use the default standard +output, and a calling shell has redirected standard output to a file. + + When `gawk' is compiled with the ST version of `gcc' and its usual +libraries, it accepts both `/' and `\' as path separators. While this +is convenient, it should be remembered that this removes one +technically valid character (`/') from your file name. It may also +create problems for external programs called via the `system' function, +which may not support this convention. Whenever it is possible that a +file created by `gawk' will be used by some other program, use only +backslashes. Also remember that in `awk', backslashes in strings have +to be doubled in order to get literal backslashes (*note Escape +Sequences::). + + +File: gawk.info, Node: Tandem Installation, Prev: Atari Installation, Up: Unsupported + +B.4.2 Installing `gawk' on a Tandem +----------------------------------- + +The Tandem port is only minimally supported. The port's contributor no +longer has access to a Tandem system. + + The Tandem port was done on a Cyclone machine running D20. The port +is pretty clean and all facilities seem to work except for the I/O +piping facilities (*note Getline/Pipe::, *note Getline/Variable/Pipe::, +and *note Redirection::), which is just too foreign a concept for +Tandem. + + To build a Tandem executable from source, download all of the files +so that the file names on the Tandem box conform to the restrictions of +D20. For example, `array.c' becomes `ARRAYC', and `awk.h' becomes +`AWKH'. The totally Tandem-specific files are in the `tandem' +"subvolume" (`unsupported/tandem' in the `gawk' distribution) and +should be copied to the main source directory before building `gawk'. + + The file `compit' can then be used to compile and bind an executable. +Alas, there is no `configure' or `make'. + + Usage is the same as for Unix, except that D20 requires all `{' and +`}' characters to be escaped with `~' on the command line (but _not_ in +script files). Also, the standard Tandem syntax for `/in filename,out +filename/' must be used instead of the usual Unix `<' and `>' for file +redirection. (Redirection options on `getline', `print' etc., are +supported.) + + The `-mr VAL' option (*note Options::) has been "stolen" to enable +Tandem users to process fixed-length records with no "end-of-line" +character. That is, `-mr 74' tells `gawk' to read the input file as +fixed 74-byte records. + + +File: gawk.info, Node: Bugs, Next: Other Versions, Prev: Unsupported, Up: Installation + +B.5 Reporting Problems and Bugs +=============================== + + There is nothing more dangerous than a bored archeologist. + The Hitchhiker's Guide to the Galaxy + + If you have problems with `gawk' or think that you have found a bug, +please report it to the developers; we cannot promise to do anything +but we might well want to fix it. + + Before reporting a bug, make sure you have actually found a real bug. +Carefully reread the documentation and see if it really says you can do +what you're trying to do. If it's not clear whether you should be able +to do something or not, report that too; it's a bug in the +documentation! + + Before reporting a bug or trying to fix it yourself, try to isolate +it to the smallest possible `awk' program and input data file that +reproduces the problem. Then send us the program and data file, some +idea of what kind of Unix system you're using, the compiler you used to +compile `gawk', and the exact results `gawk' gave you. Also say what +you expected to occur; this helps us decide whether the problem is +really in the documentation. + + Once you have a precise problem, send email to <bug-gawk@gnu.org>. + + Please include the version number of `gawk' you are using. You can +get this information with the command `gawk --version'. Using this +address automatically sends a carbon copy of your mail to me. If +necessary, I can be reached directly at <arnold@skeeve.com>. The bug +reporting address is preferred since the email list is archived at the +GNU Project. _All email should be in English, since that is my native +language._ + + *Caution:* Do _not_ try to report bugs in `gawk' by posting to the +Usenet/Internet newsgroup `comp.lang.awk'. While the `gawk' developers +do occasionally read this newsgroup, there is no guarantee that we will +see your posting. The steps described above are the official +recognized ways for reporting bugs. + + Non-bug suggestions are always welcome as well. If you have +questions about things that are unclear in the documentation or are +just obscure features, ask me; I will try to help you out, although I +may not have the time to fix the problem. You can send me electronic +mail at the Internet address noted previously. + + If you find bugs in one of the non-Unix ports of `gawk', please send +an electronic mail message to the person who maintains that port. They +are named in the following list, as well as in the `README' file in the +`gawk' distribution. Information in the `README' file should be +considered authoritative if it conflicts with this Info file. + + The people maintaining the non-Unix ports of `gawk' are as follows: + +Amiga Fred Fish, <fnf@ninemoons.com>. +BeOS Martin Brown, <mc@whoever.com>. +MS-DOS Scott Deifik, <scottd.mail@sbcglobal.net> and Darrel + Hankerson, <hankedr@mail.auburn.edu>. +MS-Windows Juan Grigera, <juan@biophnet.unlp.edu.ar>. +OS/2 The Unix for OS/2 team, + <gawk-maintainer@unixos2.org>. +Tandem Stephen Davies, <scldad@sdc.com.au>. +VMS Pat Rankin, <rankin@pactechdata.com>. + + If your bug is also reproducible under Unix, please send a copy of +your report to the <bug-gawk@gnu.org> email list as well. + + +File: gawk.info, Node: Other Versions, Prev: Bugs, Up: Installation + +B.6 Other Freely Available `awk' Implementations +================================================ + + It's kind of fun to put comments like this in your awk code. + `// Do C++ comments work? answer: yes! of course' + Michael Brennan + + There are a number of other freely available `awk' implementations. +This minor node briefly describes where to get them: + +Unix `awk' + Brian Kernighan has made his implementation of `awk' freely + available. You can retrieve this version via the World Wide Web + from his home page.(1) It is available in several archive formats: + + Shell archive + `http://cm.bell-labs.com/who/bwk/awk.shar' + + Compressed `tar' file + `http://cm.bell-labs.com/who/bwk/awk.tar.gz' + + Zip file + `http://cm.bell-labs.com/who/bwk/awk.zip' + + This version requires an ISO C (1990 standard) compiler; the C + compiler from GCC (the GNU Compiler Collection) works quite nicely. + + *Note BTL::, for a list of extensions in this `awk' that are not + in POSIX `awk'. + +`mawk' + Michael Brennan has written an independent implementation of `awk', + called `mawk'. It is available under the GPL (*note Copying::), + just as `gawk' is. + + You can get it via anonymous `ftp' to the host `ftp.whidbey.net'. + Change directory to `/pub/brennan'. Use "binary" or "image" mode, + and retrieve `mawk1.3.3.tar.gz' (or the latest version that is + there). + + `gunzip' may be used to decompress this file. Installation is + similar to `gawk''s (*note Unix Installation::). + + `mawk' has the following extensions that are not in POSIX `awk': + + * The `fflush' built-in function for flushing buffered output + (*note I/O Functions::). + + * The `**' and `**=' operators (*note Arithmetic Ops:: and also + see *note Assignment Ops::). + + * The use of `func' as an abbreviation for `function' (*note + Definition Syntax::). + + * The `\x' escape sequence (*note Escape Sequences::). + + * The `/dev/stdout', and `/dev/stderr' special files (*note + Special Files::). Use `"-"' instead of `"/dev/stdin"' with + `mawk'. + + * The ability for `FS' and for the third argument to `split' to + be null strings (*note Single Character Fields::). + + * The ability to delete all of an array at once with `delete + ARRAY' (*note Delete::). + + * The ability for `RS' to be a regexp (*note Records::). + + * The `BINMODE' special variable for non-Unix operating systems + (*note PC Using::). + + The next version of `mawk' will support `nextfile'. + +`awka' + Written by Andrew Sumner, `awka' translates `awk' programs into C, + compiles them, and links them with a library of functions that + provides the core `awk' functionality. It also has a number of + extensions. + + The `awk' translator is released under the GPL, and the library is + under the LGPL. + + To get `awka', go to `http://awka.sourceforge.net'. You can reach + Andrew Sumner at <andrew@zbcom.net>. + +`pawk' + Nelson H.F. Beebe at the University of Utah has modified the Bell + Labs `awk' to provide timing and profiling information. It is + different from `pgawk' (*note Profiling::), in that it uses + CPU-based profiling, not line-count profiling. You may find it at + either `ftp://ftp.math.utah.edu/pub/pawk/pawk-20020210.tar.gz' or + `http://www.math.utah.edu/pub/pawk/pawk-20020210.tar.gz'. + +The OpenSolaris POSIX `awk' + The version of `awk' in `/usr/xpg4/bin' on Solaris is POSIX + compliant. It is based on the `awk' from Mortice Kern Systems for + PCs. The source code can be downloaded from the OpenSolaris web + site.(2) This author was able to make it compile and work under + GNU/Linux with 1-2 hours of work. Making it more generally + portable (using GNU Autoconf and/or Automake) would take more + work, and this has not been done, at least to our knowledge. + +`jawk' + This is an interpreter for `awk' written in Java. It claims to be + a full interpreter, although because it uses Java facilities for + I/O and for regexp matching, the language it supports is different + from POSIX `awk'. More information is available on the project's + home page.(3). + + + ---------- Footnotes ---------- + + (1) `http://cm.bell-labs.com/who/bwk' + + (2) `http://www.opensolaris.org' + + (3) `http://jawk.sourceforge.net' + + +File: gawk.info, Node: Notes, Next: Basic Concepts, Prev: Installation, Up: Top + +Appendix C Implementation Notes +******************************* + +This appendix contains information mainly of interest to implementors +and maintainers of `gawk'. Everything in it applies specifically to +`gawk' and not to other implementations. + +* Menu: + +* Compatibility Mode:: How to disable certain `gawk' + extensions. +* Additions:: Making Additions To `gawk'. +* Dynamic Extensions:: Adding new built-in functions to + `gawk'. +* Future Extensions:: New features that may be implemented one day. + + +File: gawk.info, Node: Compatibility Mode, Next: Additions, Up: Notes + +C.1 Downward Compatibility and Debugging +======================================== + +*Note POSIX/GNU::, for a summary of the GNU extensions to the `awk' +language and program. All of these features can be turned off by +invoking `gawk' with the `--traditional' option or with the `--posix' +option. + + If `gawk' is compiled for debugging with `-DDEBUG', then there is +one more option available on the command line: + +`-W parsedebug' +`--parsedebug' + Prints out the parse stack information as the program is being + parsed. + + This option is intended only for serious `gawk' developers and not +for the casual user. It probably has not even been compiled into your +version of `gawk', since it slows down execution. + + +File: gawk.info, Node: Additions, Next: Dynamic Extensions, Prev: Compatibility Mode, Up: Notes + +C.2 Making Additions to `gawk' +============================== + +If you find that you want to enhance `gawk' in a significant fashion, +you are perfectly free to do so. That is the point of having free +software; the source code is available and you are free to change it as +you want (*note Copying::). + + This minor node discusses the ways you might want to change `gawk' +as well as any considerations you should bear in mind. + +* Menu: + +* Adding Code:: Adding code to the main body of + `gawk'. +* New Ports:: Porting `gawk' to a new operating + system. + + +File: gawk.info, Node: Adding Code, Next: New Ports, Up: Additions + +C.2.1 Adding New Features +------------------------- + +You are free to add any new features you like to `gawk'. However, if +you want your changes to be incorporated into the `gawk' distribution, +there are several steps that you need to take in order to make it +possible for me to include your changes: + + 1. Before building the new feature into `gawk' itself, consider + writing it as an extension module (*note Dynamic Extensions::). + If that's not possible, continue with the rest of the steps in + this list. + + 2. Get the latest version. It is much easier for me to integrate + changes if they are relative to the most recent distributed + version of `gawk'. If your version of `gawk' is very old, I may + not be able to integrate them at all. (*Note Getting::, for + information on getting the latest version of `gawk'.) + + 3. See *note (Version)Top:: standards, GNU Coding Standards. This + document describes how GNU software should be written. If you + haven't read it, please do so, preferably _before_ starting to + modify `gawk'. (The `GNU Coding Standards' are available from the + GNU Project's `ftp' site, at + `ftp://ftp.gnu.org/gnu/GNUinfo/standards.text'. An HTML version, + suitable for reading with a WWW browser, is available at + `http://www.gnu.org/prep/standards_toc.html'. Texinfo, Info, and + DVI versions are also available.) + + 4. Use the `gawk' coding style. The C code for `gawk' follows the + instructions in the `GNU Coding Standards', with minor exceptions. + The code is formatted using the traditional "K&R" style, + particularly as regards to the placement of braces and the use of + tabs. In brief, the coding rules for `gawk' are as follows: + + * Use ANSI/ISO style (prototype) function headers when defining + functions. + + * Put the name of the function at the beginning of its own line. + + * Put the return type of the function, even if it is `int', on + the line above the line with the name and arguments of the + function. + + * Put spaces around parentheses used in control structures + (`if', `while', `for', `do', `switch', and `return'). + + * Do not put spaces in front of parentheses used in function + calls. + + * Put spaces around all C operators and after commas in + function calls. + + * Do not use the comma operator to produce multiple side + effects, except in `for' loop initialization and increment + parts, and in macro bodies. + + * Use real tabs for indenting, not spaces. + + * Use the "K&R" brace layout style. + + * Use comparisons against `NULL' and `'\0'' in the conditions of + `if', `while', and `for' statements, as well as in the `case's + of `switch' statements, instead of just the plain pointer or + character value. + + * Use the `TRUE', `FALSE' and `NULL' symbolic constants and the + character constant `'\0'' where appropriate, instead of `1' + and `0'. + + * Use the `ISALPHA', `ISDIGIT', etc. macros, instead of the + traditional lowercase versions; these macros are better + behaved for non-ASCII character sets. + + * Provide one-line descriptive comments for each function. + + * Do not use `#elif'. Many older Unix C compilers cannot handle + it. + + * Do not use the `alloca' function for allocating memory off + the stack. Its use causes more portability trouble than is + worth the minor benefit of not having to free the storage. + Instead, use `malloc' and `free'. + + NOTE: If I have to reformat your code to follow the coding + style used in `gawk', I may not bother to integrate your + changes at all. + + 5. Be prepared to sign the appropriate paperwork. In order for the + FSF to distribute your changes, you must either place those + changes in the public domain and submit a signed statement to that + effect, or assign the copyright in your changes to the FSF. Both + of these actions are easy to do and _many_ people have done so + already. If you have questions, please contact me (*note Bugs::), + or <gnu@gnu.org>. + + 6. Update the documentation. Along with your new code, please supply + new sections and/or chapters for this Info file. If at all + possible, please use real Texinfo, instead of just supplying + unformatted ASCII text (although even that is better than no + documentation at all). Conventions to be followed in `GAWK: + Effective AWK Programming' are provided after the `@bye' at the + end of the Texinfo source file. If possible, please update the + `man' page as well. + + You will also have to sign paperwork for your documentation + changes. + + 7. Submit changes as context diffs or unified diffs. Use `diff -c -r + -N' or `diff -u -r -N' to compare the original `gawk' source tree + with your version. (I find context diffs to be more readable but + unified diffs are more compact.) I recommend using the GNU + version of `diff'. Send the output produced by either run of + `diff' to me when you submit your changes. (*Note Bugs::, for the + electronic mail information.) + + Using this format makes it easy for me to apply your changes to the + master version of the `gawk' source code (using `patch'). If I + have to apply the changes manually, using a text editor, I may not + do so, particularly if there are lots of changes. + + 8. Include an entry for the `ChangeLog' file with your submission. + This helps further minimize the amount of work I have to do, + making it easier for me to accept patches. + + Although this sounds like a lot of work, please remember that while +you may write the new code, I have to maintain it and support it. If it +isn't possible for me to do that with a minimum of extra work, then I +probably will not. + + +File: gawk.info, Node: New Ports, Prev: Adding Code, Up: Additions + +C.2.2 Porting `gawk' to a New Operating System +---------------------------------------------- + +If you want to port `gawk' to a new operating system, there are several +steps: + + 1. Follow the guidelines in *note Adding Code::, concerning coding + style, submission of diffs, and so on. + + 2. When doing a port, bear in mind that your code must coexist + peacefully with the rest of `gawk' and the other ports. Avoid + gratuitous changes to the system-independent parts of the code. If + at all possible, avoid sprinkling `#ifdef's just for your port + throughout the code. + + If the changes needed for a particular system affect too much of + the code, I probably will not accept them. In such a case, you + can, of course, distribute your changes on your own, as long as + you comply with the GPL (*note Copying::). + + 3. A number of the files that come with `gawk' are maintained by other + people at the Free Software Foundation. Thus, you should not + change them unless it is for a very good reason; i.e., changes are + not out of the question, but changes to these files are + scrutinized extra carefully. The files are `getopt.h', + `getopt.c', `getopt1.c', `regex.h', `regex.c', `regcomp.c', + `regex_internal.c', `regex_internal.h', `regexec.c', `dfa.h', + `dfa.c', `install-sh', and `mkinstalldirs'. + + 4. Be willing to continue to maintain the port. Non-Unix operating + systems are supported by volunteers who maintain the code needed + to compile and run `gawk' on their systems. If noone volunteers to + maintain a port, it becomes unsupported and it may be necessary to + remove it from the distribution. + + 5. Supply an appropriate `gawkmisc.???' file. Each port has its own + `gawkmisc.???' that implements certain operating system specific + functions. This is cleaner than a plethora of `#ifdef's scattered + throughout the code. The `gawkmisc.c' in the main source + directory includes the appropriate `gawkmisc.???' file from each + subdirectory. Be sure to update it as well. + + Each port's `gawkmisc.???' file has a suffix reminiscent of the + machine or operating system for the port--for example, + `pc/gawkmisc.pc' and `vms/gawkmisc.vms'. The use of separate + suffixes, instead of plain `gawkmisc.c', makes it possible to move + files from a port's subdirectory into the main subdirectory, + without accidentally destroying the real `gawkmisc.c' file. + (Currently, this is only an issue for the PC operating system + ports.) + + 6. Supply a `Makefile' as well as any other C source and header files + that are necessary for your operating system. All your code + should be in a separate subdirectory, with a name that is the same + as, or reminiscent of, either your operating system or the + computer system. If possible, try to structure things so that it + is not necessary to move files out of the subdirectory into the + main source directory. If that is not possible, then be sure to + avoid using names for your files that duplicate the names of files + in the main source directory. + + 7. Update the documentation. Please write a section (or sections) + for this Info file describing the installation and compilation + steps needed to compile and/or install `gawk' for your system. + + 8. Be prepared to sign the appropriate paperwork. In order for the + FSF to distribute your code, you must either place your code in + the public domain and submit a signed statement to that effect, or + assign the copyright in your code to the FSF. Both of these + actions are easy to do and _many_ people have done so already. If + you have questions, please contact me, or <gnu@gnu.org>. + + Following these steps makes it much easier to integrate your changes +into `gawk' and have them coexist happily with other operating systems' +code that is already there. + + In the code that you supply and maintain, feel free to use a coding +style and brace layout that suits your taste. + + +File: gawk.info, Node: Dynamic Extensions, Next: Future Extensions, Prev: Additions, Up: Notes + +C.3 Adding New Built-in Functions to `gawk' +=========================================== + + Danger Will Robinson! Danger!! + Warning! Warning! + The Robot + + Beginning with `gawk' 3.1, it is possible to add new built-in +functions to `gawk' using dynamically loaded libraries. This facility +is available on systems (such as GNU/Linux) that support the `dlopen' +and `dlsym' functions. This minor node describes how to write and use +dynamically loaded extensions for `gawk'. Experience with programming +in C or C++ is necessary when reading this minor node. + + *Caution:* The facilities described in this minor node are very much +subject to change in a future `gawk' release. Be aware that you may +have to re-do everything, perhaps from scratch, at some future time. + + *Caution:* If you have written your own dynamic extensions, be sure +to recompile them for each new `gawk' release. There is no guarantee +of binary compatibility between different releases, nor will there ever +be such a guarantee. + +* Menu: + +* Internals:: A brief look at some `gawk' internals. +* Sample Library:: A example of new functions. + + +File: gawk.info, Node: Internals, Next: Sample Library, Up: Dynamic Extensions + +C.3.1 A Minimal Introduction to `gawk' Internals +------------------------------------------------ + +The truth is that `gawk' was not designed for simple extensibility. +The facilities for adding functions using shared libraries work, but +are something of a "bag on the side." Thus, this tour is brief and +simplistic; would-be `gawk' hackers are encouraged to spend some time +reading the source code before trying to write extensions based on the +material presented here. Of particular note are the files `awk.h', +`builtin.c', and `eval.c'. Reading `awkgram.y' in order to see how the +parse tree is built would also be of use. + + With the disclaimers out of the way, the following types, structure +members, functions, and macros are declared in `awk.h' and are of use +when writing extensions. The next minor node shows how they are used: + +`AWKNUM' + An `AWKNUM' is the internal type of `awk' floating-point numbers. + Typically, it is a C `double'. + +`NODE' + Just about everything is done using objects of type `NODE'. These + contain both strings and numbers, as well as variables and arrays. + +`AWKNUM force_number(NODE *n)' + This macro forces a value to be numeric. It returns the actual + numeric value contained in the node. It may end up calling an + internal `gawk' function. + +`void force_string(NODE *n)' + This macro guarantees that a `NODE''s string value is current. It + may end up calling an internal `gawk' function. It also + guarantees that the string is zero-terminated. + +`size_t get_curfunc_arg_count(void)' + This function returns the actual number of parameters passed to + the current function. Inside the code of an extension this can be + used to determine the maximum index which is safe to use with + `stack_ptr'. If this value is greater than `tree->param_cnt', the + function was called incorrectly from the `awk' program. + + *Caution:* This function is new as of `gawk' 3.1.4. + +`n->param_cnt' + Inside an extension function, this is the maximum number of + expected parameters, as set by the `make_builtin' function. + +`n->stptr' +`n->stlen' + The data and length of a `NODE''s string value, respectively. The + string is _not_ guaranteed to be zero-terminated. If you need to + pass the string value to a C library function, save the value in + `n->stptr[n->stlen]', assign `'\0'' to it, call the routine, and + then restore the value. + +`n->type' + The type of the `NODE'. This is a C `enum'. Values should be + either `Node_var' or `Node_var_array' for function parameters. + +`n->vname' + The "variable name" of a node. This is not of much use inside + externally written extensions. + +`void assoc_clear(NODE *n)' + Clears the associative array pointed to by `n'. Make sure that + `n->type == Node_var_array' first. + +`NODE **assoc_lookup(NODE *symbol, NODE *subs, int reference)' + Finds, and installs if necessary, array elements. `symbol' is the + array, `subs' is the subscript. This is usually a value created + with `tmp_string' (see below). `reference' should be `TRUE' if it + is an error to use the value before it is created. Typically, + `FALSE' is the correct value to use from extension functions. + +`NODE *make_string(char *s, size_t len)' + Take a C string and turn it into a pointer to a `NODE' that can be + stored appropriately. This is permanent storage; understanding of + `gawk' memory management is helpful. + +`NODE *make_number(AWKNUM val)' + Take an `AWKNUM' and turn it into a pointer to a `NODE' that can + be stored appropriately. This is permanent storage; understanding + of `gawk' memory management is helpful. + +`NODE *tmp_string(char *s, size_t len);' + Take a C string and turn it into a pointer to a `NODE' that can be + stored appropriately. This is temporary storage; understanding of + `gawk' memory management is helpful. + +`NODE *tmp_number(AWKNUM val)' + Take an `AWKNUM' and turn it into a pointer to a `NODE' that can + be stored appropriately. This is temporary storage; understanding + of `gawk' memory management is helpful. + +`NODE *dupnode(NODE *n)' + Duplicate a node. In most cases, this increments an internal + reference count instead of actually duplicating the entire `NODE'; + understanding of `gawk' memory management is helpful. + +`void free_temp(NODE *n)' + This macro releases the memory associated with a `NODE' allocated + with `tmp_string' or `tmp_number'. Understanding of `gawk' memory + management is helpful. + +`void make_builtin(char *name, NODE *(*func)(NODE *), int count)' + Register a C function pointed to by `func' as new built-in + function `name'. `name' is a regular C string. `count' is the + maximum number of arguments that the function takes. The function + should be written in the following manner: + + /* do_xxx --- do xxx function for gawk */ + + NODE * + do_xxx(NODE *tree) + { + ... + } + +`NODE *get_argument(NODE *tree, int i)' + This function is called from within a C extension function to get + the `i'-th argument from the function call. The first argument is + argument zero. + +`NODE *get_actual_argument(NODE *tree, unsigned int i,' +` int optional, int wantarray);' + This function retrieves a particular argument `i'. `wantarray' is + `TRUE' if the argument should be an array, `FALSE' otherwise. If + `optional' is `TRUE', the argument need not have been supplied. + If it wasn't, the return value is `NULL'. It is a fatal error if + `optional' is `TRUE' but the argument was not provided. + + *Caution:* This function is new as of `gawk' 3.1.4. + +`get_scalar_argument(t, i, opt)' + This is a convenience macro that calls `get_actual_argument'. + + *Caution:* This macro is new as of `gawk' 3.1.4. + +`get_array_argument(t, i, opt)' + This is a convenience macro that calls `get_actual_argument'. + + *Caution:* This macro is new as of `gawk' 3.1.4. + +`void set_value(NODE *tree)' + This function is called from within a C extension function to set + the return value from the extension function. This value is what + the `awk' program sees as the return value from the new `awk' + function. + +`void update_ERRNO(void)' + This function is called from within a C extension function to set + the value of `gawk''s `ERRNO' variable, based on the current value + of the C `errno' variable. It is provided as a convenience. + +`void update_ERRNO_saved(int errno_saved)' + This function is called from within a C extension function to set + the value of `gawk''s `ERRNO' variable, based on the saved value + of the C `errno' variable provided as the argument. It is + provided as a convenience. + + *Caution:* This function is new as of `gawk' 3.1.5. + +`void register_deferred_variable(const char *name, NODE *(*load_func)(void))' + This function is called to register a function to be called when a + reference to an undefined variable with the given name is + encountered. The callback function will never be called if the + variable exists already, so, unless the calling code is running at + program startup, it should first check whether a variable of the + given name already exists. The argument function must return a + pointer to a NODE containing the newly created variable. This + function is used to implement the builtin `ENVIRON' and `PROCINFO' + variables, so you can refer to them for examples. + + *Caution:* This function is new as of `gawk' 3.1.5. + +`void register_open_hook(void *(*open_func)(IOBUF *))' + This function is called to register a function to be called + whenever a new data file is opened, leading to the creation of an + `IOBUF' structure in `iop_alloc'. After creating the new `IOBUF', + `iop_alloc' will call (in reverse order of registration, so the + last function registered is called first) each open hook until one + returns non-NULL. If any hook returns a non-NULL value, that + value is assigned to the `IOBUF''s `opaque' field (which will + presumably point to a structure containing additional state + associated with the input processing), and no further open hooks + are called. + + The function called will most likely want to set the `IOBUF' + `get_record' method to indicate that future input records should + be retrieved by calling that method instead of using the standard + `gawk' input processing. + + And the function will also probably want to set the `IOBUF' + `close_func' method to be called when the file is closed to clean + up any state associated with the input. + + Finally, hook functions should be prepared to receive an `IOBUF' + structure where the `fd' field is set to `INVALID_HANDLE', meaning + that `gawk' was not able to open the file itself. In this case, + the hook function must be able to successfully open the file and + place a valid file descriptor there. + + Currently, for example, the hook function facility is used to + implement the XML parser shared library extension. For more info, + please look in `awk.h' and in `io.c'. + + *Caution:* This function is new as of `gawk' 3.1.5. + + An argument that is supposed to be an array needs to be handled with +some extra code, in case the array being passed in is actually from a +function parameter. + + In versions of `gawk' up to and including 3.1.2, the following +boilerplate code shows how to do this: + + NODE *the_arg; + + the_arg = get_argument(tree, 2); /* assume need 3rd arg, 0-based */ + + /* if a parameter, get it off the stack */ + if (the_arg->type == Node_param_list) + the_arg = stack_ptr[the_arg->param_cnt]; + + /* parameter referenced an array, get it */ + if (the_arg->type == Node_array_ref) + the_arg = the_arg->orig_array; + + /* check type */ + if (the_arg->type != Node_var && the_arg->type != Node_var_array) + fatal("newfunc: third argument is not an array"); + + /* force it to be an array, if necessary, clear it */ + the_arg->type = Node_var_array; + assoc_clear(the_arg); + + For versions 3.1.3 and later, the internals changed. In particular, +the interface was actually _simplified_ drastically. The following +boilerplate code now suffices: + + NODE *the_arg; + + the_arg = get_argument(tree, 2); /* assume need 3rd arg, 0-based */ + + /* force it to be an array: */ + the_arg = get_array(the_arg); + + /* if necessary, clear it: */ + assoc_clear(the_arg); + + As of version 3.1.4, the internals improved again, and became even +simpler: + + NODE *the_arg; + + the_arg = get_array_argument(tree, 2, FALSE); /* assume need 3rd arg, 0-based */ + + Again, you should spend time studying the `gawk' internals; don't +just blindly copy this code. + + +File: gawk.info, Node: Sample Library, Prev: Internals, Up: Dynamic Extensions + +C.3.2 Directory and File Operation Built-ins +-------------------------------------------- + +Two useful functions that are not in `awk' are `chdir' (so that an +`awk' program can change its directory) and `stat' (so that an `awk' +program can gather information about a file). This minor node +implements these functions for `gawk' in an external extension library. + +* Menu: + +* Internal File Description:: What the new functions will do. +* Internal File Ops:: The code for internal file operations. +* Using Internal File Ops:: How to use an external extension. + + +File: gawk.info, Node: Internal File Description, Next: Internal File Ops, Up: Sample Library + +C.3.2.1 Using `chdir' and `stat' +................................ + +This minor node shows how to use the new functions at the `awk' level +once they've been integrated into the running `gawk' interpreter. +Using `chdir' is very straightforward. It takes one argument, the new +directory to change to: + + ... + newdir = "/home/arnold/funstuff" + ret = chdir(newdir) + if (ret < 0) { + printf("could not change to %s: %s\n", + newdir, ERRNO) > "/dev/stderr" + exit 1 + } + ... + + The return value is negative if the `chdir' failed, and `ERRNO' +(*note Built-in Variables::) is set to a string indicating the error. + + Using `stat' is a bit more complicated. The C `stat' function fills +in a structure that has a fair amount of information. The right way to +model this in `awk' is to fill in an associative array with the +appropriate information: + + file = "/home/arnold/.profile" + fdata[1] = "x" # force `fdata' to be an array + ret = stat(file, fdata) + if (ret < 0) { + printf("could not stat %s: %s\n", + file, ERRNO) > "/dev/stderr" + exit 1 + } + printf("size of %s is %d bytes\n", file, fdata["size"]) + + The `stat' function always clears the data array, even if the `stat' +fails. It fills in the following elements: + +`"name"' + The name of the file that was `stat''ed. + +`"dev"' +`"ino"' + The file's device and inode numbers, respectively. + +`"mode"' + The file's mode, as a numeric value. This includes both the file's + type and its permissions. + +`"nlink"' + The number of hard links (directory entries) the file has. + +`"uid"' +`"gid"' + The numeric user and group ID numbers of the file's owner. + +`"size"' + The size in bytes of the file. + +`"blocks"' + The number of disk blocks the file actually occupies. This may not + be a function of the file's size if the file has holes. + +`"atime"' +`"mtime"' +`"ctime"' + The file's last access, modification, and inode update times, + respectively. These are numeric timestamps, suitable for + formatting with `strftime' (*note Built-in::). + +`"pmode"' + The file's "printable mode." This is a string representation of + the file's type and permissions, such as what is produced by `ls + -l'--for example, `"drwxr-xr-x"'. + +`"type"' + A printable string representation of the file's type. The value + is one of the following: + + `"blockdev"' + `"chardev"' + The file is a block or character device ("special file"). + + `"directory"' + The file is a directory. + + `"fifo"' + The file is a named-pipe (also known as a FIFO). + + `"file"' + The file is just a regular file. + + `"socket"' + The file is an `AF_UNIX' ("Unix domain") socket in the + filesystem. + + `"symlink"' + The file is a symbolic link. + + Several additional elements may be present depending upon the +operating system and the type of the file. You can test for them in +your `awk' program by using the `in' operator (*note Reference to +Elements::): + +`"blksize"' + The preferred block size for I/O to the file. This field is not + present on all POSIX-like systems in the C `stat' structure. + +`"linkval"' + If the file is a symbolic link, this element is the name of the + file the link points to (i.e., the value of the link). + +`"rdev"' +`"major"' +`"minor"' + If the file is a block or character device file, then these values + represent the numeric device number and the major and minor + components of that number, respectively. + + +File: gawk.info, Node: Internal File Ops, Next: Using Internal File Ops, Prev: Internal File Description, Up: Sample Library + +C.3.2.2 C Code for `chdir' and `stat' +..................................... + +Here is the C code for these extensions. They were written for +GNU/Linux. The code needs some more work for complete portability to +other POSIX-compliant systems:(1) + + #include "awk.h" + + #include <sys/sysmacros.h> + + /* do_chdir --- provide dynamically loaded + chdir() builtin for gawk */ + + static NODE * + do_chdir(tree) + NODE *tree; + { + NODE *newdir; + int ret = -1; + + if (do_lint && get_curfunc_arg_count() != 1) + lintwarn("chdir: called with incorrect number of arguments"); + + newdir = get_scalar_argument(tree, 0); + + The file includes the `"awk.h"' header file for definitions for the +`gawk' internals. It includes `<sys/sysmacros.h>' for access to the +`major' and `minor' macros. + + By convention, for an `awk' function `foo', the function that +implements it is called `do_foo'. The function should take a `NODE *' +argument, usually called `tree', that represents the argument list to +the function. The `newdir' variable represents the new directory to +change to, retrieved with `get_argument'. Note that the first argument +is numbered zero. + + This code actually accomplishes the `chdir'. It first forces the +argument to be a string and passes the string value to the `chdir' +system call. If the `chdir' fails, `ERRNO' is updated. The result of +`force_string' has to be freed with `free_temp': + + (void) force_string(newdir); + ret = chdir(newdir->stptr); + if (ret < 0) + update_ERRNO(); + free_temp(newdir); + + Finally, the function returns the return value to the `awk' level, +using `set_value'. Then it must return a value from the call to the new +built-in (this value ignored by the interpreter): + + /* Set the return value */ + set_value(tmp_number((AWKNUM) ret)); + + /* Just to make the interpreter happy */ + return tmp_number((AWKNUM) 0); + } + + The `stat' built-in is more involved. First comes a function that +turns a numeric mode into a printable representation (e.g., 644 becomes +`-rw-r--r--'). This is omitted here for brevity: + + /* format_mode --- turn a stat mode field + into something readable */ + + static char * + format_mode(fmode) + unsigned long fmode; + { + ... + } + + Next comes the actual `do_stat' function itself. First come the +variable declarations and argument checking: + + /* do_stat --- provide a stat() function for gawk */ + + static NODE * + do_stat(tree) + NODE *tree; + { + NODE *file, *array; + struct stat sbuf; + int ret; + NODE **aptr; + char *pmode; /* printable mode */ + char *type = "unknown"; + + + if (do_lint && get_curfunc_arg_count() > 2) + lintwarn("stat: called with too many arguments"); + + Then comes the actual work. First, we get the arguments. Then, we +always clear the array. To get the file information, we use `lstat', +in case the file is a symbolic link. If there's an error, we set +`ERRNO' and return: + + /* directory is first arg, array to hold results is second */ + file = get_scalar_argument(tree, 0, FALSE); + array = get_array_argument(tree, 1, FALSE); + + /* empty out the array */ + assoc_clear(array); + + /* lstat the file, if error, set ERRNO and return */ + (void) force_string(file); + ret = lstat(file->stptr, & sbuf); + if (ret < 0) { + update_ERRNO(); + + set_value(tmp_number((AWKNUM) ret)); + + free_temp(file); + return tmp_number((AWKNUM) 0); + } + + Now comes the tedious part: filling in the array. Only a few of the +calls are shown here, since they all follow the same pattern: + + /* fill in the array */ + aptr = assoc_lookup(array, tmp_string("name", 4), FALSE); + *aptr = dupnode(file); + + aptr = assoc_lookup(array, tmp_string("mode", 4), FALSE); + *aptr = make_number((AWKNUM) sbuf.st_mode); + + aptr = assoc_lookup(array, tmp_string("pmode", 5), FALSE); + pmode = format_mode(sbuf.st_mode); + *aptr = make_string(pmode, strlen(pmode)); + + When done, we free the temporary value containing the file name, set +the return value, and return: + + free_temp(file); + + /* Set the return value */ + set_value(tmp_number((AWKNUM) ret)); + + /* Just to make the interpreter happy */ + return tmp_number((AWKNUM) 0); + } + + Finally, it's necessary to provide the "glue" that loads the new +function(s) into `gawk'. By convention, each library has a routine +named `dlload' that does the job: + + /* dlload --- load new builtins in this library */ + + NODE * + dlload(tree, dl) + NODE *tree; + void *dl; + { + make_builtin("chdir", do_chdir, 1); + make_builtin("stat", do_stat, 2); + return tmp_number((AWKNUM) 0); + } + + And that's it! As an exercise, consider adding functions to +implement system calls such as `chown', `chmod', and `umask'. + + ---------- Footnotes ---------- + + (1) This version is edited slightly for presentation. The complete +version can be found in `extension/filefuncs.c' in the `gawk' +distribution. + + +File: gawk.info, Node: Using Internal File Ops, Prev: Internal File Ops, Up: Sample Library + +C.3.2.3 Integrating the Extensions +.................................. + +Now that the code is written, it must be possible to add it at runtime +to the running `gawk' interpreter. First, the code must be compiled. +Assuming that the functions are in a file named `filefuncs.c', and IDIR +is the location of the `gawk' include files, the following steps create +a GNU/Linux shared library: + + $ gcc -shared -DHAVE_CONFIG_H -c -O -g -IIDIR filefuncs.c + $ ld -o filefuncs.so -shared filefuncs.o + + Once the library exists, it is loaded by calling the `extension' +built-in function. This function takes two arguments: the name of the +library to load and the name of a function to call when the library is +first loaded. This function adds the new functions to `gawk'. It +returns the value returned by the initialization function within the +shared library: + + # file testff.awk + BEGIN { + extension("./filefuncs.so", "dlload") + + chdir(".") # no-op + + data[1] = 1 # force `data' to be an array + print "Info for testff.awk" + ret = stat("testff.awk", data) + print "ret =", ret + for (i in data) + printf "data[\"%s\"] = %s\n", i, data[i] + print "testff.awk modified:", + strftime("%m %d %y %H:%M:%S", data["mtime"]) + } + + Here are the results of running the program: + + $ gawk -f testff.awk + -| Info for testff.awk + -| ret = 0 + -| data["blksize"] = 4096 + -| data["mtime"] = 932361936 + -| data["mode"] = 33188 + -| data["type"] = file + -| data["dev"] = 2065 + -| data["gid"] = 10 + -| data["ino"] = 878597 + -| data["ctime"] = 971431797 + -| data["blocks"] = 2 + -| data["nlink"] = 1 + -| data["name"] = testff.awk + -| data["atime"] = 971608519 + -| data["pmode"] = -rw-r--r-- + -| data["size"] = 607 + -| data["uid"] = 2076 + -| testff.awk modified: 07 19 99 08:25:36 + + +File: gawk.info, Node: Future Extensions, Prev: Dynamic Extensions, Up: Notes + +C.4 Probable Future Extensions +============================== + + AWK is a language similar to PERL, only considerably more elegant. + Arnold Robbins + + Hey! + Larry Wall + + This minor node briefly lists extensions and possible improvements +that indicate the directions we are currently considering for `gawk'. +The file `FUTURES' in the `gawk' distribution lists these extensions as +well. + + Following is a list of probable future changes visible at the `awk' +language level: + +Loadable module interface + It is not clear that the `awk'-level interface to the modules + facility is as good as it should be. The interface needs to be + redesigned, particularly taking namespace issues into account, as + well as possibly including issues such as library search path order + and versioning. + +`RECLEN' variable for fixed-length records + Along with `FIELDWIDTHS', this would speed up the processing of + fixed-length records. `PROCINFO["RS"]' would be `"RS"' or + `"RECLEN"', depending upon which kind of record processing is in + effect. + +Additional `printf' specifiers + The 1999 ISO C standard added a number of additional `printf' + format specifiers. These should be evaluated for possible + inclusion in `gawk'. + +Databases + It may be possible to map a GDBM/NDBM/SDBM file into an `awk' + array. + +More `lint' warnings + There are more things that could be checked for portability. + + Following is a list of probable improvements that will make `gawk''s +source code easier to work with: + +Loadable module mechanics + The current extension mechanism works (*note Dynamic Extensions::), + but is rather primitive. It requires a fair amount of manual work + to create and integrate a loadable module. Nor is the current + mechanism as portable as might be desired. The GNU `libtool' + package provides a number of features that would make using + loadable modules much easier. `gawk' should be changed to use + `libtool'. + +Loadable module internals + The API to its internals that `gawk' "exports" should be revised. + Too many things are needlessly exposed. A new API should be + designed and implemented to make module writing easier. + +Better array subscript management + `gawk''s management of array subscript storage could use revamping, + so that using the same value to index multiple arrays only stores + one copy of the index value. + +Integrating the DBUG library + Integrating Fred Fish's DBUG library would be helpful during + development, but it's a lot of work to do. + + Following is a list of probable improvements that will make `gawk' +perform better: + +Compilation of `awk' programs + `gawk' uses a Bison (YACC-like) parser to convert the script given + it into a syntax tree; the syntax tree is then executed by a + simple recursive evaluator. This method incurs a lot of overhead, + since the recursive evaluator performs many procedure calls to do + even the simplest things. + + It should be possible for `gawk' to convert the script's parse tree + into a C program which the user would then compile, using the + normal C compiler and a special `gawk' library to provide all the + needed functions (regexps, fields, associative arrays, type + coercion, and so on). + + An easier possibility might be for an intermediate phase of `gawk' + to convert the parse tree into a linear byte code form like the + one used in GNU Emacs Lisp. The recursive evaluator would then be + replaced by a straight line byte code interpreter that would be + intermediate in speed between running a compiled program and doing + what `gawk' does now. + + Finally, the programs in the test suite could use documenting in +this Info file. + + *Note Additions::, if you are interested in tackling any of these +projects. + + +File: gawk.info, Node: Basic Concepts, Next: Glossary, Prev: Notes, Up: Top + +Appendix D Basic Programming Concepts +************************************* + +This major node attempts to define some of the basic concepts and terms +that are used throughout the rest of this Info file. As this Info file +is specifically about `awk', and not about computer programming in +general, the coverage here is by necessity fairly cursory and +simplistic. (If you need more background, there are many other +introductory texts that you should refer to instead.) + +* Menu: + +* Basic High Level:: The high level view. +* Basic Data Typing:: A very quick intro to data types. +* Floating Point Issues:: Stuff to know about floating-point numbers. + + +File: gawk.info, Node: Basic High Level, Next: Basic Data Typing, Up: Basic Concepts + +D.1 What a Program Does +======================= + +At the most basic level, the job of a program is to process some input +data and produce results. + + _______ + +------+ / \ +---------+ + | Data | -----> < Program > -----> | Results | + +------+ \_______/ +---------+ + + The "program" in the figure can be either a compiled program(1) +(such as `ls'), or it may be "interpreted". In the latter case, a +machine-executable program such as `awk' reads your program, and then +uses the instructions in your program to process the data. + + When you write a program, it usually consists of the following, very +basic set of steps: + + ______ + +----------------+ / More \ No +----------+ + | Initialization | -------> < Data > -------> | Clean Up | + +----------------+ ^ \ ? / +----------+ + | +--+-+ + | | Yes + | | + | V + | +---------+ + +-----+ Process | + +---------+ + +Initialization + These are the things you do before actually starting to process + data, such as checking arguments, initializing any data you need + to work with, and so on. This step corresponds to `awk''s `BEGIN' + rule (*note BEGIN/END::). + + If you were baking a cake, this might consist of laying out all the + mixing bowls and the baking pan, and making sure you have all the + ingredients that you need. + +Processing + This is where the actual work is done. Your program reads data, + one logical chunk at a time, and processes it as appropriate. + + In most programming languages, you have to manually manage the + reading of data, checking to see if there is more each time you + read a chunk. `awk''s pattern-action paradigm (*note Getting + Started::) handles the mechanics of this for you. + + In baking a cake, the processing corresponds to the actual labor: + breaking eggs, mixing the flour, water, and other ingredients, and + then putting the cake into the oven. + +Clean Up + Once you've processed all the data, you may have things you need to + do before exiting. This step corresponds to `awk''s `END' rule + (*note BEGIN/END::). + + After the cake comes out of the oven, you still have to wrap it in + plastic wrap to keep anyone from tasting it, as well as wash the + mixing bowls and utensils. + + An "algorithm" is a detailed set of instructions necessary to +accomplish a task, or process data. It is much the same as a recipe +for baking a cake. Programs implement algorithms. Often, it is up to +you to design the algorithm and implement it, simultaneously. + + The "logical chunks" we talked about previously are called "records", +similar to the records a company keeps on employees, a school keeps for +students, or a doctor keeps for patients. Each record has many +component parts, such as first and last names, date of birth, address, +and so on. The component parts are referred to as the "fields" of the +record. + + The act of reading data is termed "input", and that of generating +results, not too surprisingly, is termed "output". They are often +referred to together as "input/output," and even more often, as "I/O" +for short. (You will also see "input" and "output" used as verbs.) + + `awk' manages the reading of data for you, as well as the breaking +it up into records and fields. Your program's job is to tell `awk' +what to with the data. You do this by describing "patterns" in the +data to look for, and "actions" to execute when those patterns are +seen. This "data-driven" nature of `awk' programs usually makes them +both easier to write and easier to read. + + ---------- Footnotes ---------- + + (1) Compiled programs are typically written in lower-level languages +such as C, C++, Fortran, or Ada, and then translated, or "compiled", +into a form that the computer can execute directly. + + +File: gawk.info, Node: Basic Data Typing, Next: Floating Point Issues, Prev: Basic High Level, Up: Basic Concepts + +D.2 Data Values in a Computer +============================= + +In a program, you keep track of information and values in things called +"variables". A variable is just a name for a given value, such as +`first_name', `last_name', `address', and so on. `awk' has several +predefined variables, and it has special names to refer to the current +input record and the fields of the record. You may also group multiple +associated values under one name, as an array. + + Data, particularly in `awk', consists of either numeric values, such +as 42 or 3.1415927, or string values. String values are essentially +anything that's not a number, such as a name. Strings are sometimes +referred to as "character data", since they store the individual +characters that comprise them. Individual variables, as well as +numeric and string variables, are referred to as "scalar" values. +Groups of values, such as arrays, are not scalars. + + Within computers, there are two kinds of numeric values: "integers" +and "floating-point". In school, integer values were referred to as +"whole" numbers--that is, numbers without any fractional part, such as +1, 42, or -17. The advantage to integer numbers is that they represent +values exactly. The disadvantage is that their range is limited. On +most modern systems, this range is -2,147,483,648 to 2,147,483,647. + + Integer values come in two flavors: "signed" and "unsigned". Signed +values may be negative or positive, with the range of values just +described. Unsigned values are always positive. On most modern +systems, the range is from 0 to 4,294,967,295. + + Floating-point numbers represent what are called "real" numbers; +i.e., those that do have a fractional part, such as 3.1415927. The +advantage to floating-point numbers is that they can represent a much +larger range of values. The disadvantage is that there are numbers +that they cannot represent exactly. `awk' uses "double-precision" +floating-point numbers, which can hold more digits than +"single-precision" floating-point numbers. Floating-point issues are +discussed more fully in *note Floating Point Issues::. + + At the very lowest level, computers store values as groups of binary +digits, or "bits". Modern computers group bits into groups of eight, +called "bytes". Advanced applications sometimes have to manipulate +bits directly, and `gawk' provides functions for doing so. + + While you are probably used to the idea of a number without a value +(i.e., zero), it takes a bit more getting used to the idea of +zero-length character data. Nevertheless, such a thing exists. It is +called the "null string". The null string is character data that has +no value. In other words, it is empty. It is written in `awk' programs +like this: `""'. + + Humans are used to working in decimal; i.e., base 10. In base 10, +numbers go from 0 to 9, and then "roll over" into the next column. +(Remember grade school? 42 is 4 times 10 plus 2.) + + There are other number bases though. Computers commonly use base 2 +or "binary", base 8 or "octal", and base 16 or "hexadecimal". In +binary, each column represents two times the value in the column to its +right. Each column may contain either a 0 or a 1. Thus, binary 1010 +represents 1 times 8, plus 0 times 4, plus 1 times 2, plus 0 times 1, +or decimal 10. Octal and hexadecimal are discussed more in *note +Nondecimal-numbers::. + + Programs are written in programming languages. Hundreds, if not +thousands, of programming languages exist. One of the most popular is +the C programming language. The C language had a very strong influence +on the design of the `awk' language. + + There have been several versions of C. The first is often referred +to as "K&R" C, after the initials of Brian Kernighan and Dennis Ritchie, +the authors of the first book on C. (Dennis Ritchie created the +language, and Brian Kernighan was one of the creators of `awk'.) + + In the mid-1980s, an effort began to produce an international +standard for C. This work culminated in 1989, with the production of +the ANSI standard for C. This standard became an ISO standard in 1990. +Where it makes sense, POSIX `awk' is compatible with 1990 ISO C. + + In 1999, a revised ISO C standard was approved and released. Future +versions of `gawk' will be as compatible as possible with this standard. + + +File: gawk.info, Node: Floating Point Issues, Prev: Basic Data Typing, Up: Basic Concepts + +D.3 Floating-Point Number Caveats +================================= + +As mentioned earlier, floating-point numbers represent what are called +"real" numbers, i.e., those that have a fractional part. `awk' uses +double-precision floating-point numbers to represent all numeric +values. This minor node describes some of the issues involved in using +floating-point numbers. + + There is a very nice paper on floating-point arithmetic by David +Goldberg, "What Every Computer Scientist Should Know About +Floating-point Arithmetic," `ACM Computing Surveys' *23*, 1 (1991-03), +5-48.(1) This is worth reading if you are interested in the details, +but it does require a background in computer science. + +* Menu: + +* String Conversion Precision:: The String Value Can Lie. +* Unexpected Results:: Floating Point Numbers Are Not + Abstract Numbers. +* POSIX Floating Point Problems:: Standards Versus Existing Practice. + + ---------- Footnotes ---------- + + (1) `http://www.validlab.com/goldberg/paper.ps'. + + +File: gawk.info, Node: String Conversion Precision, Next: Unexpected Results, Up: Floating Point Issues + +D.3.1 The String Value Can Lie +------------------------------ + +Internally, `awk' keeps both the numeric value (double-precision +floating-point) and the string value for a variable. Separately, `awk' +keeps track of what type the variable has (*note Typing and +Comparison::), which plays a role in how variables are used in +comparisons. + + It is important to note that the string value for a number may not +reflect the full value (all the digits) that the numeric value actually +contains. The following program (`values.awk') illustrates this: + + { + $1 = $2 + $3 + # see it for what it is + printf("$1 = %.12g\n", $1) + # use CONVFMT + a = "<" $1 ">" + print "a =", a + # use OFMT + print "$1 =", $1 + } + +This program shows the full value of the sum of `$2' and `$3' using +`printf', and then prints the string values obtained from both +automatic conversion (via `CONVFMT') and from printing (via `OFMT'). + + Here is what happens when the program is run: + + $ echo 2 3.654321 1.2345678 | awk -f values.awk + -| $1 = 4.8888888 + -| a = <4.88889> + -| $1 = 4.88889 + + This makes it clear that the full numeric value is different from +what the default string representations show. + + `CONVFMT''s default value is `"%.6g"', which yields a value with at +least six significant digits. For some applications, you might want to +change it to specify more precision. On most modern machines, most of +the time, 17 digits is enough to capture a floating-point number's +value exactly.(1) + + ---------- Footnotes ---------- + + (1) Pathological cases can require up to 752 digits (!), but we +doubt that you need to worry about this. + + +File: gawk.info, Node: Unexpected Results, Next: POSIX Floating Point Problems, Prev: String Conversion Precision, Up: Floating Point Issues + +D.3.2 Floating Point Numbers Are Not Abstract Numbers +----------------------------------------------------- + +Unlike numbers in the abstract sense (such as what you studied in high +school or college math), numbers stored in computers are limited in +certain ways. They cannot represent an infinite number of digits, nor +can they always represent things exactly. In particular, +floating-point numbers cannot always represent values exactly. Here is +an example: + + $ awk '{ printf("%010d\n", $1 * 100) }' + 515.79 + -| 0000051579 + 515.80 + -| 0000051579 + 515.81 + -| 0000051580 + 515.82 + -| 0000051582 + Ctrl-d + +This shows that some values can be represented exactly, whereas others +are only approximated. This is not a "bug" in `awk', but simply an +artifact of how computers represent numbers. + + Another peculiarity of floating-point numbers on modern systems is +that they often have more than one representation for the number zero! +In particular, it is possible to represent "minus zero" as well as +regular, or "positive" zero. + + This example shows that negative and positive zero are distinct +values when stored internally, but that they are in fact equal to each +other, as well as to "regular" zero: + + $ gawk 'BEGIN { mz = -0 ; pz = 0 + > printf "-0 = %g, +0 = %g, (-0 == +0) -> %d\n", mz, pz, mz == pz + > printf "mz == 0 -> %d, pz == 0 -> %d\n", mz == 0, pz == 0 + > }' + -| -0 = -0, +0 = 0, (-0 == +0) -> 1 + -| mz == 0 -> 1, pz == 0 -> 1 + + It helps to keep this in mind should you process numeric data that +contains negative zero values; the fact that the zero is negative is +noted and can affect comparisons. + + +File: gawk.info, Node: POSIX Floating Point Problems, Prev: Unexpected Results, Up: Floating Point Issues + +D.3.3 Standards Versus Existing Practice +---------------------------------------- + +Historically, `awk' has converted any non-numeric looking string to the +numeric value zero, when required. Furthermore, the original +definition of the language and the original POSIX standards specified +that `awk' only understands decimal numbers (base 10), and not octal +(base 8) or hexadecimal numbers (base 16). + + As of this writing (February, 2007), changes in the language of the +current POSIX standard can be interpreted to imply that `awk' should +support additional features. These features are: + + * Interpretation of floating point data values specified in + hexadecimal notation (`0xDEADBEEF'). (Note: data values, _not_ + source code constants.) + + * Support for the special IEEE 754 floating point values "Not A + Number" (NaN), positive Infinity ("inf") and negative Infinity + ("-inf"). In particular, the format for these values is as + specified by the ISO C99 standard, which ignores case and can + allow machine-dependent additional characters after the `nan' and + allow either `inf' or `infinity'. + + The first problem is that both of these are clear changes to +historical practice: + + * The `gawk' maintainer feels that hexadecimal floating point + values, in particular, is ugly, and was never intended by the + original designers to be part of the language. + + * Allowing completely alphabetic strings to have valid numeric + values is also a very severe departure from historical practice. + + The second problem is that the `gawk' maintainer feels that this +interpretation of the standard, which requires a certain amount of +"language lawyering" to arrive at in the first place, was not intended +by the standard developers, either. In other words, "we see how you +got where you are, but we don't think that that's where you want to be." + + Nevertheless, on systems that support IEEE floating point, it seems +reasonable to provide _some_ way to support NaN and Infinity values. +The solution implemented in `gawk', as of version 3.1.6, is as follows: + + 1. With the `--posix' command-line option, `gawk' becomes "hands + off." String values are passed directly to the system library's + `strtod()' function, and if it successfuly returns a numeric value, + that is what's used. By definition, the results are not portable + across different systems.(1) They are also a little surprising: + + $ echo nanny | gawk --posix '{ print $1 + 0 }' + -| nan + $ echo 0xDeadBeef | gawk --posix '{ print $1 + 0 }' + -| 3735928559 + + 2. Without `--posix', `gawk' interprets the four strings `+inf', + `-inf', `+nan', and `-nan' specially, producing the corresponding + special numeric values. The leading sign acts a signal to `gawk' + (and the user) that the value is really numeric. Hexadecimal + floating point is not supported (unless you also use + `--non-decimal-data', which is _not_ recommended). For example: + + $ echo nanny | gawk '{ print $1 + 0 }' + -| 0 + $ echo +nan | gawk '{ print $1 + 0 }' + -| nan + $ echo 0xDeadBeef | gawk '{ print $1 + 0 }' + -| 0 + + `gawk' does ignore case distinction in the four special values. + Thus `+nan' and `+NaN' are the same. + + ---------- Footnotes ---------- + + (1) You asked for it, you got it. + + +File: gawk.info, Node: Glossary, Next: Copying, Prev: Basic Concepts, Up: Top + +Glossary +******** + +Action + A series of `awk' statements attached to a rule. If the rule's + pattern matches an input record, `awk' executes the rule's action. + Actions are always enclosed in curly braces. (*Note Action + Overview::.) + +Amazing `awk' Assembler + Henry Spencer at the University of Toronto wrote a retargetable + assembler completely as `sed' and `awk' scripts. It is thousands + of lines long, including machine descriptions for several eight-bit + microcomputers. It is a good example of a program that would have + been better written in another language. You can get it from + `ftp://ftp.freefriends.org/arnold/Awkstuff/aaa.tgz'. + +Amazingly Workable Formatter (`awf') + Henry Spencer at the University of Toronto wrote a formatter that + accepts a large subset of the `nroff -ms' and `nroff -man' + formatting commands, using `awk' and `sh'. It is available over + the Internet from + `ftp://ftp.freefriends.org/arnold/Awkstuff/awf.tgz'. + +Anchor + The regexp metacharacters `^' and `$', which force the match to + the beginning or end of the string, respectively. + +ANSI + The American National Standards Institute. This organization + produces many standards, among them the standards for the C and + C++ programming languages. These standards often become + international standards as well. See also "ISO." + +Array + A grouping of multiple values under the same name. Most languages + just provide sequential arrays. `awk' provides associative arrays. + +Assertion + A statement in a program that a condition is true at this point in + the program. Useful for reasoning about how a program is supposed + to behave. + +Assignment + An `awk' expression that changes the value of some `awk' variable + or data object. An object that you can assign to is called an + "lvalue". The assigned values are called "rvalues". *Note + Assignment Ops::. + +Associative Array + Arrays in which the indices may be numbers or strings, not just + sequential integers in a fixed range. + +`awk' Language + The language in which `awk' programs are written. + +`awk' Program + An `awk' program consists of a series of "patterns" and "actions", + collectively known as "rules". For each input record given to the + program, the program's rules are all processed in turn. `awk' + programs may also contain function definitions. + +`awk' Script + Another name for an `awk' program. + +Bash + The GNU version of the standard shell (the Bourne-Again SHell). + See also "Bourne Shell." + +BBS + See "Bulletin Board System." + +Bit + Short for "Binary Digit." All values in computer memory + ultimately reduce to binary digits: values that are either zero or + one. Groups of bits may be interpreted differently--as integers, + floating-point numbers, character data, addresses of other memory + objects, or other data. `awk' lets you work with floating-point + numbers and strings. `gawk' lets you manipulate bit values with + the built-in functions described in *note Bitwise Functions::. + + Computers are often defined by how many bits they use to represent + integer values. Typical systems are 32-bit systems, but 64-bit + systems are becoming increasingly popular, and 16-bit systems are + waning in popularity. + +Boolean Expression + Named after the English mathematician Boole. See also "Logical + Expression." + +Bourne Shell + The standard shell (`/bin/sh') on Unix and Unix-like systems, + originally written by Steven R. Bourne. Many shells (`bash', + `ksh', `pdksh', `zsh') are generally upwardly compatible with the + Bourne shell. + +Built-in Function + The `awk' language provides built-in functions that perform various + numerical, I/O-related, and string computations. Examples are + `sqrt' (for the square root of a number) and `substr' (for a + substring of a string). `gawk' provides functions for timestamp + management, bit manipulation, and runtime string translation. + (*Note Built-in::.) + +Built-in Variable + `ARGC', `ARGV', `CONVFMT', `ENVIRON', `FILENAME', `FNR', `FS', + `NF', `NR', `OFMT', `OFS', `ORS', `RLENGTH', `RSTART', `RS', and + `SUBSEP' are the variables that have special meaning to `awk'. In + addition, `ARGIND', `BINMODE', `ERRNO', `FIELDWIDTHS', + `IGNORECASE', `LINT', `PROCINFO', `RT', and `TEXTDOMAIN' are the + variables that have special meaning to `gawk'. Changing some of + them affects `awk''s running environment. (*Note Built-in + Variables::.) + +Braces + See "Curly Braces." + +Bulletin Board System + A computer system allowing users to log in and read and/or leave + messages for other users of the system, much like leaving paper + notes on a bulletin board. + +C + The system programming language that most GNU software is written + in. The `awk' programming language has C-like syntax, and this + Info file points out similarities between `awk' and C when + appropriate. + + In general, `gawk' attempts to be as similar to the 1990 version + of ISO C as makes sense. Future versions of `gawk' may adopt + features from the newer 1999 standard, as appropriate. + +C++ + A popular object-oriented programming language derived from C. + +Character Set + The set of numeric codes used by a computer system to represent the + characters (letters, numbers, punctuation, etc.) of a particular + country or place. The most common character set in use today is + ASCII (American Standard Code for Information Interchange). Many + European countries use an extension of ASCII known as ISO-8859-1 + (ISO Latin-1). + +CHEM + A preprocessor for `pic' that reads descriptions of molecules and + produces `pic' input for drawing them. It was written in `awk' by + Brian Kernighan and Jon Bentley, and is available from + `http://cm.bell-labs.com/netlib/typesetting/chem.gz'. + +Coprocess + A subordinate program with which two-way communications is + possible. + +Compiler + A program that translates human-readable source code into + machine-executable object code. The object code is then executed + directly by the computer. See also "Interpreter." + +Compound Statement + A series of `awk' statements, enclosed in curly braces. Compound + statements may be nested. (*Note Statements::.) + +Concatenation + Concatenating two strings means sticking them together, one after + another, producing a new string. For example, the string `foo' + concatenated with the string `bar' gives the string `foobar'. + (*Note Concatenation::.) + +Conditional Expression + An expression using the `?:' ternary operator, such as `EXPR1 ? + EXPR2 : EXPR3'. The expression EXPR1 is evaluated; if the result + is true, the value of the whole expression is the value of EXPR2; + otherwise the value is EXPR3. In either case, only one of EXPR2 + and EXPR3 is evaluated. (*Note Conditional Exp::.) + +Comparison Expression + A relation that is either true or false, such as `(a < b)'. + Comparison expressions are used in `if', `while', `do', and `for' + statements, and in patterns to select which input records to + process. (*Note Typing and Comparison::.) + +Curly Braces + The characters `{' and `}'. Curly braces are used in `awk' for + delimiting actions, compound statements, and function bodies. + +Dark Corner + An area in the language where specifications often were (or still + are) not clear, leading to unexpected or undesirable behavior. + Such areas are marked in this Info file with "(d.c.)" in the text + and are indexed under the heading "dark corner." + +Data Driven + A description of `awk' programs, where you specify the data you + are interested in processing, and what to do when that data is + seen. + +Data Objects + These are numbers and strings of characters. Numbers are + converted into strings and vice versa, as needed. (*Note + Conversion::.) + +Deadlock + The situation in which two communicating processes are each waiting + for the other to perform an action. + +Double-Precision + An internal representation of numbers that can have fractional + parts. Double-precision numbers keep track of more digits than do + single-precision numbers, but operations on them are sometimes + more expensive. This is the way `awk' stores numeric values. It + is the C type `double'. + +Dynamic Regular Expression + A dynamic regular expression is a regular expression written as an + ordinary expression. It could be a string constant, such as + `"foo"', but it may also be an expression whose value can vary. + (*Note Computed Regexps::.) + +Environment + A collection of strings, of the form NAME`='VAL, that each program + has available to it. Users generally place values into the + environment in order to provide information to various programs. + Typical examples are the environment variables `HOME' and `PATH'. + +Empty String + See "Null String." + +Epoch + The date used as the "beginning of time" for timestamps. Time + values in Unix systems are represented as seconds since the epoch, + with library functions available for converting these values into + standard date and time formats. + + The epoch on Unix and POSIX systems is 1970-01-01 00:00:00 UTC. + See also "GMT" and "UTC." + +Escape Sequences + A special sequence of characters used for describing nonprinting + characters, such as `\n' for newline or `\033' for the ASCII ESC + (Escape) character. (*Note Escape Sequences::.) + +FDL + See "Free Documentation License." + +Field + When `awk' reads an input record, it splits the record into pieces + separated by whitespace (or by a separator regexp that you can + change by setting the built-in variable `FS'). Such pieces are + called fields. If the pieces are of fixed length, you can use the + built-in variable `FIELDWIDTHS' to describe their lengths. (*Note + Field Separators::, and *note Constant Size::.) + +Flag + A variable whose truth value indicates the existence or + nonexistence of some condition. + +Floating-Point Number + Often referred to in mathematical terms as a "rational" or real + number, this is just a number that can have a fractional part. + See also "Double-Precision" and "Single-Precision." + +Format + Format strings are used to control the appearance of output in the + `strftime' and `sprintf' functions, and are used in the `printf' + statement as well. Also, data conversions from numbers to strings + are controlled by the format string contained in the built-in + variable `CONVFMT'. (*Note Control Letters::.) + +Free Documentation License + This document describes the terms under which this Info file is + published and may be copied. (*Note GNU Free Documentation + License::.) + +Function + A specialized group of statements used to encapsulate general or + program-specific tasks. `awk' has a number of built-in functions, + and also allows you to define your own. (*Note Functions::.) + +FSF + See "Free Software Foundation." + +Free Software Foundation + A nonprofit organization dedicated to the production and + distribution of freely distributable software. It was founded by + Richard M. Stallman, the author of the original Emacs editor. GNU + Emacs is the most widely used version of Emacs today. + +`gawk' + The GNU implementation of `awk'. + +General Public License + This document describes the terms under which `gawk' and its source + code may be distributed. (*Note Copying::.) + +GMT + "Greenwich Mean Time." This is the old term for UTC. It is the + time of day used as the epoch for Unix and POSIX systems. See + also "Epoch" and "UTC." + +GNU + "GNU's not Unix". An on-going project of the Free Software + Foundation to create a complete, freely distributable, + POSIX-compliant computing environment. + +GNU/Linux + A variant of the GNU system using the Linux kernel, instead of the + Free Software Foundation's Hurd kernel. Linux is a stable, + efficient, full-featured clone of Unix that has been ported to a + variety of architectures. It is most popular on PC-class systems, + but runs well on a variety of other systems too. The Linux kernel + source code is available under the terms of the GNU General Public + License, which is perhaps its most important aspect. + +GPL + See "General Public License." + +Hexadecimal + Base 16 notation, where the digits are `0'-`9' and `A'-`F', with + `A' representing 10, `B' representing 11, and so on, up to `F' for + 15. Hexadecimal numbers are written in C using a leading `0x', to + indicate their base. Thus, `0x12' is 18 (1 times 16 plus 2). + +I/O + Abbreviation for "Input/Output," the act of moving data into and/or + out of a running program. + +Input Record + A single chunk of data that is read in by `awk'. Usually, an + `awk' input record consists of one line of text. (*Note + Records::.) + +Integer + A whole number, i.e., a number that does not have a fractional + part. + +Internationalization + The process of writing or modifying a program so that it can use + multiple languages without requiring further source code changes. + +Interpreter + A program that reads human-readable source code directly, and uses + the instructions in it to process data and produce results. `awk' + is typically (but not always) implemented as an interpreter. See + also "Compiler." + +Interval Expression + A component of a regular expression that lets you specify repeated + matches of some part of the regexp. Interval expressions were not + traditionally available in `awk' programs. + +ISO + The International Standards Organization. This organization + produces international standards for many things, including + programming languages, such as C and C++. In the computer arena, + important standards like those for C, C++, and POSIX become both + American national and ISO international standards simultaneously. + This Info file refers to Standard C as "ISO C" throughout. + +Keyword + In the `awk' language, a keyword is a word that has special + meaning. Keywords are reserved and may not be used as variable + names. + + `gawk''s keywords are: `BEGIN', `END', `if', `else', `while', + `do...while', `for', `for...in', `break', `continue', `delete', + `next', `nextfile', `function', `func', and `exit'. If `gawk' was + configured with the `--enable-switch' option (*note Switch + Statement::), then `switch', `case', and `default' are also + keywords. + +Lesser General Public License + This document describes the terms under which binary library + archives or shared objects, and their source code may be + distributed. + +Linux + See "GNU/Linux." + +LGPL + See "Lesser General Public License." + +Localization + The process of providing the data necessary for an + internationalized program to work in a particular language. + +Logical Expression + An expression using the operators for logic, AND, OR, and NOT, + written `&&', `||', and `!' in `awk'. Often called Boolean + expressions, after the mathematician who pioneered this kind of + mathematical logic. + +Lvalue + An expression that can appear on the left side of an assignment + operator. In most languages, lvalues can be variables or array + elements. In `awk', a field designator can also be used as an + lvalue. + +Matching + The act of testing a string against a regular expression. If the + regexp describes the contents of the string, it is said to "match" + it. + +Metacharacters + Characters used within a regexp that do not stand for themselves. + Instead, they denote regular expression operations, such as + repetition, grouping, or alternation. + +Null String + A string with no characters in it. It is represented explicitly in + `awk' programs by placing two double quote characters next to each + other (`""'). It can appear in input data by having two successive + occurrences of the field separator appear next to each other. + +Number + A numeric-valued data object. Modern `awk' implementations use + double-precision floating-point to represent numbers. Very old + `awk' implementations use single-precision floating-point. + +Octal + Base-eight notation, where the digits are `0'-`7'. Octal numbers + are written in C using a leading `0', to indicate their base. + Thus, `013' is 11 (one times 8 plus 3). + +P1003.2 + See "POSIX." + +Pattern + Patterns tell `awk' which input records are interesting to which + rules. + + A pattern is an arbitrary conditional expression against which + input is tested. If the condition is satisfied, the pattern is + said to "match" the input record. A typical pattern might compare + the input record against a regular expression. (*Note Pattern + Overview::.) + +POSIX + The name for a series of standards that specify a Portable + Operating System interface. The "IX" denotes the Unix heritage of + these standards. The main standard of interest for `awk' users is + `IEEE Standard for Information Technology, Standard 1003.2-1992, + Portable Operating System Interface (POSIX) Part 2: Shell and + Utilities'. Informally, this standard is often referred to as + simply "P1003.2." + +Precedence + The order in which operations are performed when operators are used + without explicit parentheses. + +Private + Variables and/or functions that are meant for use exclusively by + library functions and not for the main `awk' program. Special care + must be taken when naming such variables and functions. (*Note + Library Names::.) + +Range (of input lines) + A sequence of consecutive lines from the input file(s). A pattern + can specify ranges of input lines for `awk' to process or it can + specify single lines. (*Note Pattern Overview::.) + +Recursion + When a function calls itself, either directly or indirectly. If + this isn't clear, refer to the entry for "recursion." + +Redirection + Redirection means performing input from something other than the + standard input stream, or performing output to something other + than the standard output stream. + + You can redirect the output of the `print' and `printf' statements + to a file or a system command, using the `>', `>>', `|', and `|&' + operators. You can redirect input to the `getline' statement using + the `<', `|', and `|&' operators. (*Note Redirection::, and *note + Getline::.) + +Regexp + Short for "regular expression". A regexp is a pattern that + denotes a set of strings, possibly an infinite set. For example, + the regexp `R.*xp' matches any string starting with the letter `R' + and ending with the letters `xp'. In `awk', regexps are used in + patterns and in conditional expressions. Regexps may contain + escape sequences. (*Note Regexp::.) + +Regular Expression + See "regexp." + +Regular Expression Constant + A regular expression constant is a regular expression written + within slashes, such as `/foo/'. This regular expression is chosen + when you write the `awk' program and cannot be changed during its + execution. (*Note Regexp Usage::.) + +Rule + A segment of an `awk' program that specifies how to process single + input records. A rule consists of a "pattern" and an "action". + `awk' reads an input record; then, for each rule, if the input + record satisfies the rule's pattern, `awk' executes the rule's + action. Otherwise, the rule does nothing for that input record. + +Rvalue + A value that can appear on the right side of an assignment + operator. In `awk', essentially every expression has a value. + These values are rvalues. + +Scalar + A single value, be it a number or a string. Regular variables are + scalars; arrays and functions are not. + +Search Path + In `gawk', a list of directories to search for `awk' program + source files. In the shell, a list of directories to search for + executable programs. + +Seed + The initial value, or starting point, for a sequence of random + numbers. + +`sed' + See "Stream Editor." + +Shell + The command interpreter for Unix and POSIX-compliant systems. The + shell works both interactively, and as a programming language for + batch files, or shell scripts. + +Short-Circuit + The nature of the `awk' logical operators `&&' and `||'. If the + value of the entire expression is determinable from evaluating just + the lefthand side of these operators, the righthand side is not + evaluated. (*Note Boolean Ops::.) + +Side Effect + A side effect occurs when an expression has an effect aside from + merely producing a value. Assignment expressions, increment and + decrement expressions, and function calls have side effects. + (*Note Assignment Ops::.) + +Single-Precision + An internal representation of numbers that can have fractional + parts. Single-precision numbers keep track of fewer digits than + do double-precision numbers, but operations on them are sometimes + less expensive in terms of CPU time. This is the type used by + some very old versions of `awk' to store numeric values. It is + the C type `float'. + +Space + The character generated by hitting the space bar on the keyboard. + +Special File + A file name interpreted internally by `gawk', instead of being + handed directly to the underlying operating system--for example, + `/dev/stderr'. (*Note Special Files::.) + +Stream Editor + A program that reads records from an input stream and processes + them one or more at a time. This is in contrast with batch + programs, which may expect to read their input files in entirety + before starting to do anything, as well as with interactive + programs which require input from the user. + +String + A datum consisting of a sequence of characters, such as `I am a + string'. Constant strings are written with double quotes in the + `awk' language and may contain escape sequences. (*Note Escape + Sequences::.) + +Tab + The character generated by hitting the `TAB' key on the keyboard. + It usually expands to up to eight spaces upon output. + +Text Domain + A unique name that identifies an application. Used for grouping + messages that are translated at runtime into the local language. + +Timestamp + A value in the "seconds since the epoch" format used by Unix and + POSIX systems. Used for the `gawk' functions `mktime', + `strftime', and `systime'. See also "Epoch" and "UTC." + +Unix + A computer operating system originally developed in the early + 1970's at AT&T Bell Laboratories. It initially became popular in + universities around the world and later moved into commercial + environments as a software development system and network server + system. There are many commercial versions of Unix, as well as + several work-alike systems whose source code is freely available + (such as GNU/Linux, NetBSD, FreeBSD, and OpenBSD). + +UTC + The accepted abbreviation for "Universal Coordinated Time." This + is standard time in Greenwich, England, which is used as a + reference time for day and date calculations. See also "Epoch" + and "GMT." + +Whitespace + A sequence of space, TAB, or newline characters occurring inside + an input record or a string. + + +File: gawk.info, Node: Copying, Next: GNU Free Documentation License, Prev: Glossary, Up: Top + +GNU General Public License +************************** + + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. `http://fsf.org/' + + Everyone is permitted to copy and distribute verbatim copies of this + license document, but changing it is not allowed. + +Preamble +======== + +The GNU General Public License is a free, copyleft license for software +and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains +free software for all its users. We, the Free Software Foundation, use +the GNU General Public License for most of our software; it applies +also to any other work released this way by its authors. You can apply +it to your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you +have certain responsibilities if you distribute copies of the software, +or if you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the +manufacturer can do so. This is fundamentally incompatible with the +aim of protecting users' freedom to change the software. The +systematic pattern of such abuse occurs in the area of products for +individuals to use, which is precisely where it is most unacceptable. +Therefore, we have designed this version of the GPL to prohibit the +practice for those products. If such problems arise substantially in +other domains, we stand ready to extend this provision to those domains +in future versions of the GPL, as needed to protect the freedom of +users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + +TERMS AND CONDITIONS +==================== + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public + License. + + "Copyright" also means copyright-like laws that apply to other + kinds of works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this + License. Each licensee is addressed as "you". "Licensees" and + "recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the + work in a fashion requiring copyright permission, other than the + making of an exact copy. The resulting work is called a "modified + version" of the earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work + based on the Program. + + To "propagate" a work means to do anything with it that, without + permission, would make you directly or secondarily liable for + infringement under applicable copyright law, except executing it + on a computer or modifying a private copy. Propagation includes + copying, distribution (with or without modification), making + available to the public, and in some countries other activities as + well. + + To "convey" a work means any kind of propagation that enables other + parties to make or receive copies. Mere interaction with a user + through a computer network, with no transfer of a copy, is not + conveying. + + An interactive user interface displays "Appropriate Legal Notices" + to the extent that it includes a convenient and prominently visible + feature that (1) displays an appropriate copyright notice, and (2) + tells the user that there is no warranty for the work (except to + the extent that warranties are provided), that licensees may + convey the work under this License, and how to view a copy of this + License. If the interface presents a list of user commands or + options, such as a menu, a prominent item in the list meets this + criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work + for making modifications to it. "Object code" means any + non-source form of a work. + + A "Standard Interface" means an interface that either is an + official standard defined by a recognized standards body, or, in + the case of interfaces specified for a particular programming + language, one that is widely used among developers working in that + language. + + The "System Libraries" of an executable work include anything, + other than the work as a whole, that (a) is included in the normal + form of packaging a Major Component, but which is not part of that + Major Component, and (b) serves only to enable use of the work + with that Major Component, or to implement a Standard Interface + for which an implementation is available to the public in source + code form. A "Major Component", in this context, means a major + essential component (kernel, window system, and so on) of the + specific operating system (if any) on which the executable work + runs, or a compiler used to produce the work, or an object code + interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all + the source code needed to generate, install, and (for an executable + work) run the object code and to modify the work, including + scripts to control those activities. However, it does not include + the work's System Libraries, or general-purpose tools or generally + available free programs which are used unmodified in performing + those activities but which are not part of the work. For example, + Corresponding Source includes interface definition files + associated with source files for the work, and the source code for + shared libraries and dynamically linked subprograms that the work + is specifically designed to require, such as by intimate data + communication or control flow between those subprograms and other + parts of the work. + + The Corresponding Source need not include anything that users can + regenerate automatically from other parts of the Corresponding + Source. + + The Corresponding Source for a work in source code form is that + same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of + copyright on the Program, and are irrevocable provided the stated + conditions are met. This License explicitly affirms your unlimited + permission to run the unmodified Program. The output from running + a covered work is covered by this License only if the output, + given its content, constitutes a covered work. This License + acknowledges your rights of fair use or other equivalent, as + provided by copyright law. + + You may make, run and propagate covered works that you do not + convey, without conditions so long as your license otherwise + remains in force. You may convey covered works to others for the + sole purpose of having them make modifications exclusively for + you, or provide you with facilities for running those works, + provided that you comply with the terms of this License in + conveying all material for which you do not control copyright. + Those thus making or running the covered works for you must do so + exclusively on your behalf, under your direction and control, on + terms that prohibit them from making any copies of your + copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under + the conditions stated below. Sublicensing is not allowed; section + 10 makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological + measure under any applicable law fulfilling obligations under + article 11 of the WIPO copyright treaty adopted on 20 December + 1996, or similar laws prohibiting or restricting circumvention of + such measures. + + When you convey a covered work, you waive any legal power to forbid + circumvention of technological measures to the extent such + circumvention is effected by exercising rights under this License + with respect to the covered work, and you disclaim any intention + to limit operation or modification of the work as a means of + enforcing, against the work's users, your or third parties' legal + rights to forbid circumvention of technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you + receive it, in any medium, provided that you conspicuously and + appropriately publish on each copy an appropriate copyright notice; + keep intact all notices stating that this License and any + non-permissive terms added in accord with section 7 apply to the + code; keep intact all notices of the absence of any warranty; and + give all recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, + and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to + produce it from the Program, in the form of source code under the + terms of section 4, provided that you also meet all of these + conditions: + + a. The work must carry prominent notices stating that you + modified it, and giving a relevant date. + + b. The work must carry prominent notices stating that it is + released under this License and any conditions added under + section 7. This requirement modifies the requirement in + section 4 to "keep intact all notices". + + c. You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable + section 7 additional terms, to the whole of the work, and all + its parts, regardless of how they are packaged. This License + gives no permission to license the work in any other way, but + it does not invalidate such permission if you have separately + received it. + + d. If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has + interactive interfaces that do not display Appropriate Legal + Notices, your work need not make them do so. + + A compilation of a covered work with other separate and independent + works, which are not by their nature extensions of the covered + work, and which are not combined with it such as to form a larger + program, in or on a volume of a storage or distribution medium, is + called an "aggregate" if the compilation and its resulting + copyright are not used to limit the access or legal rights of the + compilation's users beyond what the individual works permit. + Inclusion of a covered work in an aggregate does not cause this + License to apply to the other parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms + of sections 4 and 5, provided that you also convey the + machine-readable Corresponding Source under the terms of this + License, in one of these ways: + + a. Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b. Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for + as long as you offer spare parts or customer support for that + product model, to give anyone who possesses the object code + either (1) a copy of the Corresponding Source for all the + software in the product that is covered by this License, on a + durable physical medium customarily used for software + interchange, for a price no more than your reasonable cost of + physically performing this conveying of source, or (2) access + to copy the Corresponding Source from a network server at no + charge. + + c. Convey individual copies of the object code with a copy of + the written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, + and only if you received the object code with such an offer, + in accord with subsection 6b. + + d. Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access + to the Corresponding Source in the same way through the same + place at no further charge. You need not require recipients + to copy the Corresponding Source along with the object code. + If the place to copy the object code is a network server, the + Corresponding Source may be on a different server (operated + by you or a third party) that supports equivalent copying + facilities, provided you maintain clear directions next to + the object code saying where to find the Corresponding Source. + Regardless of what server hosts the Corresponding Source, you + remain obligated to ensure that it is available for as long + as needed to satisfy these requirements. + + e. Convey the object code using peer-to-peer transmission, + provided you inform other peers where the object code and + Corresponding Source of the work are being offered to the + general public at no charge under subsection 6d. + + + A separable portion of the object code, whose source code is + excluded from the Corresponding Source as a System Library, need + not be included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means + any tangible personal property which is normally used for personal, + family, or household purposes, or (2) anything designed or sold for + incorporation into a dwelling. In determining whether a product + is a consumer product, doubtful cases shall be resolved in favor of + coverage. For a particular product received by a particular user, + "normally used" refers to a typical or common use of that class of + product, regardless of the status of the particular user or of the + way in which the particular user actually uses, or expects or is + expected to use, the product. A product is a consumer product + regardless of whether the product has substantial commercial, + industrial or non-consumer uses, unless such uses represent the + only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, + procedures, authorization keys, or other information required to + install and execute modified versions of a covered work in that + User Product from a modified version of its Corresponding Source. + The information must suffice to ensure that the continued + functioning of the modified object code is in no case prevented or + interfered with solely because modification has been made. + + If you convey an object code work under this section in, or with, + or specifically for use in, a User Product, and the conveying + occurs as part of a transaction in which the right of possession + and use of the User Product is transferred to the recipient in + perpetuity or for a fixed term (regardless of how the transaction + is characterized), the Corresponding Source conveyed under this + section must be accompanied by the Installation Information. But + this requirement does not apply if neither you nor any third party + retains the ability to install modified object code on the User + Product (for example, the work has been installed in ROM). + + The requirement to provide Installation Information does not + include a requirement to continue to provide support service, + warranty, or updates for a work that has been modified or + installed by the recipient, or for the User Product in which it + has been modified or installed. Access to a network may be denied + when the modification itself materially and adversely affects the + operation of the network or violates the rules and protocols for + communication across the network. + + Corresponding Source conveyed, and Installation Information + provided, in accord with this section must be in a format that is + publicly documented (and with an implementation available to the + public in source code form), and must require no special password + or key for unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of + this License by making exceptions from one or more of its + conditions. Additional permissions that are applicable to the + entire Program shall be treated as though they were included in + this License, to the extent that they are valid under applicable + law. If additional permissions apply only to part of the Program, + that part may be used separately under those permissions, but the + entire Program remains governed by this License without regard to + the additional permissions. + + When you convey a copy of a covered work, you may at your option + remove any additional permissions from that copy, or from any part + of it. (Additional permissions may be written to require their own + removal in certain cases when you modify the work.) You may place + additional permissions on material, added by you to a covered work, + for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material + you add to a covered work, you may (if authorized by the copyright + holders of that material) supplement the terms of this License + with terms: + + a. Disclaiming warranty or limiting liability differently from + the terms of sections 15 and 16 of this License; or + + b. Requiring preservation of specified reasonable legal notices + or author attributions in that material or in the Appropriate + Legal Notices displayed by works containing it; or + + c. Prohibiting misrepresentation of the origin of that material, + or requiring that modified versions of such material be + marked in reasonable ways as different from the original + version; or + + d. Limiting the use for publicity purposes of names of licensors + or authors of the material; or + + e. Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f. Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified + versions of it) with contractual assumptions of liability to + the recipient, for any liability that these contractual + assumptions directly impose on those licensors and authors. + + All other non-permissive additional terms are considered "further + restrictions" within the meaning of section 10. If the Program as + you received it, or any part of it, contains a notice stating that + it is governed by this License along with a term that is a further + restriction, you may remove that term. If a license document + contains a further restriction but permits relicensing or + conveying under this License, you may add to a covered work + material governed by the terms of that license document, provided + that the further restriction does not survive such relicensing or + conveying. + + If you add terms to a covered work in accord with this section, you + must place, in the relevant source files, a statement of the + additional terms that apply to those files, or a notice indicating + where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in + the form of a separately written license, or stated as exceptions; + the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly + provided under this License. Any attempt otherwise to propagate or + modify it is void, and will automatically terminate your rights + under this License (including any patent licenses granted under + the third paragraph of section 11). + + However, if you cease all violation of this License, then your + license from a particular copyright holder is reinstated (a) + provisionally, unless and until the copyright holder explicitly + and finally terminates your license, and (b) permanently, if the + copyright holder fails to notify you of the violation by some + reasonable means prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is + reinstated permanently if the copyright holder notifies you of the + violation by some reasonable means, this is the first time you have + received notice of violation of this License (for any work) from + that copyright holder, and you cure the violation prior to 30 days + after your receipt of the notice. + + Termination of your rights under this section does not terminate + the licenses of parties who have received copies or rights from + you under this License. If your rights have been terminated and + not permanently reinstated, you do not qualify to receive new + licenses for the same material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or + run a copy of the Program. Ancillary propagation of a covered work + occurring solely as a consequence of using peer-to-peer + transmission to receive a copy likewise does not require + acceptance. However, nothing other than this License grants you + permission to propagate or modify any covered work. These actions + infringe copyright if you do not accept this License. Therefore, + by modifying or propagating a covered work, you indicate your + acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically + receives a license from the original licensors, to run, modify and + propagate that work, subject to this License. You are not + responsible for enforcing compliance by third parties with this + License. + + An "entity transaction" is a transaction transferring control of an + organization, or substantially all assets of one, or subdividing an + organization, or merging organizations. If propagation of a + covered work results from an entity transaction, each party to that + transaction who receives a copy of the work also receives whatever + licenses to the work the party's predecessor in interest had or + could give under the previous paragraph, plus a right to + possession of the Corresponding Source of the work from the + predecessor in interest, if the predecessor has it or can get it + with reasonable efforts. + + You may not impose any further restrictions on the exercise of the + rights granted or affirmed under this License. For example, you + may not impose a license fee, royalty, or other charge for + exercise of rights granted under this License, and you may not + initiate litigation (including a cross-claim or counterclaim in a + lawsuit) alleging that any patent claim is infringed by making, + using, selling, offering for sale, or importing the Program or any + portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this + License of the Program or a work on which the Program is based. + The work thus licensed is called the contributor's "contributor + version". + + A contributor's "essential patent claims" are all patent claims + owned or controlled by the contributor, whether already acquired or + hereafter acquired, that would be infringed by some manner, + permitted by this License, of making, using, or selling its + contributor version, but do not include claims that would be + infringed only as a consequence of further modification of the + contributor version. For purposes of this definition, "control" + includes the right to grant patent sublicenses in a manner + consistent with the requirements of this License. + + Each contributor grants you a non-exclusive, worldwide, + royalty-free patent license under the contributor's essential + patent claims, to make, use, sell, offer for sale, import and + otherwise run, modify and propagate the contents of its + contributor version. + + In the following three paragraphs, a "patent license" is any + express agreement or commitment, however denominated, not to + enforce a patent (such as an express permission to practice a + patent or covenant not to sue for patent infringement). To + "grant" such a patent license to a party means to make such an + agreement or commitment not to enforce a patent against the party. + + If you convey a covered work, knowingly relying on a patent + license, and the Corresponding Source of the work is not available + for anyone to copy, free of charge and under the terms of this + License, through a publicly available network server or other + readily accessible means, then you must either (1) cause the + Corresponding Source to be so available, or (2) arrange to deprive + yourself of the benefit of the patent license for this particular + work, or (3) arrange, in a manner consistent with the requirements + of this License, to extend the patent license to downstream + recipients. "Knowingly relying" means you have actual knowledge + that, but for the patent license, your conveying the covered work + in a country, or your recipient's use of the covered work in a + country, would infringe one or more identifiable patents in that + country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or + arrangement, you convey, or propagate by procuring conveyance of, a + covered work, and grant a patent license to some of the parties + receiving the covered work authorizing them to use, propagate, + modify or convey a specific copy of the covered work, then the + patent license you grant is automatically extended to all + recipients of the covered work and works based on it. + + A patent license is "discriminatory" if it does not include within + the scope of its coverage, prohibits the exercise of, or is + conditioned on the non-exercise of one or more of the rights that + are specifically granted under this License. You may not convey a + covered work if you are a party to an arrangement with a third + party that is in the business of distributing software, under + which you make payment to the third party based on the extent of + your activity of conveying the work, and under which the third + party grants, to any of the parties who would receive the covered + work from you, a discriminatory patent license (a) in connection + with copies of the covered work conveyed by you (or copies made + from those copies), or (b) primarily for and in connection with + specific products or compilations that contain the covered work, + unless you entered into that arrangement, or that patent license + was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting + any implied license or other defenses to infringement that may + otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, + agreement or otherwise) that contradict the conditions of this + License, they do not excuse you from the conditions of this + License. If you cannot convey a covered work so as to satisfy + simultaneously your obligations under this License and any other + pertinent obligations, then as a consequence you may not convey it + at all. For example, if you agree to terms that obligate you to + collect a royalty for further conveying from those to whom you + convey the Program, the only way you could satisfy both those + terms and this License would be to refrain entirely from conveying + the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have + permission to link or combine any covered work with a work licensed + under version 3 of the GNU Affero General Public License into a + single combined work, and to convey the resulting work. The terms + of this License will continue to apply to the part which is the + covered work, but the special requirements of the GNU Affero + General Public License, section 13, concerning interaction through + a network will apply to the combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new + versions of the GNU General Public License from time to time. + Such new versions will be similar in spirit to the present + version, but may differ in detail to address new problems or + concerns. + + Each version is given a distinguishing version number. If the + Program specifies that a certain numbered version of the GNU + General Public License "or any later version" applies to it, you + have the option of following the terms and conditions either of + that numbered version or of any later version published by the + Free Software Foundation. If the Program does not specify a + version number of the GNU General Public License, you may choose + any version ever published by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future + versions of the GNU General Public License can be used, that + proxy's public statement of acceptance of a version permanently + authorizes you to choose that version for the Program. + + Later license versions may give you additional or different + permissions. However, no additional obligations are imposed on any + author or copyright holder as a result of your choosing to follow a + later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY + APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE + COPYRIGHT HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" + WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED, + INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF + MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE + RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. + SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL + NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN + WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES + AND/OR CONVEYS THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU + FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR + CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE + THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA + BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD + PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER + PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF + THE POSSIBILITY OF SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided + above cannot be given local legal effect according to their terms, + reviewing courts shall apply local law that most closely + approximates an absolute waiver of all civil liability in + connection with the Program, unless a warranty or assumption of + liability accompanies a copy of the Program in return for a fee. + + +END OF TERMS AND CONDITIONS +=========================== + +How to Apply These Terms to Your New Programs +============================================= + +If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these +terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least the +"copyright" line and a pointer to where the full notice is found. + + ONE LINE TO GIVE THE PROGRAM'S NAME AND A BRIEF IDEA OF WHAT IT DOES. + Copyright (C) YEAR NAME OF AUTHOR + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or (at + your option) any later version. + + This program is distributed in the hope that it will be useful, but + WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU + General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see `http://www.gnu.org/licenses/'. + + Also add information on how to contact you by electronic and paper +mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + PROGRAM Copyright (C) YEAR NAME OF AUTHOR + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + + The hypothetical commands `show w' and `show c' should show the +appropriate parts of the General Public License. Of course, your +program's commands might be different; for a GUI interface, you would +use an "about box". + + You should also get your employer (if you work as a programmer) or +school, if any, to sign a "copyright disclaimer" for the program, if +necessary. For more information on this, and how to apply and follow +the GNU GPL, see `http://www.gnu.org/licenses/'. + + The GNU General Public License does not permit incorporating your +program into proprietary programs. If your program is a subroutine +library, you may consider it more useful to permit linking proprietary +applications with the library. If this is what you want to do, use the +GNU Lesser General Public License instead of this License. But first, +please read `http://www.gnu.org/philosophy/why-not-lgpl.html'. + + +File: gawk.info, Node: GNU Free Documentation License, Next: Index, Prev: Copying, Up: Top + +GNU Free Documentation License +****************************** + + Version 1.2, November 2002 + + Copyright (C) 2000,2001,2002 Free Software Foundation, Inc. + 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA + + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + 0. PREAMBLE + + The purpose of this License is to make a manual, textbook, or other + functional and useful document "free" in the sense of freedom: to + assure everyone the effective freedom to copy and redistribute it, + with or without modifying it, either commercially or + noncommercially. Secondarily, this License preserves for the + author and publisher a way to get credit for their work, while not + being considered responsible for modifications made by others. + + This License is a kind of "copyleft", which means that derivative + works of the document must themselves be free in the same sense. + It complements the GNU General Public License, which is a copyleft + license designed for free software. + + We have designed this License in order to use it for manuals for + free software, because free software needs free documentation: a + free program should come with manuals providing the same freedoms + that the software does. But this License is not limited to + software manuals; it can be used for any textual work, regardless + of subject matter or whether it is published as a printed book. + We recommend this License principally for works whose purpose is + instruction or reference. + + 1. APPLICABILITY AND DEFINITIONS + + This License applies to any manual or other work, in any medium, + that contains a notice placed by the copyright holder saying it + can be distributed under the terms of this License. Such a notice + grants a world-wide, royalty-free license, unlimited in duration, + to use that work under the conditions stated herein. The + "Document", below, refers to any such manual or work. Any member + of the public is a licensee, and is addressed as "you". You + accept the license if you copy, modify or distribute the work in a + way requiring permission under copyright law. + + A "Modified Version" of the Document means any work containing the + Document or a portion of it, either copied verbatim, or with + modifications and/or translated into another language. + + A "Secondary Section" is a named appendix or a front-matter section + of the Document that deals exclusively with the relationship of the + publishers or authors of the Document to the Document's overall + subject (or to related matters) and contains nothing that could + fall directly within that overall subject. (Thus, if the Document + is in part a textbook of mathematics, a Secondary Section may not + explain any mathematics.) The relationship could be a matter of + historical connection with the subject or with related matters, or + of legal, commercial, philosophical, ethical or political position + regarding them. + + The "Invariant Sections" are certain Secondary Sections whose + titles are designated, as being those of Invariant Sections, in + the notice that says that the Document is released under this + License. If a section does not fit the above definition of + Secondary then it is not allowed to be designated as Invariant. + The Document may contain zero Invariant Sections. If the Document + does not identify any Invariant Sections then there are none. + + The "Cover Texts" are certain short passages of text that are + listed, as Front-Cover Texts or Back-Cover Texts, in the notice + that says that the Document is released under this License. A + Front-Cover Text may be at most 5 words, and a Back-Cover Text may + be at most 25 words. + + A "Transparent" copy of the Document means a machine-readable copy, + represented in a format whose specification is available to the + general public, that is suitable for revising the document + straightforwardly with generic text editors or (for images + composed of pixels) generic paint programs or (for drawings) some + widely available drawing editor, and that is suitable for input to + text formatters or for automatic translation to a variety of + formats suitable for input to text formatters. A copy made in an + otherwise Transparent file format whose markup, or absence of + markup, has been arranged to thwart or discourage subsequent + modification by readers is not Transparent. An image format is + not Transparent if used for any substantial amount of text. A + copy that is not "Transparent" is called "Opaque". + + Examples of suitable formats for Transparent copies include plain + ASCII without markup, Texinfo input format, LaTeX input format, + SGML or XML using a publicly available DTD, and + standard-conforming simple HTML, PostScript or PDF designed for + human modification. Examples of transparent image formats include + PNG, XCF and JPG. Opaque formats include proprietary formats that + can be read and edited only by proprietary word processors, SGML or + XML for which the DTD and/or processing tools are not generally + available, and the machine-generated HTML, PostScript or PDF + produced by some word processors for output purposes only. + + The "Title Page" means, for a printed book, the title page itself, + plus such following pages as are needed to hold, legibly, the + material this License requires to appear in the title page. For + works in formats which do not have any title page as such, "Title + Page" means the text near the most prominent appearance of the + work's title, preceding the beginning of the body of the text. + + A section "Entitled XYZ" means a named subunit of the Document + whose title either is precisely XYZ or contains XYZ in parentheses + following text that translates XYZ in another language. (Here XYZ + stands for a specific section name mentioned below, such as + "Acknowledgements", "Dedications", "Endorsements", or "History".) + To "Preserve the Title" of such a section when you modify the + Document means that it remains a section "Entitled XYZ" according + to this definition. + + The Document may include Warranty Disclaimers next to the notice + which states that this License applies to the Document. These + Warranty Disclaimers are considered to be included by reference in + this License, but only as regards disclaiming warranties: any other + implication that these Warranty Disclaimers may have is void and + has no effect on the meaning of this License. + + 2. VERBATIM COPYING + + You may copy and distribute the Document in any medium, either + commercially or noncommercially, provided that this License, the + copyright notices, and the license notice saying this License + applies to the Document are reproduced in all copies, and that you + add no other conditions whatsoever to those of this License. You + may not use technical measures to obstruct or control the reading + or further copying of the copies you make or distribute. However, + you may accept compensation in exchange for copies. If you + distribute a large enough number of copies you must also follow + the conditions in section 3. + + You may also lend copies, under the same conditions stated above, + and you may publicly display copies. + + 3. COPYING IN QUANTITY + + If you publish printed copies (or copies in media that commonly + have printed covers) of the Document, numbering more than 100, and + the Document's license notice requires Cover Texts, you must + enclose the copies in covers that carry, clearly and legibly, all + these Cover Texts: Front-Cover Texts on the front cover, and + Back-Cover Texts on the back cover. Both covers must also clearly + and legibly identify you as the publisher of these copies. The + front cover must present the full title with all words of the + title equally prominent and visible. You may add other material + on the covers in addition. Copying with changes limited to the + covers, as long as they preserve the title of the Document and + satisfy these conditions, can be treated as verbatim copying in + other respects. + + If the required texts for either cover are too voluminous to fit + legibly, you should put the first ones listed (as many as fit + reasonably) on the actual cover, and continue the rest onto + adjacent pages. + + If you publish or distribute Opaque copies of the Document + numbering more than 100, you must either include a + machine-readable Transparent copy along with each Opaque copy, or + state in or with each Opaque copy a computer-network location from + which the general network-using public has access to download + using public-standard network protocols a complete Transparent + copy of the Document, free of added material. If you use the + latter option, you must take reasonably prudent steps, when you + begin distribution of Opaque copies in quantity, to ensure that + this Transparent copy will remain thus accessible at the stated + location until at least one year after the last time you + distribute an Opaque copy (directly or through your agents or + retailers) of that edition to the public. + + It is requested, but not required, that you contact the authors of + the Document well before redistributing any large number of + copies, to give them a chance to provide you with an updated + version of the Document. + + 4. MODIFICATIONS + + You may copy and distribute a Modified Version of the Document + under the conditions of sections 2 and 3 above, provided that you + release the Modified Version under precisely this License, with + the Modified Version filling the role of the Document, thus + licensing distribution and modification of the Modified Version to + whoever possesses a copy of it. In addition, you must do these + things in the Modified Version: + + A. Use in the Title Page (and on the covers, if any) a title + distinct from that of the Document, and from those of + previous versions (which should, if there were any, be listed + in the History section of the Document). You may use the + same title as a previous version if the original publisher of + that version gives permission. + + B. List on the Title Page, as authors, one or more persons or + entities responsible for authorship of the modifications in + the Modified Version, together with at least five of the + principal authors of the Document (all of its principal + authors, if it has fewer than five), unless they release you + from this requirement. + + C. State on the Title page the name of the publisher of the + Modified Version, as the publisher. + + D. Preserve all the copyright notices of the Document. + + E. Add an appropriate copyright notice for your modifications + adjacent to the other copyright notices. + + F. Include, immediately after the copyright notices, a license + notice giving the public permission to use the Modified + Version under the terms of this License, in the form shown in + the Addendum below. + + G. Preserve in that license notice the full lists of Invariant + Sections and required Cover Texts given in the Document's + license notice. + + H. Include an unaltered copy of this License. + + I. Preserve the section Entitled "History", Preserve its Title, + and add to it an item stating at least the title, year, new + authors, and publisher of the Modified Version as given on + the Title Page. If there is no section Entitled "History" in + the Document, create one stating the title, year, authors, + and publisher of the Document as given on its Title Page, + then add an item describing the Modified Version as stated in + the previous sentence. + + J. Preserve the network location, if any, given in the Document + for public access to a Transparent copy of the Document, and + likewise the network locations given in the Document for + previous versions it was based on. These may be placed in + the "History" section. You may omit a network location for a + work that was published at least four years before the + Document itself, or if the original publisher of the version + it refers to gives permission. + + K. For any section Entitled "Acknowledgements" or "Dedications", + Preserve the Title of the section, and preserve in the + section all the substance and tone of each of the contributor + acknowledgements and/or dedications given therein. + + L. Preserve all the Invariant Sections of the Document, + unaltered in their text and in their titles. Section numbers + or the equivalent are not considered part of the section + titles. + + M. Delete any section Entitled "Endorsements". Such a section + may not be included in the Modified Version. + + N. Do not retitle any existing section to be Entitled + "Endorsements" or to conflict in title with any Invariant + Section. + + O. Preserve any Warranty Disclaimers. + + If the Modified Version includes new front-matter sections or + appendices that qualify as Secondary Sections and contain no + material copied from the Document, you may at your option + designate some or all of these sections as invariant. To do this, + add their titles to the list of Invariant Sections in the Modified + Version's license notice. These titles must be distinct from any + other section titles. + + You may add a section Entitled "Endorsements", provided it contains + nothing but endorsements of your Modified Version by various + parties--for example, statements of peer review or that the text + has been approved by an organization as the authoritative + definition of a standard. + + You may add a passage of up to five words as a Front-Cover Text, + and a passage of up to 25 words as a Back-Cover Text, to the end + of the list of Cover Texts in the Modified Version. Only one + passage of Front-Cover Text and one of Back-Cover Text may be + added by (or through arrangements made by) any one entity. If the + Document already includes a cover text for the same cover, + previously added by you or by arrangement made by the same entity + you are acting on behalf of, you may not add another; but you may + replace the old one, on explicit permission from the previous + publisher that added the old one. + + The author(s) and publisher(s) of the Document do not by this + License give permission to use their names for publicity for or to + assert or imply endorsement of any Modified Version. + + 5. COMBINING DOCUMENTS + + You may combine the Document with other documents released under + this License, under the terms defined in section 4 above for + modified versions, provided that you include in the combination + all of the Invariant Sections of all of the original documents, + unmodified, and list them all as Invariant Sections of your + combined work in its license notice, and that you preserve all + their Warranty Disclaimers. + + The combined work need only contain one copy of this License, and + multiple identical Invariant Sections may be replaced with a single + copy. If there are multiple Invariant Sections with the same name + but different contents, make the title of each such section unique + by adding at the end of it, in parentheses, the name of the + original author or publisher of that section if known, or else a + unique number. Make the same adjustment to the section titles in + the list of Invariant Sections in the license notice of the + combined work. + + In the combination, you must combine any sections Entitled + "History" in the various original documents, forming one section + Entitled "History"; likewise combine any sections Entitled + "Acknowledgements", and any sections Entitled "Dedications". You + must delete all sections Entitled "Endorsements." + + 6. COLLECTIONS OF DOCUMENTS + + You may make a collection consisting of the Document and other + documents released under this License, and replace the individual + copies of this License in the various documents with a single copy + that is included in the collection, provided that you follow the + rules of this License for verbatim copying of each of the + documents in all other respects. + + You may extract a single document from such a collection, and + distribute it individually under this License, provided you insert + a copy of this License into the extracted document, and follow + this License in all other respects regarding verbatim copying of + that document. + + 7. AGGREGATION WITH INDEPENDENT WORKS + + A compilation of the Document or its derivatives with other + separate and independent documents or works, in or on a volume of + a storage or distribution medium, is called an "aggregate" if the + copyright resulting from the compilation is not used to limit the + legal rights of the compilation's users beyond what the individual + works permit. When the Document is included an aggregate, this + License does not apply to the other works in the aggregate which + are not themselves derivative works of the Document. + + If the Cover Text requirement of section 3 is applicable to these + copies of the Document, then if the Document is less than one half + of the entire aggregate, the Document's Cover Texts may be placed + on covers that bracket the Document within the aggregate, or the + electronic equivalent of covers if the Document is in electronic + form. Otherwise they must appear on printed covers that bracket + the whole aggregate. + + 8. TRANSLATION + + Translation is considered a kind of modification, so you may + distribute translations of the Document under the terms of section + 4. Replacing Invariant Sections with translations requires special + permission from their copyright holders, but you may include + translations of some or all Invariant Sections in addition to the + original versions of these Invariant Sections. You may include a + translation of this License, and all the license notices in the + Document, and any Warranty Disclaimers, provided that you also + include the original English version of this License and the + original versions of those notices and disclaimers. In case of a + disagreement between the translation and the original version of + this License or a notice or disclaimer, the original version will + prevail. + + If a section in the Document is Entitled "Acknowledgements", + "Dedications", or "History", the requirement (section 4) to + Preserve its Title (section 1) will typically require changing the + actual title. + + 9. TERMINATION + + You may not copy, modify, sublicense, or distribute the Document + except as expressly provided for under this License. Any other + attempt to copy, modify, sublicense or distribute the Document is + void, and will automatically terminate your rights under this + License. However, parties who have received copies, or rights, + from you under this License will not have their licenses + terminated so long as such parties remain in full compliance. + + 10. FUTURE REVISIONS OF THIS LICENSE + + The Free Software Foundation may publish new, revised versions of + the GNU Free Documentation License from time to time. Such new + versions will be similar in spirit to the present version, but may + differ in detail to address new problems or concerns. See + `http://www.gnu.org/copyleft/'. + + Each version of the License is given a distinguishing version + number. If the Document specifies that a particular numbered + version of this License "or any later version" applies to it, you + have the option of following the terms and conditions either of + that specified version or of any later version that has been + published (not as a draft) by the Free Software Foundation. If + the Document does not specify a version number of this License, + you may choose any version ever published (not as a draft) by the + Free Software Foundation. + +ADDENDUM: How to use this License for your documents +==================================================== + +To use this License in a document you have written, include a copy of +the License in the document and put the following copyright and license +notices just after the title page: + + Copyright (C) YEAR YOUR NAME. + Permission is granted to copy, distribute and/or modify this document + under the terms of the GNU Free Documentation License, Version 1.2 + or any later version published by the Free Software Foundation; + with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts. + A copy of the license is included in the section entitled ``GNU + Free Documentation License''. + + If you have Invariant Sections, Front-Cover Texts and Back-Cover +Texts, replace the "with...Texts." line with this: + + with the Invariant Sections being LIST THEIR TITLES, with + the Front-Cover Texts being LIST, and with the Back-Cover Texts + being LIST. + + If you have Invariant Sections without Cover Texts, or some other +combination of the three, merge those two alternatives to suit the +situation. + + If your document contains nontrivial examples of program code, we +recommend releasing these examples in parallel under your choice of +free software license, such as the GNU General Public License, to +permit their use in free software. + + +File: gawk.info, Node: Index, Prev: GNU Free Documentation License, Up: Top + +Index +***** + + +* Menu: + +* ! (exclamation point), ! operator: Boolean Ops. (line 67) +* ! (exclamation point), ! operator <1>: Egrep Program. (line 160) +* ! (exclamation point), ! operator: Precedence. (line 52) +* ! (exclamation point), != operator <1>: Precedence. (line 65) +* ! (exclamation point), != operator: Comparison Operators. + (line 11) +* ! (exclamation point), !~ operator <1>: Expression Patterns. + (line 24) +* ! (exclamation point), !~ operator <2>: Precedence. (line 81) +* ! (exclamation point), !~ operator <3>: Comparison Operators. + (line 11) +* ! (exclamation point), !~ operator <4>: Regexp Constants. (line 6) +* ! (exclamation point), !~ operator <5>: Computed Regexps. (line 6) +* ! (exclamation point), !~ operator <6>: Case-sensitivity. (line 26) +* ! (exclamation point), !~ operator: Regexp Usage. (line 19) +* ! operator <1>: Egrep Program. (line 168) +* ! operator: Ranges. (line 48) +* " (double quote) <1>: Quoting. (line 33) +* " (double quote): Read Terminal. (line 25) +* " (double quote), regexp constants: Computed Regexps. (line 28) +* # (number sign), #! (executable scripts): Executable Scripts. + (line 6) +* # (number sign), #! (executable scripts), portability issues with: Executable Scripts. + (line 6) +* # (number sign), commenting: Comments. (line 6) +* $ (dollar sign): Regexp Operators. (line 35) +* $ (dollar sign), $ field operator <1>: Precedence. (line 43) +* $ (dollar sign), $ field operator: Fields. (line 19) +* $ (dollar sign), incrementing fields and arrays: Increment Ops. + (line 30) +* $ field operator: Fields. (line 19) +* % (percent sign), % operator: Precedence. (line 55) +* % (percent sign), %= operator <1>: Precedence. (line 96) +* % (percent sign), %= operator: Assignment Ops. (line 129) +* & (ampersand), && operator <1>: Precedence. (line 87) +* & (ampersand), && operator: Boolean Ops. (line 57) +* & (ampersand), gsub/gensub/sub functions and: Gory Details. (line 6) +* ' (single quote) <1>: Quoting. (line 27) +* ' (single quote) <2>: Long. (line 33) +* ' (single quote): One-shot. (line 15) +* ' (single quote), vs. apostrophe: Comments. (line 27) +* ' (single quote), with double quotes: Quoting. (line 49) +* () (parentheses): Regexp Operators. (line 78) +* () (parentheses), pgawk program: Profiling. (line 144) +* * (asterisk), * operator, as multiplication operator: Precedence. + (line 55) +* * (asterisk), * operator, as regexp operator: Regexp Operators. + (line 86) +* * (asterisk), * operator, null strings, matching: Gory Details. + (line 160) +* * (asterisk), ** operator <1>: Options. (line 192) +* * (asterisk), ** operator <2>: Precedence. (line 49) +* * (asterisk), ** operator: Arithmetic Ops. (line 81) +* * (asterisk), **= operator <1>: Options. (line 192) +* * (asterisk), **= operator <2>: Precedence. (line 96) +* * (asterisk), **= operator: Assignment Ops. (line 129) +* * (asterisk), *= operator <1>: Precedence. (line 96) +* * (asterisk), *= operator: Assignment Ops. (line 129) +* + (plus sign): Regexp Operators. (line 101) +* + (plus sign), + operator: Precedence. (line 52) +* + (plus sign), ++ operator <1>: Precedence. (line 46) +* + (plus sign), ++ operator: Increment Ops. (line 40) +* + (plus sign), += operator <1>: Precedence. (line 96) +* + (plus sign), += operator: Assignment Ops. (line 82) +* + (plus sign), decrement/increment operators: Increment Ops. + (line 11) +* , (comma), in range patterns: Ranges. (line 6) +* - (hyphen), - operator: Precedence. (line 52) +* - (hyphen), -- (decrement/increment) operator: Precedence. (line 46) +* - (hyphen), -- operator: Increment Ops. (line 48) +* - (hyphen), -= operator <1>: Precedence. (line 96) +* - (hyphen), -= operator: Assignment Ops. (line 129) +* - (hyphen), filenames beginning with: Options. (line 67) +* - (hyphen), in character lists: Character Lists. (line 17) +* --assign option: Options. (line 30) +* --compat option: Options. (line 79) +* --copyleft option: Options. (line 92) +* --copyright option: Options. (line 87) +* --disable-directories-fatal configuration option: Additional Configuration Options. + (line 37) +* --disable-lint configuration option: Additional Configuration Options. + (line 17) +* --disable-nls configuration option: Additional Configuration Options. + (line 32) +* --dump-variables option <1>: Library Names. (line 45) +* --dump-variables option: Options. (line 95) +* --enable-portals configuration option <1>: Additional Configuration Options. + (line 9) +* --enable-portals configuration option: Portal Files. (line 6) +* --enable-switch configuration option: Additional Configuration Options. + (line 13) +* --exec option: Options. (line 111) +* --field-separator option: Options. (line 21) +* --file option: Options. (line 25) +* --gen-po option <1>: Options. (line 130) +* --gen-po option: String Extraction. (line 6) +* --help option: Options. (line 139) +* --lint option <1>: Options. (line 144) +* --lint option: Command Line. (line 20) +* --lint-old option: Options. (line 163) +* --non-decimal-data option <1>: Options. (line 168) +* --non-decimal-data option: Nondecimal Data. (line 6) +* --non-decimal-data option, strtonum function and: Nondecimal Data. + (line 36) +* --posix option: Options. (line 176) +* --posix option, --traditional option and: Options. (line 206) +* --profile option <1>: Options. (line 212) +* --profile option: Profiling. (line 15) +* --re-interval option: Options. (line 224) +* --source option: Options. (line 231) +* --traditional option: Options. (line 79) +* --traditional option, --posix option and: Options. (line 206) +* --usage option: Options. (line 139) +* --use-lc-numeric option: Options. (line 239) +* --version option: Options. (line 244) +* -f option: Options. (line 25) +* -F option <1>: Options. (line 21) +* -F option: Command Line Field Separator. + (line 6) +* -f option: Long. (line 12) +* -F option, -Ft sets FS to TAB: Options. (line 252) +* -f option, on command line: Options. (line 257) +* -F option, troubleshooting: Known Bugs. (line 6) +* -mf/-mr options: Options. (line 45) +* -v option: Options. (line 30) +* -v option, variables, assigning: Assignment Options. (line 12) +* -W option: Options. (line 55) +* . (period): Regexp Operators. (line 43) +* .mo files: Explaining gettext. (line 39) +* .mo files, converting from .po: I18N Example. (line 62) +* .mo files, specifying directory of <1>: Programmer i18n. (line 45) +* .mo files, specifying directory of: Explaining gettext. (line 51) +* .po files <1>: Translator i18n. (line 6) +* .po files: Explaining gettext. (line 36) +* .po files, converting to .mo: I18N Example. (line 62) +* / (forward slash): Regexp. (line 10) +* / (forward slash), / operator: Precedence. (line 55) +* / (forward slash), /= operator <1>: Precedence. (line 96) +* / (forward slash), /= operator: Assignment Ops. (line 129) +* / (forward slash), /= operator, vs. /=.../ regexp constant: Assignment Ops. + (line 148) +* / (forward slash), patterns and: Expression Patterns. (line 24) +* /= operator vs. /=.../ regexp constant: Assignment Ops. (line 148) +* /dev/... special files (gawk): Special FD. (line 41) +* /inet/ files (gawk): TCP/IP Networking. (line 6) +* /p files (gawk): Portal Files. (line 6) +* ; (semicolon): Statements/Lines. (line 90) +* ; (semicolon), AWKPATH variable and: PC Using. (line 11) +* ; (semicolon), separating statements in actions <1>: Statements. + (line 10) +* ; (semicolon), separating statements in actions: Action Overview. + (line 19) +* < (left angle bracket), < operator <1>: Precedence. (line 65) +* < (left angle bracket), < operator: Comparison Operators. + (line 11) +* < (left angle bracket), < operator (I/O): Getline/File. (line 6) +* < (left angle bracket), <= operator <1>: Precedence. (line 65) +* < (left angle bracket), <= operator: Comparison Operators. + (line 11) +* = (equals sign), = operator: Assignment Ops. (line 6) +* = (equals sign), == operator <1>: Precedence. (line 65) +* = (equals sign), == operator: Comparison Operators. + (line 11) +* > (right angle bracket), > operator <1>: Precedence. (line 65) +* > (right angle bracket), > operator: Comparison Operators. + (line 11) +* > (right angle bracket), > operator (I/O): Redirection. (line 19) +* > (right angle bracket), >= operator <1>: Precedence. (line 65) +* > (right angle bracket), >= operator: Comparison Operators. + (line 11) +* > (right angle bracket), >> operator (I/O) <1>: Precedence. (line 65) +* > (right angle bracket), >> operator (I/O): Redirection. (line 47) +* ? (question mark) <1>: GNU Regexp Operators. + (line 51) +* ? (question mark): Regexp Operators. (line 110) +* ? (question mark), ?: operator: Precedence. (line 93) +* [] (square brackets): Regexp Operators. (line 55) +* \ (backslash) <1>: Regexp Operators. (line 18) +* \ (backslash) <2>: Quoting. (line 27) +* \ (backslash) <3>: Comments. (line 50) +* \ (backslash): Read Terminal. (line 25) +* \ (backslash), \" escape sequence: Escape Sequences. (line 76) +* \ (backslash), \' operator (gawk): GNU Regexp Operators. + (line 48) +* \ (backslash), \/ escape sequence: Escape Sequences. (line 69) +* \ (backslash), \< operator (gawk): GNU Regexp Operators. + (line 22) +* \ (backslash), \> operator (gawk): GNU Regexp Operators. + (line 26) +* \ (backslash), \` operator (gawk): GNU Regexp Operators. + (line 46) +* \ (backslash), \a escape sequence: Escape Sequences. (line 34) +* \ (backslash), \b escape sequence: Escape Sequences. (line 38) +* \ (backslash), \B operator (gawk): GNU Regexp Operators. + (line 35) +* \ (backslash), \f escape sequence: Escape Sequences. (line 41) +* \ (backslash), \n escape sequence: Escape Sequences. (line 44) +* \ (backslash), \NNN escape sequence: Escape Sequences. (line 56) +* \ (backslash), \r escape sequence: Escape Sequences. (line 47) +* \ (backslash), \t escape sequence: Escape Sequences. (line 50) +* \ (backslash), \v escape sequence: Escape Sequences. (line 53) +* \ (backslash), \W operator (gawk): GNU Regexp Operators. + (line 18) +* \ (backslash), \w operator (gawk): GNU Regexp Operators. + (line 13) +* \ (backslash), \x escape sequence: Escape Sequences. (line 61) +* \ (backslash), \y operator (gawk): GNU Regexp Operators. + (line 30) +* \ (backslash), as field separators: Command Line Field Separator. + (line 27) +* \ (backslash), continuing lines and <1>: Egrep Program. (line 218) +* \ (backslash), continuing lines and: Statements/Lines. (line 19) +* \ (backslash), continuing lines and, comments and: Statements/Lines. + (line 75) +* \ (backslash), continuing lines and, in csh <1>: Statements/Lines. + (line 44) +* \ (backslash), continuing lines and, in csh: More Complex. (line 15) +* \ (backslash), gsub/gensub/sub functions and: Gory Details. (line 6) +* \ (backslash), in character lists: Character Lists. (line 17) +* \ (backslash), in escape sequences: Escape Sequences. (line 6) +* \ (backslash), in escape sequences, POSIX and: Escape Sequences. + (line 113) +* \ (backslash), regexp constants: Computed Regexps. (line 28) +* ^ (caret) <1>: GNU Regexp Operators. + (line 51) +* ^ (caret): Regexp Operators. (line 22) +* ^ (caret), ^ operator <1>: Options. (line 192) +* ^ (caret), ^ operator: Precedence. (line 49) +* ^ (caret), ^= operator <1>: Options. (line 192) +* ^ (caret), ^= operator <2>: Precedence. (line 96) +* ^ (caret), ^= operator: Assignment Ops. (line 129) +* ^ (caret), in character lists: Character Lists. (line 17) +* _ (underscore), _ C macro: Explaining gettext. (line 68) +* _ (underscore), in names of private variables: Library Names. + (line 29) +* _ (underscore), translatable string: Programmer i18n. (line 67) +* _gr_init user-defined function: Group Functions. (line 80) +* _pw_init user-defined function: Passwd Functions. (line 91) +* accessing fields: Fields. (line 6) +* account information <1>: Group Functions. (line 6) +* account information: Passwd Functions. (line 16) +* actions: Action Overview. (line 6) +* actions, control statements in: Statements. (line 6) +* actions, default: Very Simple. (line 34) +* actions, empty: Very Simple. (line 39) +* adding, features to gawk: Adding Code. (line 6) +* adding, fields: Changing Fields. (line 53) +* adding, functions to gawk: Dynamic Extensions. (line 10) +* advanced features, buffering: I/O Functions. (line 95) +* advanced features, close function: Close Files And Pipes. + (line 130) +* advanced features, constants, values of: Nondecimal-numbers. + (line 67) +* advanced features, data files as single record: Records. (line 170) +* advanced features, fixed-width data: Constant Size. (line 9) +* advanced features, FNR/NR variables: Auto-set. (line 187) +* advanced features, gawk: Advanced Features. (line 6) +* advanced features, gawk, BSD portals: Portal Files. (line 6) +* advanced features, gawk, network programming: TCP/IP Networking. + (line 6) +* advanced features, gawk, nondecimal input data: Nondecimal Data. + (line 6) +* advanced features, gawk, processes, communicating with: Two-way I/O. + (line 23) +* advanced features, network connections, See Also networks, connections: Advanced Features. + (line 6) +* advanced features, null strings, matching: Gory Details. (line 160) +* advanced features, operators, precedence: Increment Ops. (line 61) +* advanced features, piping into sh: Redirection. (line 140) +* advanced features, regexp constants: Assignment Ops. (line 148) +* Aho, Alfred <1>: Contributors. (line 12) +* Aho, Alfred: History. (line 17) +* alarm clock example program: Alarm Program. (line 9) +* alarm.awk program: Alarm Program. (line 27) +* algorithms: Basic High Level. (line 66) +* Alpha (DEC): Manual History. (line 28) +* amazing awk assembler (aaa): Glossary. (line 12) +* amazingly workable formatter (awf): Glossary. (line 20) +* ambiguity, syntactic: /= operator vs. /=.../ regexp constant: Assignment Ops. + (line 148) +* amiga: Amiga Installation. (line 6) +* ampersand (&), && operator: Boolean Ops. (line 57) +* ampersand (&), &&operator: Precedence. (line 87) +* ampersand (&), gsub/gensub/sub functions and: Gory Details. (line 6) +* AND bitwise operation: Bitwise Functions. (line 6) +* and Boolean-logic operator: Boolean Ops. (line 6) +* and function (gawk): Bitwise Functions. (line 39) +* ANSI: Glossary. (line 31) +* archeologists: Bugs. (line 6) +* ARGC/ARGV variables <1>: ARGC and ARGV. (line 6) +* ARGC/ARGV variables: Auto-set. (line 11) +* ARGC/ARGV variables, command-line arguments: Other Arguments. + (line 12) +* ARGC/ARGV variables, portability and: Executable Scripts. (line 43) +* ARGIND variable: Auto-set. (line 40) +* ARGIND variable, command-line arguments: Other Arguments. (line 12) +* arguments, command-line <1>: Other Arguments. (line 6) +* arguments, command-line <2>: ARGC and ARGV. (line 6) +* arguments, command-line: Auto-set. (line 11) +* arguments, command-line, invoking awk: Command Line. (line 6) +* arguments, in function calls: Function Calls. (line 16) +* arguments, processing: Getopt Function. (line 6) +* arguments, retrieving: Internals. (line 121) +* arithmetic operators: Arithmetic Ops. (line 6) +* arrays: Arrays. (line 6) +* arrays, as parameters to functions: Function Caveats. (line 55) +* arrays, associative: Array Intro. (line 45) +* arrays, associative, clearing: Internals. (line 66) +* arrays, associative, library functions and: Library Names. (line 57) +* arrays, deleting entire contents: Delete. (line 39) +* arrays, elements, assigning: Assigning Elements. (line 6) +* arrays, elements, deleting: Delete. (line 6) +* arrays, elements, installing: Internals. (line 70) +* arrays, elements, order of: Scanning an Array. (line 47) +* arrays, elements, referencing: Reference to Elements. + (line 6) +* arrays, elements, retrieving number of: String Functions. (line 18) +* arrays, for statement and: Scanning an Array. (line 20) +* arrays, IGNORECASE variable and: Array Intro. (line 87) +* arrays, indexing: Array Intro. (line 45) +* arrays, merging into strings: Join Function. (line 6) +* arrays, multidimensional: Multi-dimensional. (line 6) +* arrays, multidimensional, scanning: Multi-scanning. (line 11) +* arrays, names of: Arrays. (line 17) +* arrays, scanning: Scanning an Array. (line 6) +* arrays, sorting: Array Sorting. (line 6) +* arrays, sorting, IGNORECASE variable and: Array Sorting. (line 86) +* arrays, sparse: Array Intro. (line 66) +* arrays, subscripts: Numeric Array Subscripts. + (line 6) +* arrays, subscripts, uninitialized variables as: Uninitialized Subscripts. + (line 6) +* artificial intelligence, gawk and: Distribution contents. + (line 47) +* ASCII: Ordinal Functions. (line 44) +* asort function (gawk) <1>: String Functions. (line 18) +* asort function (gawk): Array Sorting. (line 6) +* asort function (gawk), arrays, sorting: Array Sorting. (line 6) +* asorti function (gawk): String Functions. (line 47) +* assert function (C library): Assert Function. (line 6) +* assert user-defined function: Assert Function. (line 28) +* assertions: Assert Function. (line 6) +* assignment operators: Assignment Ops. (line 6) +* assignment operators, evaluation order: Assignment Ops. (line 111) +* assignment operators, lvalues/rvalues: Assignment Ops. (line 32) +* assignments as filenames: Ignoring Assigns. (line 6) +* assoc_clear internal function: Internals. (line 66) +* assoc_lookup internal function: Internals. (line 70) +* associative arrays: Array Intro. (line 45) +* asterisk (*), * operator, as multiplication operator: Precedence. + (line 55) +* asterisk (*), * operator, as regexp operator: Regexp Operators. + (line 86) +* asterisk (*), * operator, null strings, matching: Gory Details. + (line 160) +* asterisk (*), ** operator <1>: Options. (line 192) +* asterisk (*), ** operator <2>: Precedence. (line 49) +* asterisk (*), ** operator: Arithmetic Ops. (line 81) +* asterisk (*), **= operator <1>: Options. (line 192) +* asterisk (*), **= operator <2>: Precedence. (line 96) +* asterisk (*), **= operator: Assignment Ops. (line 129) +* asterisk (*), *= operator <1>: Precedence. (line 96) +* asterisk (*), *= operator: Assignment Ops. (line 129) +* atan2 function: Numeric Functions. (line 37) +* atari: Atari Installation. (line 9) +* awf (amazingly workable formatter) program: Glossary. (line 20) +* awk language, POSIX version: Assignment Ops. (line 136) +* awk programs <1>: Two Rules. (line 6) +* awk programs <2>: Executable Scripts. (line 6) +* awk programs: Getting Started. (line 12) +* awk programs, complex: When. (line 30) +* awk programs, documenting <1>: Library Names. (line 6) +* awk programs, documenting: Comments. (line 6) +* awk programs, examples of: Sample Programs. (line 6) +* awk programs, execution of: Next Statement. (line 16) +* awk programs, internationalizing <1>: Programmer i18n. (line 6) +* awk programs, internationalizing: I18N Functions. (line 6) +* awk programs, lengthy: Long. (line 6) +* awk programs, lengthy, assertions: Assert Function. (line 6) +* awk programs, location of: Options. (line 25) +* awk programs, one-line examples: Very Simple. (line 45) +* awk programs, profiling: Profiling. (line 6) +* awk programs, profiling, enabling: Options. (line 212) +* awk programs, running <1>: Long. (line 6) +* awk programs, running: Running gawk. (line 6) +* awk programs, running, from shell scripts: One-shot. (line 22) +* awk programs, running, without input files: Read Terminal. (line 17) +* awk programs, shell variables in: Using Shell Variables. + (line 6) +* awk, function of: Getting Started. (line 6) +* awk, gawk and <1>: This Manual. (line 13) +* awk, gawk and: Preface. (line 22) +* awk, history of: History. (line 17) +* awk, implementation issues, pipes: Redirection. (line 132) +* awk, implementations: Other Versions. (line 6) +* awk, implementations, limits: Getline Notes. (line 14) +* awk, invoking: Command Line. (line 6) +* awk, new vs. old: Names. (line 6) +* awk, new vs. old, OFMT variable: Conversion. (line 54) +* awk, POSIX and: Preface. (line 22) +* awk, POSIX and, See Also POSIX awk: Preface. (line 22) +* awk, regexp constants and: Comparison Operators. + (line 102) +* awk, See Also gawk: Preface. (line 35) +* awk, terms describing: This Manual. (line 6) +* awk, uses for <1>: When. (line 6) +* awk, uses for <2>: Getting Started. (line 12) +* awk, uses for: Preface. (line 22) +* awk, versions of <1>: V7/SVR3.1. (line 6) +* awk, versions of: Names. (line 10) +* awk, versions of, changes between SVR3.1 and SVR4: SVR4. (line 6) +* awk, versions of, changes between SVR4 and POSIX awk: POSIX. + (line 6) +* awk, versions of, changes between V7 and SVR3.1: V7/SVR3.1. (line 6) +* awk, versions of, See Also Bell Laboratories awk: BTL. (line 6) +* awk.h file (internal): Internals. (line 15) +* awka compiler for awk: Other Versions. (line 76) +* AWKNUM internal type: Internals. (line 19) +* AWKPATH environment variable <1>: PC Using. (line 11) +* AWKPATH environment variable: AWKPATH Variable. (line 6) +* awkprof.out file: Profiling. (line 10) +* awksed.awk program: Simple Sed. (line 25) +* awkvars.out file: Options. (line 95) +* backslash (\) <1>: Regexp Operators. (line 18) +* backslash (\) <2>: Quoting. (line 27) +* backslash (\) <3>: Comments. (line 50) +* backslash (\): Read Terminal. (line 25) +* backslash (\), \" escape sequence: Escape Sequences. (line 76) +* backslash (\), \' operator (gawk): GNU Regexp Operators. + (line 48) +* backslash (\), \/ escape sequence: Escape Sequences. (line 69) +* backslash (\), \< operator (gawk): GNU Regexp Operators. + (line 22) +* backslash (\), \> operator (gawk): GNU Regexp Operators. + (line 26) +* backslash (\), \` operator (gawk): GNU Regexp Operators. + (line 46) +* backslash (\), \a escape sequence: Escape Sequences. (line 34) +* backslash (\), \b escape sequence: Escape Sequences. (line 38) +* backslash (\), \B operator (gawk): GNU Regexp Operators. + (line 35) +* backslash (\), \f escape sequence: Escape Sequences. (line 41) +* backslash (\), \n escape sequence: Escape Sequences. (line 44) +* backslash (\), \NNN escape sequence: Escape Sequences. (line 56) +* backslash (\), \r escape sequence: Escape Sequences. (line 47) +* backslash (\), \t escape sequence: Escape Sequences. (line 50) +* backslash (\), \v escape sequence: Escape Sequences. (line 53) +* backslash (\), \W operator (gawk): GNU Regexp Operators. + (line 18) +* backslash (\), \w operator (gawk): GNU Regexp Operators. + (line 13) +* backslash (\), \x escape sequence: Escape Sequences. (line 61) +* backslash (\), \y operator (gawk): GNU Regexp Operators. + (line 30) +* backslash (\), as field separators: Command Line Field Separator. + (line 27) +* backslash (\), continuing lines and <1>: Egrep Program. (line 218) +* backslash (\), continuing lines and: Statements/Lines. (line 19) +* backslash (\), continuing lines and, comments and: Statements/Lines. + (line 75) +* backslash (\), continuing lines and, in csh <1>: Statements/Lines. + (line 44) +* backslash (\), continuing lines and, in csh: More Complex. (line 15) +* backslash (\), gsub/gensub/sub functions and: Gory Details. (line 6) +* backslash (\), in character lists: Character Lists. (line 17) +* backslash (\), in escape sequences: Escape Sequences. (line 6) +* backslash (\), in escape sequences, POSIX and: Escape Sequences. + (line 113) +* backslash (\), regexp constants: Computed Regexps. (line 28) +* BBS-list file: Sample Data Files. (line 6) +* Beebe, Nelson: Acknowledgments. (line 53) +* Beebe, Nelson H.F.: Other Versions. (line 88) +* BEGIN pattern <1>: BEGIN/END. (line 6) +* BEGIN pattern <2>: Field Separators. (line 43) +* BEGIN pattern: Records. (line 29) +* BEGIN pattern, assert user-defined function and: Assert Function. + (line 82) +* BEGIN pattern, Boolean patterns and: Expression Patterns. (line 73) +* BEGIN pattern, exit statement and: Exit Statement. (line 12) +* BEGIN pattern, getline and: Getline Notes. (line 19) +* BEGIN pattern, headings, adding: Print Examples. (line 43) +* BEGIN pattern, next/nextfile statements and <1>: Next Statement. + (line 39) +* BEGIN pattern, next/nextfile statements and: I/O And BEGIN/END. + (line 36) +* BEGIN pattern, OFS/ORS variables, assigning values to: Output Separators. + (line 20) +* BEGIN pattern, operators and: Using BEGIN/END. (line 17) +* BEGIN pattern, pgawk program: Profiling. (line 69) +* BEGIN pattern, print statement and: I/O And BEGIN/END. (line 16) +* BEGIN pattern, pwcat program: Passwd Functions. (line 125) +* BEGIN pattern, running awk programs and: Cut Program. (line 66) +* BEGIN pattern, TEXTDOMAIN variable and: Programmer i18n. (line 58) +* beginfile user-defined function: Filetrans Function. (line 60) +* Bell Laboratories awk extensions: BTL. (line 6) +* Benzinger, Michael: Contributors. (line 86) +* BeOS: BeOS Installation. (line 6) +* Berry, Karl: Acknowledgments. (line 30) +* binary input/output: User-modified. (line 10) +* bindtextdomain function (C library): Explaining gettext. (line 47) +* bindtextdomain function (gawk) <1>: Programmer i18n. (line 45) +* bindtextdomain function (gawk): I18N Functions. (line 26) +* bindtextdomain function (gawk), portability and: I18N Portability. + (line 32) +* BINMODE variable <1>: PC Using. (line 40) +* BINMODE variable: User-modified. (line 10) +* bits2str user-defined function: Bitwise Functions. (line 60) +* bitwise, complement: Bitwise Functions. (line 25) +* bitwise, operations: Bitwise Functions. (line 6) +* bitwise, shift: Bitwise Functions. (line 32) +* body, in actions: Statements. (line 10) +* body, in loops: While Statement. (line 14) +* Boolean expressions: Boolean Ops. (line 6) +* Boolean expressions, as patterns: Expression Patterns. (line 41) +* Boolean operators, See Boolean expressions: Boolean Ops. (line 6) +* Bourne shell, quoting rules for: Quoting. (line 14) +* braces ({}), actions and: Action Overview. (line 19) +* braces ({}), pgawk program: Profiling. (line 140) +* braces ({}), statements, grouping: Statements. (line 10) +* bracket expressions, See character lists: Regexp Operators. (line 55) +* break statement: Break Statement. (line 6) +* Brennan, Michael <1>: Other Versions. (line 6) +* Brennan, Michael <2>: Simple Sed. (line 25) +* Brennan, Michael <3>: Two-way I/O. (line 6) +* Brennan, Michael: Delete. (line 51) +* Broder, Alan J.: Contributors. (line 77) +* Brown, Martin <1>: Bugs. (line 57) +* Brown, Martin <2>: Contributors. (line 72) +* Brown, Martin: Acknowledgments. (line 53) +* BSD portals: Portal Files. (line 6) +* BSD-based operating systems: Glossary. (line 582) +* Buening, Andreas <1>: Contributors. (line 81) +* Buening, Andreas: Acknowledgments. (line 53) +* buffering, input/output <1>: Two-way I/O. (line 71) +* buffering, input/output: I/O Functions. (line 127) +* buffering, interactive vs. noninteractive: I/O Functions. (line 95) +* buffers, flushing: I/O Functions. (line 29) +* buffers, operators for: GNU Regexp Operators. + (line 40) +* bug reports, email address, bug-gawk@gnu.org: Bugs. (line 27) +* bug-gawk@gnu.org bug reporting address: Bugs. (line 27) +* built-in functions: Functions. (line 6) +* built-in functions, evaluation order: Calling Built-in. (line 30) +* built-in variables: Built-in Variables. (line 6) +* built-in variables, -v option, setting with: Options. (line 38) +* built-in variables, conveying information: Auto-set. (line 6) +* built-in variables, user-modifiable: User-modified. (line 6) +* call by reference: Function Caveats. (line 55) +* call by value: Function Caveats. (line 26) +* caret (^) <1>: GNU Regexp Operators. + (line 51) +* caret (^): Regexp Operators. (line 22) +* caret (^), ^ operator <1>: Options. (line 192) +* caret (^), ^ operator: Precedence. (line 49) +* caret (^), ^= operator <1>: Options. (line 192) +* caret (^), ^= operator <2>: Precedence. (line 96) +* caret (^), ^= operator: Assignment Ops. (line 129) +* caret (^), in character lists: Character Lists. (line 17) +* case keyword: Switch Statement. (line 6) +* case sensitivity, array indices and: Array Intro. (line 87) +* case sensitivity, converting case: String Functions. (line 453) +* case sensitivity, example programs: Library Functions. (line 43) +* case sensitivity, gawk: Case-sensitivity. (line 26) +* case sensitivity, regexps and <1>: User-modified. (line 68) +* case sensitivity, regexps and: Case-sensitivity. (line 6) +* case sensitivity, string comparisons and: User-modified. (line 68) +* CGI, awk scripts for: Options. (line 111) +* character encodings: Ordinal Functions. (line 44) +* character lists <1>: Character Lists. (line 6) +* character lists: Regexp Operators. (line 55) +* character lists, character classes: Character Lists. (line 30) +* character lists, collating elements: Character Lists. (line 71) +* character lists, collating symbols: Character Lists. (line 78) +* character lists, complemented: Regexp Operators. (line 62) +* character lists, equivalence classes: Character Lists. (line 84) +* character lists, non-ASCII: Character Lists. (line 71) +* character lists, range expressions: Character Lists. (line 6) +* character sets: Ordinal Functions. (line 44) +* character sets (machine character encodings): Glossary. (line 138) +* character sets, See Also character lists: Regexp Operators. (line 55) +* characters, counting: Wc Program. (line 6) +* characters, transliterating: Translate Program. (line 6) +* characters, values of as numbers: Ordinal Functions. (line 6) +* Chassell, Robert J.: Acknowledgments. (line 30) +* chdir function, implementing in gawk: Sample Library. (line 6) +* chem utility: Glossary. (line 146) +* chr user-defined function: Ordinal Functions. (line 16) +* Cliff random numbers: Cliff Random Function. + (line 6) +* cliff_rand user-defined function: Cliff Random Function. + (line 11) +* close function <1>: I/O Functions. (line 10) +* close function <2>: Close Files And Pipes. + (line 18) +* close function <3>: Getline/Pipe. (line 24) +* close function: Getline/Variable/File. + (line 30) +* close function, return values: Close Files And Pipes. + (line 130) +* close function, two-way pipes and: Two-way I/O. (line 78) +* Close, Diane <1>: Contributors. (line 21) +* Close, Diane: Manual History. (line 40) +* close_func input method: Internals. (line 178) +* collating elements: Character Lists. (line 71) +* collating symbols: Character Lists. (line 78) +* columns, aligning: Print Examples. (line 70) +* columns, cutting: Cut Program. (line 6) +* comma (,), in range patterns: Ranges. (line 6) +* command line, arguments <1>: Other Arguments. (line 6) +* command line, arguments <2>: ARGC and ARGV. (line 6) +* command line, arguments: Auto-set. (line 11) +* command line, formats: Running gawk. (line 12) +* command line, FS on, setting: Command Line Field Separator. + (line 6) +* command line, invoking awk from: Command Line. (line 6) +* command line, options <1>: Options. (line 6) +* command line, options <2>: Command Line Field Separator. + (line 6) +* command line, options: Long. (line 12) +* command line, options, end of: Options. (line 62) +* command line, variables, assigning on: Assignment Options. (line 6) +* command-line options, processing: Getopt Function. (line 6) +* command-line options, string extraction: String Extraction. (line 6) +* commenting: Comments. (line 6) +* commenting, backslash continuation and: Statements/Lines. (line 75) +* comp.lang.awk newsgroup: Bugs. (line 37) +* comparison expressions: Typing and Comparison. + (line 9) +* comparison expressions, as patterns: Expression Patterns. (line 14) +* comparison expressions, string vs. regexp: Comparison Operators. + (line 79) +* compatibility mode (gawk), extensions: POSIX/GNU. (line 6) +* compatibility mode (gawk), file names: Special Caveats. (line 9) +* compatibility mode (gawk), hexadecimal numbers: Nondecimal-numbers. + (line 60) +* compatibility mode (gawk), octal numbers: Nondecimal-numbers. + (line 60) +* compatibility mode (gawk), specifying: Options. (line 79) +* compiled programs <1>: Glossary. (line 156) +* compiled programs: Basic High Level. (line 14) +* compl function (gawk): Bitwise Functions. (line 43) +* complement, bitwise: Bitwise Functions. (line 25) +* compound statements, control statements and: Statements. (line 10) +* concatenating: Concatenation. (line 9) +* conditional expressions: Conditional Exp. (line 6) +* configuration option, --disable-directories-fatal: Additional Configuration Options. + (line 37) +* configuration option, --disable-lint: Additional Configuration Options. + (line 17) +* configuration option, --disable-nls: Additional Configuration Options. + (line 32) +* configuration option, --enable-portals: Additional Configuration Options. + (line 9) +* configuration option, --enable-switch: Additional Configuration Options. + (line 13) +* configuration options, gawk: Additional Configuration Options. + (line 6) +* constants, nondecimal: Nondecimal Data. (line 6) +* constants, types of: Constants. (line 6) +* continue statement: Continue Statement. (line 6) +* control statements: Statements. (line 6) +* converting, case: String Functions. (line 453) +* converting, dates to timestamps: Time Functions. (line 72) +* converting, during subscripting: Numeric Array Subscripts. + (line 31) +* converting, numbers: Conversion. (line 6) +* converting, numbers, to strings: Bitwise Functions. (line 99) +* converting, strings to numbers: Conversion. (line 6) +* CONVFMT variable <1>: User-modified. (line 26) +* CONVFMT variable: Conversion. (line 29) +* CONVFMT variable, array subscripts and: Numeric Array Subscripts. + (line 6) +* coprocesses <1>: Two-way I/O. (line 44) +* coprocesses: Redirection. (line 99) +* coprocesses, closing: Close Files And Pipes. + (line 6) +* coprocesses, getline from: Getline/Coprocess. (line 6) +* cos function: Numeric Functions. (line 34) +* counting: Wc Program. (line 6) +* csh utility: Statements/Lines. (line 44) +* csh utility, backslash continuation and: More Complex. (line 15) +* csh utility, POSIXLY_CORRECT environment variable: Options. (line 295) +* csh utility, |& operator, comparison with: Two-way I/O. (line 44) +* ctime user-defined function: Function Example. (line 72) +* currency symbols, localization: Explaining gettext. (line 99) +* custom.h file: Configuration Philosophy. + (line 29) +* cut utility: Cut Program. (line 6) +* cut.awk program: Cut Program. (line 44) +* d.c., See dark corner: Conventions. (line 37) +* dark corner <1>: Glossary. (line 188) +* dark corner <2>: Truth Values. (line 24) +* dark corner <3>: Assignment Ops. (line 148) +* dark corner <4>: Format Modifiers. (line 59) +* dark corner: Conventions. (line 37) +* dark corner, array subscripts: Uninitialized Subscripts. + (line 42) +* dark corner, break statement: Break Statement. (line 47) +* dark corner, close function: Close Files And Pipes. + (line 130) +* dark corner, command-line arguments: Assignment Options. (line 43) +* dark corner, continue statement: Continue Statement. (line 43) +* dark corner, CONVFMT variable: Conversion. (line 40) +* dark corner, escape sequences: Other Arguments. (line 31) +* dark corner, escape sequences, for metacharacters: Escape Sequences. + (line 136) +* dark corner, exit statement: Exit Statement. (line 29) +* dark corner, field separators: Field Splitting Summary. + (line 47) +* dark corner, FILENAME variable <1>: Auto-set. (line 88) +* dark corner, FILENAME variable: Getline Notes. (line 19) +* dark corner, FNR/NR variables: Auto-set. (line 187) +* dark corner, format-control characters: Control Letters. (line 80) +* dark corner, FS as null string: Single Character Fields. + (line 20) +* dark corner, input files: Records. (line 98) +* dark corner, invoking awk: Command Line. (line 16) +* dark corner, multiline records: Multiple Line. (line 35) +* dark corner, NF variable, decrementing: Changing Fields. (line 107) +* dark corner, OFMT variable: OFMT. (line 27) +* dark corner, regexp constants: Using Constant Regexps. + (line 6) +* dark corner, regexp constants, /= operator and: Assignment Ops. + (line 148) +* dark corner, regexp constants, as arguments to user-defined functions: Using Constant Regexps. + (line 44) +* dark corner, split function: String Functions. (line 220) +* dark corner, strings, storing: Records. (line 186) +* data, fixed-width: Constant Size. (line 9) +* data-driven languages: Basic High Level. (line 83) +* database, group, reading: Group Functions. (line 6) +* database, users, reading: Passwd Functions. (line 6) +* date utility, GNU: Time Functions. (line 17) +* date utility, POSIX: Time Functions. (line 259) +* dates, converting to timestamps: Time Functions. (line 72) +* dates, information related to, localization: Explaining gettext. + (line 111) +* Davies, Stephen <1>: Bugs. (line 62) +* Davies, Stephen: Contributors. (line 68) +* dcgettext function (gawk) <1>: Programmer i18n. (line 19) +* dcgettext function (gawk): I18N Functions. (line 12) +* dcgettext function (gawk), portability and: I18N Portability. + (line 32) +* dcngettext function (gawk) <1>: Programmer i18n. (line 35) +* dcngettext function (gawk): I18N Functions. (line 18) +* dcngettext function (gawk), portability and: I18N Portability. + (line 32) +* deadlocks: Two-way I/O. (line 71) +* debugging gawk: Known Bugs. (line 6) +* debugging gawk, bug reports: Bugs. (line 9) +* decimal point character, locale specific: Options. (line 200) +* decrement operators: Increment Ops. (line 35) +* default keyword: Switch Statement. (line 6) +* Deifik, Scott <1>: Bugs. (line 58) +* Deifik, Scott <2>: Contributors. (line 52) +* Deifik, Scott: Acknowledgments. (line 53) +* delete statement: Delete. (line 6) +* deleting elements in arrays: Delete. (line 6) +* deleting entire arrays: Delete. (line 39) +* differences between gawk and awk: String Functions. (line 88) +* differences in awk and gawk, ARGC/ARGV variables: ARGC and ARGV. + (line 85) +* differences in awk and gawk, ARGIND variable: Auto-set. (line 40) +* differences in awk and gawk, array elements, deleting: Delete. + (line 39) +* differences in awk and gawk, AWKPATH environment variable: AWKPATH Variable. + (line 6) +* differences in awk and gawk, BEGIN/END patterns: I/O And BEGIN/END. + (line 16) +* differences in awk and gawk, BINMODE variable <1>: PC Using. + (line 40) +* differences in awk and gawk, BINMODE variable: User-modified. + (line 21) +* differences in awk and gawk, close function: Close Files And Pipes. + (line 81) +* differences in awk and gawk, ERRNO variable: Auto-set. (line 72) +* differences in awk and gawk, error messages: Special FD. (line 15) +* differences in awk and gawk, FIELDWIDTHS variable: User-modified. + (line 33) +* differences in awk and gawk, function arguments (gawk): Calling Built-in. + (line 16) +* differences in awk and gawk, getline command: Getline. (line 19) +* differences in awk and gawk, IGNORECASE variable: User-modified. + (line 68) +* differences in awk and gawk, implementation limitations <1>: Redirection. + (line 132) +* differences in awk and gawk, implementation limitations: Getline Notes. + (line 14) +* differences in awk and gawk, input/output operators <1>: Redirection. + (line 99) +* differences in awk and gawk, input/output operators: Getline/Coprocess. + (line 6) +* differences in awk and gawk, line continuations: Conditional Exp. + (line 34) +* differences in awk and gawk, LINT variable: User-modified. (line 83) +* differences in awk and gawk, match function: String Functions. + (line 151) +* differences in awk and gawk, next/nextfile statements: Nextfile Statement. + (line 6) +* differences in awk and gawk, print/printf statements: Format Modifiers. + (line 13) +* differences in awk and gawk, PROCINFO array: Auto-set. (line 119) +* differences in awk and gawk, record separators: Records. (line 112) +* differences in awk and gawk, regexp constants: Using Constant Regexps. + (line 44) +* differences in awk and gawk, regular expressions: Case-sensitivity. + (line 26) +* differences in awk and gawk, RS/RT variables: Records. (line 162) +* differences in awk and gawk, RT variable: Auto-set. (line 176) +* differences in awk and gawk, single-character fields: Single Character Fields. + (line 6) +* differences in awk and gawk, split function: String Functions. + (line 209) +* differences in awk and gawk, strings: Scalar Constants. (line 20) +* differences in awk and gawk, strings, storing: Records. (line 182) +* differences in awk and gawk, strtonum function (gawk): String Functions. + (line 247) +* differences in awk and gawk, TEXTDOMAIN variable: User-modified. + (line 138) +* differences in awk and gawk, trunc-mod operation: Arithmetic Ops. + (line 66) +* directories, changing: Sample Library. (line 6) +* directories, searching <1>: Igawk Program. (line 358) +* directories, searching: AWKPATH Variable. (line 6) +* division: Arithmetic Ops. (line 44) +* do-while statement <1>: Do Statement. (line 6) +* do-while statement: Regexp Usage. (line 19) +* documentation, of awk programs: Library Names. (line 6) +* documentation, online: Manual History. (line 11) +* documents, searching: Dupword Program. (line 6) +* dollar sign ($): Regexp Operators. (line 35) +* dollar sign ($), $ field operator <1>: Precedence. (line 43) +* dollar sign ($), $ field operator: Fields. (line 19) +* dollar sign ($), incrementing fields and arrays: Increment Ops. + (line 30) +* double quote (") <1>: Quoting. (line 33) +* double quote ("): Read Terminal. (line 25) +* double quote ("), regexp constants: Computed Regexps. (line 28) +* double-precision floating-point: Basic Data Typing. (line 33) +* Drepper, Ulrich: Acknowledgments. (line 49) +* dupnode internal function: Internals. (line 97) +* dupword.awk program: Dupword Program. (line 31) +* EBCDIC: Ordinal Functions. (line 44) +* egrep utility <1>: Egrep Program. (line 6) +* egrep utility: Character Lists. (line 24) +* egrep.awk program: Egrep Program. (line 54) +* elements in arrays: Reference to Elements. + (line 6) +* elements in arrays, assigning: Assigning Elements. (line 6) +* elements in arrays, deleting: Delete. (line 6) +* elements in arrays, order of: Scanning an Array. (line 47) +* elements in arrays, scanning: Scanning an Array. (line 6) +* email address for bug reports, bug-gawk@gnu.org: Bugs. (line 27) +* EMISTERED: TCP/IP Networking. (line 6) +* empty pattern: Empty. (line 6) +* empty strings, See null strings: Regexp Field Splitting. + (line 43) +* END pattern: BEGIN/END. (line 6) +* END pattern, assert user-defined function and: Assert Function. + (line 74) +* END pattern, backslash continuation and: Egrep Program. (line 218) +* END pattern, Boolean patterns and: Expression Patterns. (line 73) +* END pattern, exit statement and: Exit Statement. (line 12) +* END pattern, next/nextfile statements and <1>: Next Statement. + (line 39) +* END pattern, next/nextfile statements and: I/O And BEGIN/END. + (line 36) +* END pattern, operators and: Using BEGIN/END. (line 17) +* END pattern, pgawk program: Profiling. (line 69) +* END pattern, print statement and: I/O And BEGIN/END. (line 16) +* endfile user-defined function: Filetrans Function. (line 60) +* endgrent function (C library): Group Functions. (line 213) +* endgrent user-defined function: Group Functions. (line 216) +* endpwent function (C library): Passwd Functions. (line 192) +* endpwent user-defined function: Passwd Functions. (line 195) +* ENVIRON variable <1>: Internals. (line 165) +* ENVIRON variable: Auto-set. (line 60) +* environment variables: Auto-set. (line 60) +* epoch, definition of: Glossary. (line 230) +* equals sign (=), = operator: Assignment Ops. (line 6) +* equals sign (=), == operator <1>: Precedence. (line 65) +* equals sign (=), == operator: Comparison Operators. + (line 11) +* EREs (Extended Regular Expressions): Character Lists. (line 24) +* ERRNO variable <1>: Internals. (line 152) +* ERRNO variable <2>: Auto-set. (line 72) +* ERRNO variable: Getline. (line 19) +* error handling: Special FD. (line 15) +* error handling, ERRNO variable and: Auto-set. (line 72) +* error output: Special FD. (line 6) +* escape processing, gsub/gensub/sub functions: Gory Details. (line 6) +* escape sequences: Escape Sequences. (line 6) +* escape sequences, unrecognized: Options. (line 180) +* evaluation order: Increment Ops. (line 61) +* evaluation order, concatenation: Concatenation. (line 42) +* evaluation order, functions: Calling Built-in. (line 30) +* examining fields: Fields. (line 6) +* exclamation point (!), ! operator <1>: Egrep Program. (line 160) +* exclamation point (!), ! operator <2>: Precedence. (line 52) +* exclamation point (!), ! operator: Boolean Ops. (line 67) +* exclamation point (!), != operator <1>: Precedence. (line 65) +* exclamation point (!), != operator: Comparison Operators. + (line 11) +* exclamation point (!), !~ operator <1>: Expression Patterns. + (line 24) +* exclamation point (!), !~ operator <2>: Precedence. (line 81) +* exclamation point (!), !~ operator <3>: Comparison Operators. + (line 11) +* exclamation point (!), !~ operator <4>: Regexp Constants. (line 6) +* exclamation point (!), !~ operator <5>: Computed Regexps. (line 6) +* exclamation point (!), !~ operator <6>: Case-sensitivity. (line 26) +* exclamation point (!), !~ operator: Regexp Usage. (line 19) +* exit statement: Exit Statement. (line 6) +* exp function: Numeric Functions. (line 22) +* expand utility: Very Simple. (line 69) +* expressions: Expressions. (line 6) +* expressions, as patterns: Expression Patterns. (line 6) +* expressions, assignment: Assignment Ops. (line 6) +* expressions, Boolean: Boolean Ops. (line 6) +* expressions, comparison: Typing and Comparison. + (line 9) +* expressions, conditional: Conditional Exp. (line 6) +* expressions, matching, See comparison expressions: Typing and Comparison. + (line 9) +* expressions, selecting: Conditional Exp. (line 6) +* Extended Regular Expressions (EREs): Character Lists. (line 24) +* extension function (gawk): Using Internal File Ops. + (line 15) +* extensions, Bell Laboratories awk: BTL. (line 6) +* extensions, in gawk, not in POSIX awk: POSIX/GNU. (line 6) +* extensions, mawk: Other Versions. (line 46) +* extract.awk program: Extract Program. (line 77) +* extraction, of marked strings (internationalization): String Extraction. + (line 6) +* false, logical: Truth Values. (line 6) +* FDL (Free Documentation License): GNU Free Documentation License. + (line 6) +* features, adding to gawk: Adding Code. (line 6) +* features, advanced, See advanced features: Obsolete. (line 6) +* features, deprecated: Obsolete. (line 6) +* features, undocumented: Undocumented. (line 6) +* Fenlason, Jay <1>: Contributors. (line 19) +* Fenlason, Jay: History. (line 30) +* fflush function: I/O Functions. (line 25) +* fflush function, unsupported: Options. (line 203) +* field numbers: Nonconstant Fields. (line 6) +* field operator $: Fields. (line 19) +* field operators, dollar sign as: Fields. (line 19) +* field separators <1>: User-modified. (line 43) +* field separators: Field Separators. (line 13) +* field separators, choice of: Field Separators. (line 49) +* field separators, FIELDWIDTHS variable and: User-modified. (line 33) +* field separators, in multiline records: Multiple Line. (line 41) +* field separators, on command line: Command Line Field Separator. + (line 6) +* field separators, POSIX and <1>: Field Splitting Summary. + (line 41) +* field separators, POSIX and: Fields. (line 6) +* field separators, regular expressions as <1>: Regexp Field Splitting. + (line 6) +* field separators, regular expressions as: Field Separators. (line 49) +* field separators, See Also OFS: Changing Fields. (line 64) +* field separators, spaces as: Cut Program. (line 106) +* fields <1>: Basic High Level. (line 71) +* fields <2>: Fields. (line 6) +* fields: Reading Files. (line 14) +* fields, adding: Changing Fields. (line 53) +* fields, changing contents of: Changing Fields. (line 6) +* fields, cutting: Cut Program. (line 6) +* fields, examining: Fields. (line 6) +* fields, number of: Fields. (line 33) +* fields, numbers: Nonconstant Fields. (line 6) +* fields, printing: Print Examples. (line 21) +* fields, separating: Field Separators. (line 13) +* fields, single-character: Single Character Fields. + (line 6) +* FIELDWIDTHS variable <1>: User-modified. (line 33) +* FIELDWIDTHS variable: Constant Size. (line 22) +* file descriptors: Special FD. (line 6) +* file names, distinguishing: Auto-set. (line 52) +* file names, in compatibility mode: Special Caveats. (line 9) +* file names, standard streams in gawk: Special FD. (line 41) +* FILENAME variable <1>: Auto-set. (line 88) +* FILENAME variable: Reading Files. (line 6) +* FILENAME variable, getline, setting with: Getline Notes. (line 19) +* filenames, assignments as: Ignoring Assigns. (line 6) +* files, .mo: Explaining gettext. (line 39) +* files, .mo, converting from .po: I18N Example. (line 62) +* files, .mo, specifying directory of <1>: Programmer i18n. (line 45) +* files, .mo, specifying directory of: Explaining gettext. (line 51) +* files, .po <1>: Translator i18n. (line 6) +* files, .po: Explaining gettext. (line 36) +* files, .po, converting to .mo: I18N Example. (line 62) +* files, /dev/... special files: Special FD. (line 41) +* files, /inet/ (gawk): TCP/IP Networking. (line 6) +* files, /p (gawk): Portal Files. (line 6) +* files, as single records: Records. (line 191) +* files, awk programs in: Long. (line 6) +* files, awkprof.out: Profiling. (line 10) +* files, awkvars.out: Options. (line 95) +* files, closing: I/O Functions. (line 10) +* files, descriptors, See file descriptors: Special FD. (line 6) +* files, for process information: Special Process. (line 6) +* files, group: Group Functions. (line 6) +* files, information about, retrieving: Sample Library. (line 6) +* files, initialization and cleanup: Filetrans Function. (line 6) +* files, input, See input files: Read Terminal. (line 17) +* files, log, timestamps in: Time Functions. (line 6) +* files, managing: Data File Management. + (line 6) +* files, managing, data file boundaries: Filetrans Function. (line 6) +* files, message object: Explaining gettext. (line 39) +* files, message object, converting from portable object files: I18N Example. + (line 62) +* files, message object, specifying directory of <1>: Programmer i18n. + (line 45) +* files, message object, specifying directory of: Explaining gettext. + (line 51) +* files, multiple passes over: Other Arguments. (line 49) +* files, multiple, duplicating output into: Tee Program. (line 6) +* files, output, See output files: Close Files And Pipes. + (line 6) +* files, password: Passwd Functions. (line 16) +* files, portable object <1>: Translator i18n. (line 6) +* files, portable object: Explaining gettext. (line 36) +* files, portable object, converting to message object files: I18N Example. + (line 62) +* files, portable object, generating: Options. (line 130) +* files, portal: Portal Files. (line 6) +* files, processing, ARGIND variable and: Auto-set. (line 47) +* files, reading: Rewind Function. (line 6) +* files, reading, multiline records: Multiple Line. (line 6) +* files, searching for regular expressions: Egrep Program. (line 6) +* files, skipping: File Checking. (line 6) +* files, source, search path for: Igawk Program. (line 358) +* files, splitting: Split Program. (line 6) +* files, Texinfo, extracting programs from: Extract Program. (line 6) +* Fish, Fred <1>: Bugs. (line 57) +* Fish, Fred: Contributors. (line 50) +* fixed-width data: Constant Size. (line 9) +* flag variables <1>: Tee Program. (line 20) +* flag variables: Boolean Ops. (line 67) +* floating-point: Unexpected Results. (line 6) +* floating-point, numbers: Basic Data Typing. (line 21) +* floating-point, numbers, AWKNUM internal type: Internals. (line 19) +* FNR variable <1>: Auto-set. (line 98) +* FNR variable: Records. (line 6) +* FNR variable, changing: Auto-set. (line 187) +* for statement: For Statement. (line 6) +* for statement, in arrays: Scanning an Array. (line 20) +* force_number internal function: Internals. (line 27) +* force_string internal function: Internals. (line 32) +* format specifiers, mixing regular with positional specifiers: Printf Ordering. + (line 57) +* format specifiers, printf statement: Control Letters. (line 6) +* format specifiers, strftime function (gawk): Time Functions. + (line 85) +* format strings: Basic Printf. (line 15) +* formats, numeric output: OFMT. (line 6) +* formatting output: Printf. (line 6) +* forward slash (/): Regexp. (line 10) +* forward slash (/), / operator: Precedence. (line 55) +* forward slash (/), /= operator <1>: Precedence. (line 96) +* forward slash (/), /= operator: Assignment Ops. (line 129) +* forward slash (/), /= operator, vs. /=.../ regexp constant: Assignment Ops. + (line 148) +* forward slash (/), patterns and: Expression Patterns. (line 24) +* Free Documentation License (FDL): GNU Free Documentation License. + (line 6) +* Free Software Foundation (FSF) <1>: Glossary. (line 284) +* Free Software Foundation (FSF) <2>: Getting. (line 10) +* Free Software Foundation (FSF): Manual History. (line 6) +* free_temp internal macro: Internals. (line 102) +* FreeBSD: Glossary. (line 582) +* FS variable <1>: User-modified. (line 43) +* FS variable: Field Separators. (line 13) +* FS variable, --field-separator option and: Options. (line 21) +* FS variable, as null string: Single Character Fields. + (line 20) +* FS variable, as TAB character: Options. (line 196) +* FS variable, changing value of <1>: Known Bugs. (line 6) +* FS variable, changing value of: Field Separators. (line 33) +* FS variable, running awk programs and: Cut Program. (line 66) +* FS variable, setting from command line: Command Line Field Separator. + (line 6) +* FSF (Free Software Foundation) <1>: Glossary. (line 284) +* FSF (Free Software Foundation) <2>: Getting. (line 10) +* FSF (Free Software Foundation): Manual History. (line 6) +* function calls: Function Calls. (line 6) +* functions, arrays as parameters to: Function Caveats. (line 55) +* functions, built-in <1>: Functions. (line 6) +* functions, built-in: Function Calls. (line 10) +* functions, built-in, adding to gawk: Dynamic Extensions. (line 10) +* functions, built-in, evaluation order: Calling Built-in. (line 30) +* functions, defining: Definition Syntax. (line 6) +* functions, library: Library Functions. (line 6) +* functions, library, assertions: Assert Function. (line 6) +* functions, library, associative arrays and: Library Names. (line 57) +* functions, library, C library: Getopt Function. (line 6) +* functions, library, character values as numbers: Ordinal Functions. + (line 6) +* functions, library, Cliff random numbers: Cliff Random Function. + (line 6) +* functions, library, command-line options: Getopt Function. (line 6) +* functions, library, example program for using: Igawk Program. + (line 6) +* functions, library, group database, reading: Group Functions. + (line 6) +* functions, library, managing data files: Data File Management. + (line 6) +* functions, library, managing time: Gettimeofday Function. + (line 6) +* functions, library, merging arrays into strings: Join Function. + (line 6) +* functions, library, nextfile statement: Nextfile Function. (line 6) +* functions, library, rounding numbers: Round Function. (line 6) +* functions, library, user database, reading: Passwd Functions. + (line 6) +* functions, names of <1>: Definition Syntax. (line 20) +* functions, names of: Arrays. (line 17) +* functions, recursive: Definition Syntax. (line 68) +* functions, return values, setting: Internals. (line 146) +* functions, string-translation: I18N Functions. (line 6) +* functions, undefined: Function Caveats. (line 79) +* functions, user-defined: User-defined. (line 6) +* functions, user-defined, calling: Function Caveats. (line 6) +* functions, user-defined, counts: Profiling. (line 135) +* functions, user-defined, library of: Library Functions. (line 6) +* functions, user-defined, next/nextfile statements and <1>: Nextfile Statement. + (line 39) +* functions, user-defined, next/nextfile statements and: Next Statement. + (line 39) +* G-d: Acknowledgments. (line 70) +* Garfinkle, Scott: Contributors. (line 37) +* gawk, awk and <1>: This Manual. (line 13) +* gawk, awk and: Preface. (line 22) +* gawk, bitwise operations in: Bitwise Functions. (line 39) +* gawk, break statement in: Break Statement. (line 47) +* gawk, built-in variables and: Built-in Variables. (line 14) +* gawk, character classes and: Character Lists. (line 92) +* gawk, coding style in: Adding Code. (line 32) +* gawk, command-line options: GNU Regexp Operators. + (line 62) +* gawk, comparison operators and: Comparison Operators. + (line 50) +* gawk, configuring: Configuration Philosophy. + (line 6) +* gawk, configuring, options: Additional Configuration Options. + (line 6) +* gawk, continue statement in: Continue Statement. (line 43) +* gawk, debugging: Known Bugs. (line 6) +* gawk, distribution: Distribution contents. + (line 6) +* gawk, escape sequences: Escape Sequences. (line 125) +* gawk, extensions, disabling: Options. (line 176) +* gawk, features, adding: Adding Code. (line 6) +* gawk, features, advanced: Advanced Features. (line 6) +* gawk, fflush function in: I/O Functions. (line 45) +* gawk, field separators and: User-modified. (line 63) +* gawk, FIELDWIDTHS variable in: User-modified. (line 39) +* gawk, file names in: Special Files. (line 6) +* gawk, format-control characters: Control Letters. (line 80) +* gawk, function arguments and: Calling Built-in. (line 16) +* gawk, functions, adding: Dynamic Extensions. (line 10) +* gawk, hexadecimal numbers and: Nondecimal-numbers. (line 42) +* gawk, IGNORECASE variable in: User-modified. (line 79) +* gawk, implementation issues: Notes. (line 6) +* gawk, implementation issues, debugging: Compatibility Mode. (line 6) +* gawk, implementation issues, downward compatibility: Compatibility Mode. + (line 6) +* gawk, implementation issues, limits: Getline Notes. (line 14) +* gawk, implementation issues, pipes: Redirection. (line 132) +* gawk, installing: Installation. (line 6) +* gawk, internals: Internals. (line 6) +* gawk, internationalization and, See internationalization: Internationalization. + (line 13) +* gawk, interpreter, adding code to <1>: Future Extensions. (line 87) +* gawk, interpreter, adding code to: Using Internal File Ops. + (line 6) +* gawk, interval expressions and: Regexp Operators. (line 138) +* gawk, line continuation in: Conditional Exp. (line 34) +* gawk, LINT variable in: User-modified. (line 92) +* gawk, list of contributors to: Contributors. (line 6) +* gawk, MS-DOS version of: PC Using. (line 11) +* gawk, newlines in: Statements/Lines. (line 12) +* gawk, next file statement in: Nextfile Statement. (line 46) +* gawk, nextfile statement in <1>: Nextfile Function. (line 6) +* gawk, nextfile statement in: Nextfile Statement. (line 46) +* gawk, octal numbers and: Nondecimal-numbers. (line 42) +* gawk, OS/2 version of: PC Using. (line 11) +* gawk, regexp constants and: Using Constant Regexps. + (line 28) +* gawk, regular expressions, case sensitivity: Case-sensitivity. + (line 26) +* gawk, regular expressions, operators: GNU Regexp Operators. + (line 6) +* gawk, regular expressions, precedence: Regexp Operators. (line 154) +* gawk, See Also awk: Preface. (line 35) +* gawk, source code, obtaining: Getting. (line 6) +* gawk, splitting fields and: Constant Size. (line 87) +* gawk, string-translation functions: I18N Functions. (line 6) +* gawk, timestamps: Time Functions. (line 6) +* gawk, uses for: Preface. (line 35) +* gawk, versions of, information about, printing: Options. (line 244) +* gawk, word-boundary operator: GNU Regexp Operators. + (line 55) +* General Public License (GPL): Glossary. (line 293) +* General Public License, See GPL: Manual History. (line 11) +* gensub function (gawk) <1>: String Functions. (line 361) +* gensub function (gawk): Using Constant Regexps. + (line 44) +* gensub function (gawk), escape processing: Gory Details. (line 6) +* get_actual_argument internal function: Internals. (line 126) +* get_argument internal function: Internals. (line 121) +* get_array_argument internal macro: Internals. (line 141) +* get_curfunc_arg_count internal function: Internals. (line 37) +* get_record input method: Internals. (line 178) +* get_scalar_argument internal macro: Internals. (line 136) +* getgrent function (C library): Group Functions. (line 6) +* getgrent user-defined function: Group Functions. (line 6) +* getgrgid function (C library): Group Functions. (line 180) +* getgrgid user-defined function: Group Functions. (line 183) +* getgrnam function (C library): Group Functions. (line 168) +* getgrnam user-defined function: Group Functions. (line 172) +* getgruser function (C library): Group Functions. (line 191) +* getgruser function, user-defined: Group Functions. (line 194) +* getline command: Reading Files. (line 20) +* getline command, _gr_init user-defined function: Group Functions. + (line 80) +* getline command, _pw_init function: Passwd Functions. (line 136) +* getline command, coprocesses, using from <1>: Close Files And Pipes. + (line 6) +* getline command, coprocesses, using from: Getline/Coprocess. + (line 6) +* getline command, deadlock and: Two-way I/O. (line 71) +* getline command, explicit input with: Getline. (line 6) +* getline command, FILENAME variable and: Getline Notes. (line 19) +* getline command, return values: Getline. (line 19) +* getline command, variants: Getline Summary. (line 6) +* getopt function (C library): Getopt Function. (line 15) +* getopt user-defined function: Getopt Function. (line 106) +* getpwent function (C library): Passwd Functions. (line 16) +* getpwent user-defined function: Passwd Functions. (line 16) +* getpwnam function (C library): Passwd Functions. (line 156) +* getpwnam user-defined function: Passwd Functions. (line 160) +* getpwuid function (C library): Passwd Functions. (line 168) +* getpwuid user-defined function: Passwd Functions. (line 172) +* getservbyname function (C library): TCP/IP Networking. (line 34) +* gettext function (C library): Explaining gettext. (line 60) +* gettext library: Explaining gettext. (line 6) +* gettext library, locale categories: Explaining gettext. (line 78) +* gettimeofday user-defined function: Gettimeofday Function. + (line 16) +* GNITS mailing list: Acknowledgments. (line 49) +* GNU awk, See gawk: Preface. (line 48) +* GNU Free Documentation License: GNU Free Documentation License. + (line 6) +* GNU General Public License: Glossary. (line 293) +* GNU Lesser General Public License: Glossary. (line 373) +* GNU long options <1>: Options. (line 6) +* GNU long options: Command Line. (line 13) +* GNU long options, printing list of: Options. (line 139) +* GNU Project <1>: Glossary. (line 302) +* GNU Project: Manual History. (line 11) +* GNU/Linux <1>: Glossary. (line 582) +* GNU/Linux <2>: Atari Compiling. (line 16) +* GNU/Linux <3>: I18N Example. (line 55) +* GNU/Linux: Manual History. (line 28) +* GPL (General Public License) <1>: Glossary. (line 293) +* GPL (General Public License): Manual History. (line 11) +* GPL (General Public License), printing: Options. (line 87) +* grcat program: Group Functions. (line 15) +* Grigera, Juan <1>: Bugs. (line 59) +* Grigera, Juan: Contributors. (line 54) +* group database, reading: Group Functions. (line 6) +* group file: Group Functions. (line 6) +* groups, information about: Group Functions. (line 6) +* gsub function <1>: String Functions. (line 345) +* gsub function: Using Constant Regexps. + (line 44) +* gsub function, arguments of: String Functions. (line 325) +* gsub function, escape processing: Gory Details. (line 6) +* Hankerson, Darrel <1>: Bugs. (line 58) +* Hankerson, Darrel <2>: Contributors. (line 56) +* Hankerson, Darrel: Acknowledgments. (line 53) +* Hartholz, Elaine: Acknowledgments. (line 35) +* Hartholz, Marshall: Acknowledgments. (line 35) +* Hasegawa, Isamu <1>: Contributors. (line 83) +* Hasegawa, Isamu: Acknowledgments. (line 53) +* hexadecimal numbers: Nondecimal-numbers. (line 6) +* hexadecimal values, enabling interpretation of: Options. (line 168) +* histsort.awk program: History Sorting. (line 25) +* Hughes, Phil: Acknowledgments. (line 40) +* HUP signal: Profiling. (line 207) +* hyphen (-), - operator: Precedence. (line 52) +* hyphen (-), -- (decrement/increment) operators: Precedence. (line 46) +* hyphen (-), -- operator: Increment Ops. (line 48) +* hyphen (-), -= operator <1>: Precedence. (line 96) +* hyphen (-), -= operator: Assignment Ops. (line 129) +* hyphen (-), filenames beginning with: Options. (line 67) +* hyphen (-), in character lists: Character Lists. (line 17) +* id utility: Id Program. (line 6) +* id.awk program: Id Program. (line 30) +* if statement <1>: If Statement. (line 6) +* if statement: Regexp Usage. (line 19) +* if statement, actions, changing: Ranges. (line 25) +* igawk.sh program: Igawk Program. (line 118) +* IGNORECASE variable <1>: User-modified. (line 68) +* IGNORECASE variable: Case-sensitivity. (line 26) +* IGNORECASE variable, array sorting and: Array Sorting. (line 86) +* IGNORECASE variable, array subscripts and: Array Intro. (line 87) +* IGNORECASE variable, in example programs: Library Functions. + (line 43) +* implementation issues, gawk: Notes. (line 6) +* implementation issues, gawk, debugging: Compatibility Mode. (line 6) +* implementation issues, gawk, limits <1>: Redirection. (line 132) +* implementation issues, gawk, limits: Getline Notes. (line 14) +* in operator <1>: Id Program. (line 93) +* in operator <2>: For Statement. (line 74) +* in operator <3>: Precedence. (line 84) +* in operator: Comparison Operators. + (line 11) +* in operator, arrays and <1>: Scanning an Array. (line 17) +* in operator, arrays and: Reference to Elements. + (line 25) +* increment operators: Increment Ops. (line 6) +* index function: String Functions. (line 60) +* indexing arrays: Array Intro. (line 45) +* initialization, automatic: More Complex. (line 38) +* input files: Reading Files. (line 6) +* input files, closing: Close Files And Pipes. + (line 6) +* input files, counting elements in: Wc Program. (line 6) +* input files, examples: Sample Data Files. (line 6) +* input files, reading: Reading Files. (line 6) +* input files, running awk without: Read Terminal. (line 6) +* input files, skipping: Nextfile Function. (line 6) +* input files, variable assignments and: Other Arguments. (line 19) +* input pipeline: Getline/Pipe. (line 6) +* input redirection: Getline/File. (line 6) +* input, data, nondecimal: Nondecimal Data. (line 6) +* input, explicit: Getline. (line 6) +* input, files, See input files: Multiple Line. (line 6) +* input, multiline records: Multiple Line. (line 6) +* input, splitting into records: Records. (line 6) +* input, standard <1>: Special FD. (line 6) +* input, standard: Read Terminal. (line 6) +* input/output, binary: User-modified. (line 10) +* input/output, from BEGIN and END: I/O And BEGIN/END. (line 6) +* input/output, two-way: Two-way I/O. (line 44) +* insomnia, cure for: Alarm Program. (line 6) +* installation, amiga: Amiga Installation. (line 6) +* installation, atari: Atari Installation. (line 9) +* installation, beos: BeOS Installation. (line 6) +* installation, tandem: Tandem Installation. (line 6) +* installation, vms: VMS Installation. (line 6) +* installing gawk: Installation. (line 6) +* int function: Numeric Functions. (line 11) +* INT signal (MS-DOS): Profiling. (line 210) +* integers: Basic Data Typing. (line 21) +* integers, unsigned: Basic Data Typing. (line 28) +* interacting with other programs: I/O Functions. (line 63) +* internationalization <1>: I18N and L10N. (line 6) +* internationalization: I18N Functions. (line 6) +* internationalization, localization <1>: Internationalization. + (line 13) +* internationalization, localization: User-modified. (line 138) +* internationalization, localization, character classes: Character Lists. + (line 92) +* internationalization, localization, gawk and: Internationalization. + (line 13) +* internationalization, localization, locale categories: Explaining gettext. + (line 78) +* internationalization, localization, marked strings: Programmer i18n. + (line 14) +* internationalization, localization, portability and: I18N Portability. + (line 6) +* internationalizing a program: Explaining gettext. (line 6) +* interpreted programs <1>: Glossary. (line 342) +* interpreted programs: Basic High Level. (line 14) +* interval expressions: Regexp Operators. (line 115) +* inventory-shipped file: Sample Data Files. (line 32) +* IOBUF internal structure: Internals. (line 178) +* iop_alloc internal function: Internals. (line 178) +* ISO: Glossary. (line 353) +* ISO 8859-1: Glossary. (line 138) +* ISO Latin-1: Glossary. (line 138) +* Jacobs, Andrew: Passwd Functions. (line 76) +* Jaegermann, Michal <1>: Contributors. (line 45) +* Jaegermann, Michal: Acknowledgments. (line 53) +* Java implementation of awk: Other Versions. (line 105) +* jawk: Other Versions. (line 105) +* Jedi knights: Undocumented. (line 6) +* join user-defined function: Join Function. (line 18) +* Kahrs, Ju"rgen <1>: Contributors. (line 64) +* Kahrs, Ju"rgen: Acknowledgments. (line 53) +* Kenobi, Obi-Wan: Undocumented. (line 6) +* Kernighan, Brian <1>: Basic Data Typing. (line 71) +* Kernighan, Brian <2>: Other Versions. (line 13) +* Kernighan, Brian <3>: Contributors. (line 12) +* Kernighan, Brian <4>: BTL. (line 6) +* Kernighan, Brian <5>: Concatenation. (line 6) +* Kernighan, Brian <6>: Acknowledgments. (line 60) +* Kernighan, Brian <7>: Conventions. (line 33) +* Kernighan, Brian: History. (line 17) +* kill command, dynamic profiling: Profiling. (line 185) +* Knights, jedi: Undocumented. (line 6) +* Kwok, Conrad: Contributors. (line 37) +* labels.awk program: Labels Program. (line 48) +* languages, data-driven: Basic High Level. (line 83) +* LC_ALL locale category: Explaining gettext. (line 116) +* LC_COLLATE locale category: Explaining gettext. (line 89) +* LC_CTYPE locale category: Explaining gettext. (line 93) +* LC_MESSAGES locale category: Explaining gettext. (line 83) +* LC_MESSAGES locale category, bindtextdomain function (gawk): Programmer i18n. + (line 86) +* LC_MONETARY locale category: Explaining gettext. (line 99) +* LC_NUMERIC locale category: Explaining gettext. (line 103) +* LC_RESPONSE locale category: Explaining gettext. (line 107) +* LC_TIME locale category: Explaining gettext. (line 111) +* left angle bracket (<), < operator <1>: Precedence. (line 65) +* left angle bracket (<), < operator: Comparison Operators. + (line 11) +* left angle bracket (<), < operator (I/O): Getline/File. (line 6) +* left angle bracket (<), <= operator <1>: Precedence. (line 65) +* left angle bracket (<), <= operator: Comparison Operators. + (line 11) +* left shift, bitwise: Bitwise Functions. (line 32) +* leftmost longest match: Multiple Line. (line 26) +* length function: String Functions. (line 71) +* Lesser General Public License (LGPL): Glossary. (line 373) +* LGPL (Lesser General Public License): Glossary. (line 373) +* libraries of awk functions: Library Functions. (line 6) +* libraries of awk functions, assertions: Assert Function. (line 6) +* libraries of awk functions, associative arrays and: Library Names. + (line 57) +* libraries of awk functions, character values as numbers: Ordinal Functions. + (line 6) +* libraries of awk functions, command-line options: Getopt Function. + (line 6) +* libraries of awk functions, example program for using: Igawk Program. + (line 6) +* libraries of awk functions, group database, reading: Group Functions. + (line 6) +* libraries of awk functions, managing, data files: Data File Management. + (line 6) +* libraries of awk functions, managing, time: Gettimeofday Function. + (line 6) +* libraries of awk functions, merging arrays into strings: Join Function. + (line 6) +* libraries of awk functions, nextfile statement: Nextfile Function. + (line 6) +* libraries of awk functions, rounding numbers: Round Function. + (line 6) +* libraries of awk functions, user database, reading: Passwd Functions. + (line 6) +* line breaks: Statements/Lines. (line 6) +* line continuations: Boolean Ops. (line 62) +* line continuations, gawk: Conditional Exp. (line 34) +* line continuations, in print statement: Print Examples. (line 76) +* line continuations, with C shell: More Complex. (line 30) +* lines, blank, printing: Print. (line 22) +* lines, counting: Wc Program. (line 6) +* lines, duplicate, removing: History Sorting. (line 6) +* lines, matching ranges of: Ranges. (line 6) +* lines, skipping between markers: Ranges. (line 43) +* lint checking: User-modified. (line 83) +* lint checking, array elements: Delete. (line 34) +* lint checking, array subscripts: Uninitialized Subscripts. + (line 42) +* lint checking, empty programs: Command Line. (line 16) +* lint checking, issuing warnings: Options. (line 144) +* lint checking, POSIXLY_CORRECT environment variable: Options. + (line 282) +* lint checking, undefined functions: Function Caveats. (line 96) +* LINT variable: User-modified. (line 83) +* Linux <1>: Glossary. (line 582) +* Linux <2>: Atari Compiling. (line 16) +* Linux <3>: I18N Example. (line 55) +* Linux: Manual History. (line 28) +* locale categories: Explaining gettext. (line 78) +* locale decimal point character: Options. (line 200) +* locale, definition of: Locales. (line 6) +* localization: I18N and L10N. (line 6) +* localization, See internationalization, localization: I18N and L10N. + (line 6) +* log files, timestamps in: Time Functions. (line 6) +* log function: Numeric Functions. (line 27) +* logical false/true: Truth Values. (line 6) +* logical operators, See Boolean expressions: Boolean Ops. (line 6) +* login information: Passwd Functions. (line 16) +* long options: Command Line. (line 13) +* loops: While Statement. (line 6) +* loops, continue statements and: For Statement. (line 63) +* loops, count for header: Profiling. (line 129) +* loops, exiting: Break Statement. (line 6) +* loops, See Also while statement: While Statement. (line 6) +* Lost In Space: Dynamic Extensions. (line 6) +* ls utility: More Complex. (line 15) +* lshift function (gawk): Bitwise Functions. (line 45) +* lvalues/rvalues: Assignment Ops. (line 32) +* mailing labels, printing: Labels Program. (line 6) +* mailing list, GNITS: Acknowledgments. (line 49) +* make_builtin internal function: Internals. (line 107) +* make_number internal function: Internals. (line 82) +* make_string internal function: Internals. (line 77) +* mark parity: Ordinal Functions. (line 44) +* marked string extraction (internationalization): String Extraction. + (line 6) +* marked strings, extracting: String Extraction. (line 6) +* Marx, Groucho: Increment Ops. (line 61) +* match function: String Functions. (line 98) +* match function, RSTART/RLENGTH variables: String Functions. (line 115) +* matching, expressions, See comparison expressions: Typing and Comparison. + (line 9) +* matching, leftmost longest: Multiple Line. (line 26) +* matching, null strings: Gory Details. (line 160) +* mawk program: Other Versions. (line 33) +* McPhee, Patrick: Contributors. (line 89) +* memory, releasing: Internals. (line 102) +* memory, setting limits: Options. (line 45) +* message object files: Explaining gettext. (line 39) +* message object files, converting from portable object files: I18N Example. + (line 62) +* message object files, specifying directory of <1>: Programmer i18n. + (line 45) +* message object files, specifying directory of: Explaining gettext. + (line 51) +* metacharacters, escape sequences for: Escape Sequences. (line 132) +* mktime function (gawk): Time Functions. (line 30) +* modifiers, in format specifiers: Format Modifiers. (line 6) +* monetary information, localization: Explaining gettext. (line 99) +* msgfmt utility: I18N Example. (line 62) +* names, arrays/variables <1>: Library Names. (line 6) +* names, arrays/variables: Arrays. (line 17) +* names, functions <1>: Library Names. (line 6) +* names, functions: Definition Syntax. (line 20) +* namespace issues <1>: Library Names. (line 6) +* namespace issues: Arrays. (line 17) +* namespace issues, functions: Definition Syntax. (line 20) +* nawk utility: Names. (line 17) +* negative zero: Unexpected Results. (line 28) +* NetBSD: Glossary. (line 582) +* networks, programming: TCP/IP Networking. (line 6) +* networks, support for: Special Network. (line 6) +* newlines <1>: Options. (line 183) +* newlines <2>: Boolean Ops. (line 67) +* newlines: Statements/Lines. (line 6) +* newlines, as field separators: Field Separators. (line 63) +* newlines, as record separators: Records. (line 20) +* newlines, in dynamic regexps: Computed Regexps. (line 59) +* newlines, in regexp constants: Computed Regexps. (line 69) +* newlines, printing: Print Examples. (line 12) +* newlines, separating statements in actions <1>: Statements. (line 10) +* newlines, separating statements in actions: Action Overview. + (line 19) +* next file statement: POSIX/GNU. (line 155) +* next file statement, deprecated: Obsolete. (line 11) +* next file statement, in gawk: Nextfile Statement. (line 46) +* next statement <1>: Next Statement. (line 6) +* next statement: Boolean Ops. (line 85) +* next statement, BEGIN/END patterns and: I/O And BEGIN/END. (line 36) +* next statement, user-defined functions and: Next Statement. (line 39) +* nextfile statement: Nextfile Statement. (line 6) +* nextfile statement, BEGIN/END patterns and: I/O And BEGIN/END. + (line 36) +* nextfile statement, implementing: Nextfile Function. (line 6) +* nextfile statement, in gawk: Nextfile Statement. (line 46) +* nextfile statement, next file statement and: Obsolete. (line 11) +* nextfile statement, user-defined functions and: Nextfile Statement. + (line 39) +* nextfile user-defined function: Nextfile Function. (line 38) +* NF variable <1>: Auto-set. (line 103) +* NF variable: Fields. (line 33) +* NF variable, decrementing: Changing Fields. (line 107) +* noassign.awk program: Ignoring Assigns. (line 15) +* NODE internal type: Internals. (line 23) +* nodes, duplicating: Internals. (line 97) +* not Boolean-logic operator: Boolean Ops. (line 6) +* NR variable <1>: Auto-set. (line 114) +* NR variable: Records. (line 6) +* NR variable, changing: Auto-set. (line 187) +* null strings <1>: Basic Data Typing. (line 47) +* null strings <2>: Truth Values. (line 6) +* null strings <3>: Regexp Field Splitting. + (line 43) +* null strings: Records. (line 102) +* null strings, array elements and: Delete. (line 27) +* null strings, as array subscripts: Uninitialized Subscripts. + (line 42) +* null strings, converting numbers to strings: Conversion. (line 21) +* null strings, matching: Gory Details. (line 160) +* null strings, quoting and: Quoting. (line 58) +* number sign (#), #! (executable scripts): Executable Scripts. + (line 6) +* number sign (#), #! (executable scripts), portability issues with: Executable Scripts. + (line 6) +* number sign (#), commenting: Comments. (line 6) +* numbers: Internals. (line 82) +* numbers, as array subscripts: Numeric Array Subscripts. + (line 6) +* numbers, as values of characters: Ordinal Functions. (line 6) +* numbers, Cliff random: Cliff Random Function. + (line 6) +* numbers, converting: Conversion. (line 6) +* numbers, converting, to strings <1>: Bitwise Functions. (line 99) +* numbers, converting, to strings: User-modified. (line 26) +* numbers, floating-point: Basic Data Typing. (line 21) +* numbers, floating-point, AWKNUM internal type: Internals. (line 19) +* numbers, hexadecimal: Nondecimal-numbers. (line 6) +* numbers, NODE internal type: Internals. (line 23) +* numbers, octal: Nondecimal-numbers. (line 6) +* numbers, random: Numeric Functions. (line 70) +* numbers, rounding: Round Function. (line 6) +* numeric, constants: Scalar Constants. (line 6) +* numeric, output format: OFMT. (line 6) +* numeric, strings: Variable Typing. (line 6) +* numeric, values: Internals. (line 27) +* oawk utility: Names. (line 17) +* obsolete features: Obsolete. (line 6) +* octal numbers: Nondecimal-numbers. (line 6) +* octal values, enabling interpretation of: Options. (line 168) +* OFMT variable <1>: User-modified. (line 100) +* OFMT variable <2>: Conversion. (line 54) +* OFMT variable: OFMT. (line 15) +* OFMT variable, POSIX awk and: OFMT. (line 27) +* OFS variable <1>: User-modified. (line 109) +* OFS variable <2>: Output Separators. (line 6) +* OFS variable: Changing Fields. (line 64) +* OpenBSD: Glossary. (line 582) +* OpenSolaris: Other Versions. (line 96) +* operating systems, BSD-based <1>: Portal Files. (line 6) +* operating systems, BSD-based: Manual History. (line 28) +* operating systems, PC, gawk on: PC Using. (line 6) +* operating systems, PC, gawk on, installing: PC Installation. + (line 6) +* operating systems, porting gawk to: New Ports. (line 6) +* operating systems, See Also GNU/Linux, PC operating systems, Unix: Installation. + (line 6) +* operations, bitwise: Bitwise Functions. (line 6) +* operators, arithmetic: Arithmetic Ops. (line 6) +* operators, assignment: Assignment Ops. (line 6) +* operators, assignment, evaluation order: Assignment Ops. (line 111) +* operators, Boolean, See Boolean expressions: Boolean Ops. (line 6) +* operators, decrement/increment: Increment Ops. (line 6) +* operators, GNU-specific: GNU Regexp Operators. + (line 6) +* operators, input/output <1>: Precedence. (line 65) +* operators, input/output <2>: Redirection. (line 19) +* operators, input/output <3>: Getline/Coprocess. (line 6) +* operators, input/output <4>: Getline/Pipe. (line 6) +* operators, input/output: Getline/File. (line 6) +* operators, logical, See Boolean expressions: Boolean Ops. (line 6) +* operators, precedence <1>: Precedence. (line 6) +* operators, precedence: Increment Ops. (line 61) +* operators, relational, See operators, comparison: Typing and Comparison. + (line 9) +* operators, short-circuit: Boolean Ops. (line 57) +* operators, string: Concatenation. (line 9) +* operators, string-matching: Regexp Usage. (line 19) +* operators, string-matching, for buffers: GNU Regexp Operators. + (line 40) +* operators, word-boundary (gawk): GNU Regexp Operators. + (line 55) +* options, command-line <1>: Options. (line 6) +* options, command-line <2>: Command Line Field Separator. + (line 6) +* options, command-line: Long. (line 12) +* options, command-line, end of: Options. (line 62) +* options, command-line, invoking awk: Command Line. (line 6) +* options, command-line, processing: Getopt Function. (line 6) +* options, deprecated: Obsolete. (line 6) +* options, long <1>: Options. (line 6) +* options, long: Command Line. (line 13) +* options, printing list of: Options. (line 139) +* OR bitwise operation: Bitwise Functions. (line 6) +* or Boolean-logic operator: Boolean Ops. (line 6) +* or function (gawk): Bitwise Functions. (line 39) +* ord user-defined function: Ordinal Functions. (line 16) +* order of evaluation, concatenation: Concatenation. (line 42) +* ORS variable <1>: User-modified. (line 114) +* ORS variable: Output Separators. (line 20) +* output field separator, See OFS variable: Changing Fields. (line 64) +* output record separator, See ORS variable: Output Separators. + (line 20) +* output redirection: Redirection. (line 6) +* output, buffering: I/O Functions. (line 29) +* output, duplicating into files: Tee Program. (line 6) +* output, files, closing: Close Files And Pipes. + (line 6) +* output, format specifier, OFMT: OFMT. (line 15) +* output, formatted: Printf. (line 6) +* output, pipes: Redirection. (line 54) +* output, printing, See printing: Printing. (line 6) +* output, records: Output Separators. (line 20) +* output, standard: Special FD. (line 6) +* P1003.2 POSIX standard: Glossary. (line 426) +* param_cnt internal variable: Internals. (line 46) +* parameters, number of: Internals. (line 46) +* parentheses (): Regexp Operators. (line 78) +* parentheses (), pgawk program: Profiling. (line 144) +* password file: Passwd Functions. (line 16) +* patterns: Patterns and Actions. + (line 6) +* patterns, comparison expressions as: Expression Patterns. (line 14) +* patterns, counts: Profiling. (line 116) +* patterns, default: Very Simple. (line 34) +* patterns, empty: Empty. (line 6) +* patterns, expressions as: Regexp Patterns. (line 6) +* patterns, ranges in: Ranges. (line 6) +* patterns, regexp constants as: Expression Patterns. (line 36) +* patterns, types of: Pattern Overview. (line 14) +* pawk profiling Bell Labs awk: Other Versions. (line 88) +* PC operating systems, gawk on: PC Using. (line 6) +* PC operating systems, gawk on, installing: PC Installation. (line 6) +* percent sign (%), % operator: Precedence. (line 55) +* percent sign (%), %= operator <1>: Precedence. (line 96) +* percent sign (%), %= operator: Assignment Ops. (line 129) +* period (.): Regexp Operators. (line 43) +* PERL: Future Extensions. (line 6) +* Peters, Arno: Contributors. (line 74) +* Peterson, Hal: Contributors. (line 40) +* pgawk program: Profiling. (line 6) +* pgawk program, awkprof.out file: Profiling. (line 10) +* pgawk program, dynamic profiling: Profiling. (line 177) +* pipes, closing: Close Files And Pipes. + (line 6) +* pipes, input: Getline/Pipe. (line 6) +* pipes, output: Redirection. (line 54) +* plus sign (+): Regexp Operators. (line 101) +* plus sign (+), + operator: Precedence. (line 52) +* plus sign (+), ++ operator <1>: Precedence. (line 46) +* plus sign (+), ++ operator: Increment Ops. (line 40) +* plus sign (+), += operator <1>: Precedence. (line 96) +* plus sign (+), += operator: Assignment Ops. (line 82) +* plus sign (+), decrement/increment operators: Increment Ops. + (line 11) +* portability: Escape Sequences. (line 94) +* portability, #! (executable scripts): Executable Scripts. (line 34) +* portability, ** operator and: Arithmetic Ops. (line 81) +* portability, **= operator and: Assignment Ops. (line 142) +* portability, ARGV variable: Executable Scripts. (line 43) +* portability, backslash continuation and: Statements/Lines. (line 30) +* portability, backslash in escape sequences: Escape Sequences. + (line 113) +* portability, close function and: Close Files And Pipes. + (line 81) +* portability, data files as single record: Records. (line 170) +* portability, deleting array elements: Delete. (line 51) +* portability, example programs: Library Functions. (line 31) +* portability, fflush function and: I/O Functions. (line 29) +* portability, functions, defining: Definition Syntax. (line 88) +* portability, gawk: New Ports. (line 6) +* portability, gettext library and: Explaining gettext. (line 10) +* portability, internationalization and: I18N Portability. (line 6) +* portability, length function: String Functions. (line 80) +* portability, new awk vs. old awk: Conversion. (line 54) +* portability, next statement in user-defined functions: Function Caveats. + (line 99) +* portability, NF variable, decrementing: Changing Fields. (line 115) +* portability, operators: Increment Ops. (line 61) +* portability, operators, not in POSIX awk: Precedence. (line 100) +* portability, POSIXLY_CORRECT environment variable: Options. (line 300) +* portability, substr function: String Functions. (line 443) +* portable object files <1>: Translator i18n. (line 6) +* portable object files: Explaining gettext. (line 36) +* portable object files, converting to message object files: I18N Example. + (line 62) +* portable object files, generating: Options. (line 130) +* portal files: Portal Files. (line 6) +* porting gawk: New Ports. (line 6) +* positional specifiers, printf statement <1>: Printf Ordering. + (line 6) +* positional specifiers, printf statement: Format Modifiers. (line 13) +* positional specifiers, printf statement, mixing with regular formats: Printf Ordering. + (line 57) +* positive zero: Unexpected Results. (line 28) +* POSIX awk <1>: Assignment Ops. (line 136) +* POSIX awk: This Manual. (line 13) +* POSIX awk, **= operator and: Assignment Ops. (line 142) +* POSIX awk, < operator and: Getline/File. (line 26) +* POSIX awk, arithmetic operators and: Arithmetic Ops. (line 36) +* POSIX awk, backslashes in string constants: Escape Sequences. + (line 113) +* POSIX awk, BEGIN/END patterns: I/O And BEGIN/END. (line 16) +* POSIX awk, break statement and: Break Statement. (line 47) +* POSIX awk, changes in awk versions: POSIX. (line 6) +* POSIX awk, character lists and: Character Lists. (line 24) +* POSIX awk, character lists and, character classes: Character Lists. + (line 30) +* POSIX awk, continue statement and: Continue Statement. (line 43) +* POSIX awk, CONVFMT variable and: User-modified. (line 26) +* POSIX awk, date utility and: Time Functions. (line 259) +* POSIX awk, field separators and <1>: Field Splitting Summary. + (line 41) +* POSIX awk, field separators and: Fields. (line 6) +* POSIX awk, FS variable and: User-modified. (line 52) +* POSIX awk, function keyword in: Definition Syntax. (line 73) +* POSIX awk, functions and, gsub/sub: Gory Details. (line 53) +* POSIX awk, functions and, length: String Functions. (line 80) +* POSIX awk, GNU long options and: Options. (line 15) +* POSIX awk, interval expressions in: Regexp Operators. (line 134) +* POSIX awk, next/nextfile statements and: Next Statement. (line 39) +* POSIX awk, numeric strings and: Variable Typing. (line 6) +* POSIX awk, OFMT variable and <1>: Conversion. (line 54) +* POSIX awk, OFMT variable and: OFMT. (line 27) +* POSIX awk, period (.), using: Regexp Operators. (line 50) +* POSIX awk, printf format strings and: Format Modifiers. (line 159) +* POSIX awk, regular expressions and: Regexp Operators. (line 154) +* POSIX awk, timestamps and: Time Functions. (line 6) +* POSIX awk, | I/O operator and: Getline/Pipe. (line 52) +* POSIX mode: Options. (line 176) +* POSIX, awk and: Preface. (line 22) +* POSIX, gawk extensions not included in: POSIX/GNU. (line 6) +* POSIX, programs, implementing in awk: Clones. (line 6) +* POSIXLY_CORRECT environment variable: Options. (line 282) +* precedence <1>: Precedence. (line 6) +* precedence: Increment Ops. (line 61) +* precedence, regexp operators: Regexp Operators. (line 149) +* print statement: Printing. (line 16) +* print statement, BEGIN/END patterns and: I/O And BEGIN/END. (line 16) +* print statement, commas, omitting: Print Examples. (line 31) +* print statement, I/O operators in: Precedence. (line 72) +* print statement, line continuations and: Print Examples. (line 76) +* print statement, OFMT variable and: User-modified. (line 109) +* print statement, See Also redirection, of output: Redirection. + (line 14) +* print statement, sprintf function and: Round Function. (line 6) +* printf statement <1>: Printf. (line 6) +* printf statement: Printing. (line 16) +* printf statement, columns, aligning: Print Examples. (line 70) +* printf statement, format-control characters: Control Letters. + (line 6) +* printf statement, I/O operators in: Precedence. (line 72) +* printf statement, modifiers: Format Modifiers. (line 6) +* printf statement, positional specifiers <1>: Printf Ordering. + (line 6) +* printf statement, positional specifiers: Format Modifiers. (line 13) +* printf statement, positional specifiers, mixing with regular formats: Printf Ordering. + (line 57) +* printf statement, See Also redirection, of output: Redirection. + (line 14) +* printf statement, sprintf function and: Round Function. (line 6) +* printf statement, syntax of: Basic Printf. (line 6) +* printing: Printing. (line 6) +* printing, list of options: Options. (line 139) +* printing, mailing labels: Labels Program. (line 6) +* printing, unduplicated lines of text: Uniq Program. (line 6) +* printing, user information: Id Program. (line 6) +* private variables: Library Names. (line 11) +* process information, files for: Special Process. (line 6) +* processes, two-way communications with: Two-way I/O. (line 23) +* processing data: Basic High Level. (line 6) +* PROCINFO array <1>: Group Functions. (line 6) +* PROCINFO array <2>: Passwd Functions. (line 6) +* PROCINFO array <3>: Auto-set. (line 119) +* PROCINFO array: Special Caveats. (line 12) +* PROCINFO variable: Internals. (line 165) +* profiling awk programs: Profiling. (line 6) +* profiling awk programs, dynamically: Profiling. (line 177) +* profiling gawk, See pgawk program: Profiling. (line 6) +* program, definition of: Getting Started. (line 21) +* programmers, attractiveness of: Two-way I/O. (line 6) +* programming conventions, --non-decimal-data option: Nondecimal Data. + (line 36) +* programming conventions, ARGC/ARGV variables: Auto-set. (line 31) +* programming conventions, exit statement: Exit Statement. (line 36) +* programming conventions, function parameters: Return Statement. + (line 39) +* programming conventions, functions, calling: Calling Built-in. + (line 10) +* programming conventions, functions, writing: Definition Syntax. + (line 50) +* programming conventions, gawk internals: Internal File Ops. (line 33) +* programming conventions, nextfile statement: Nextfile Function. + (line 20) +* programming conventions, private variable names: Library Names. + (line 23) +* programming language, recipe for: History. (line 6) +* programming languages, data-driven vs. procedural: Getting Started. + (line 12) +* programming, basic steps: Basic High Level. (line 19) +* programming, concepts: Basic Concepts. (line 6) +* pwcat program: Passwd Functions. (line 23) +* question mark (?) <1>: GNU Regexp Operators. + (line 51) +* question mark (?): Regexp Operators. (line 110) +* question mark (?), ?: operator: Precedence. (line 93) +* QUIT signal (MS-DOS): Profiling. (line 210) +* quoting <1>: Comments. (line 27) +* quoting <2>: Long. (line 26) +* quoting: Read Terminal. (line 25) +* quoting, rules for: Quoting. (line 6) +* quoting, tricks for: Quoting. (line 67) +* Rakitzis, Byron: History Sorting. (line 25) +* rand function: Numeric Functions. (line 40) +* random numbers, Cliff: Cliff Random Function. + (line 6) +* random numbers, rand/srand functions: Numeric Functions. (line 40) +* random numbers, seed of: Numeric Functions. (line 70) +* range expressions: Character Lists. (line 6) +* range patterns: Ranges. (line 6) +* Rankin, Pat <1>: Bugs. (line 64) +* Rankin, Pat <2>: Contributors. (line 35) +* Rankin, Pat <3>: Assignment Ops. (line 100) +* Rankin, Pat: Acknowledgments. (line 53) +* raw sockets: TCP/IP Networking. (line 30) +* readable data files, checking: File Checking. (line 6) +* readable.awk program: File Checking. (line 11) +* recipe for a programming language: History. (line 6) +* record separators <1>: User-modified. (line 119) +* record separators: Records. (line 14) +* record separators, changing: Records. (line 81) +* record separators, regular expressions as: Records. (line 112) +* record separators, with multiline records: Multiple Line. (line 10) +* records <1>: Basic High Level. (line 71) +* records: Reading Files. (line 14) +* records, multiline: Multiple Line. (line 6) +* records, printing: Print. (line 22) +* records, splitting input into: Records. (line 6) +* records, terminating: Records. (line 112) +* records, treating files as: Records. (line 191) +* recursive functions: Definition Syntax. (line 68) +* redirection of input: Getline/File. (line 6) +* redirection of output: Redirection. (line 6) +* reference counting, sorting arrays: Array Sorting. (line 79) +* regexp constants <1>: Comparison Operators. + (line 102) +* regexp constants <2>: Regexp Constants. (line 6) +* regexp constants: Regexp Usage. (line 58) +* regexp constants, /=.../, /= operator and: Assignment Ops. (line 148) +* regexp constants, as patterns: Expression Patterns. (line 36) +* regexp constants, in gawk: Using Constant Regexps. + (line 28) +* regexp constants, slashes vs. quotes: Computed Regexps. (line 28) +* regexp constants, vs. string constants: Computed Regexps. (line 38) +* regexp, See regular expressions: Regexp. (line 6) +* register_deferred_variable internal function: Internals. (line 165) +* register_open_hook internal function: Internals. (line 178) +* regular expressions: Regexp. (line 6) +* regular expressions as field separators: Field Separators. (line 49) +* regular expressions, anchors in: Regexp Operators. (line 22) +* regular expressions, as field separators: Regexp Field Splitting. + (line 6) +* regular expressions, as patterns <1>: Regexp Patterns. (line 6) +* regular expressions, as patterns: Regexp Usage. (line 6) +* regular expressions, as record separators: Records. (line 112) +* regular expressions, case sensitivity <1>: User-modified. (line 68) +* regular expressions, case sensitivity: Case-sensitivity. (line 6) +* regular expressions, computed: Computed Regexps. (line 6) +* regular expressions, constants, See regexp constants: Regexp Usage. + (line 58) +* regular expressions, dynamic: Computed Regexps. (line 6) +* regular expressions, dynamic, with embedded newlines: Computed Regexps. + (line 59) +* regular expressions, gawk, command-line options: GNU Regexp Operators. + (line 62) +* regular expressions, interval expressions and: Options. (line 224) +* regular expressions, leftmost longest match: Leftmost Longest. + (line 6) +* regular expressions, operators <1>: Regexp Operators. (line 6) +* regular expressions, operators: Regexp Usage. (line 19) +* regular expressions, operators, for buffers: GNU Regexp Operators. + (line 40) +* regular expressions, operators, for words: GNU Regexp Operators. + (line 6) +* regular expressions, operators, gawk: GNU Regexp Operators. + (line 6) +* regular expressions, operators, precedence of: Regexp Operators. + (line 149) +* regular expressions, searching for: Egrep Program. (line 6) +* relational operators, See comparison operators: Typing and Comparison. + (line 9) +* return statement, user-defined functions: Return Statement. (line 6) +* return values, close function: Close Files And Pipes. + (line 130) +* rev user-defined function: Function Example. (line 52) +* rewind user-defined function: Rewind Function. (line 16) +* right angle bracket (>), > operator <1>: Precedence. (line 65) +* right angle bracket (>), > operator: Comparison Operators. + (line 11) +* right angle bracket (>), > operator (I/O): Redirection. (line 19) +* right angle bracket (>), >= operator <1>: Precedence. (line 65) +* right angle bracket (>), >= operator: Comparison Operators. + (line 11) +* right angle bracket (>), >> operator (I/O) <1>: Precedence. (line 65) +* right angle bracket (>), >> operator (I/O): Redirection. (line 47) +* right shift, bitwise: Bitwise Functions. (line 32) +* Ritchie, Dennis: Basic Data Typing. (line 71) +* RLENGTH variable: Auto-set. (line 163) +* RLENGTH variable, match function and: String Functions. (line 115) +* Robbins, Arnold <1>: Future Extensions. (line 6) +* Robbins, Arnold <2>: Bugs. (line 29) +* Robbins, Arnold <3>: Contributors. (line 92) +* Robbins, Arnold <4>: Alarm Program. (line 6) +* Robbins, Arnold <5>: Passwd Functions. (line 76) +* Robbins, Arnold <6>: Getline/Pipe. (line 36) +* Robbins, Arnold: Command Line Field Separator. + (line 80) +* Robbins, Bill: Getline/Pipe. (line 36) +* Robbins, Harry: Acknowledgments. (line 70) +* Robbins, Jean: Acknowledgments. (line 70) +* Robbins, Miriam <1>: Passwd Functions. (line 76) +* Robbins, Miriam <2>: Getline/Pipe. (line 36) +* Robbins, Miriam: Acknowledgments. (line 70) +* Robinson, Will: Dynamic Extensions. (line 6) +* robot, the: Dynamic Extensions. (line 6) +* Rommel, Kai Uwe <1>: Contributors. (line 42) +* Rommel, Kai Uwe: Acknowledgments. (line 53) +* round user-defined function: Round Function. (line 16) +* rounding: Round Function. (line 6) +* rounding numbers: Round Function. (line 6) +* RS variable <1>: User-modified. (line 119) +* RS variable: Records. (line 20) +* RS variable, multiline records and: Multiple Line. (line 17) +* rshift function (gawk): Bitwise Functions. (line 46) +* RSTART variable: Auto-set. (line 169) +* RSTART variable, match function and: String Functions. (line 115) +* RT variable <1>: Auto-set. (line 176) +* RT variable <2>: Multiple Line. (line 129) +* RT variable: Records. (line 112) +* Rubin, Paul <1>: Contributors. (line 16) +* Rubin, Paul: History. (line 30) +* rule, definition of: Getting Started. (line 21) +* rvalues/lvalues: Assignment Ops. (line 32) +* scalar values: Basic Data Typing. (line 13) +* Schreiber, Bert: Acknowledgments. (line 35) +* Schreiber, Rita: Acknowledgments. (line 35) +* search paths <1>: VMS Running. (line 28) +* search paths: PC Using. (line 11) +* search paths, for source files <1>: VMS Running. (line 28) +* search paths, for source files <2>: Igawk Program. (line 358) +* search paths, for source files: AWKPATH Variable. (line 6) +* searching: String Functions. (line 60) +* searching, files for regular expressions: Egrep Program. (line 6) +* searching, for words: Dupword Program. (line 6) +* sed utility <1>: Glossary. (line 12) +* sed utility <2>: Simple Sed. (line 6) +* sed utility: Field Splitting Summary. + (line 47) +* semicolon (;): Statements/Lines. (line 90) +* semicolon (;), AWKPATH variable and: PC Using. (line 11) +* semicolon (;), separating statements in actions <1>: Statements. + (line 10) +* semicolon (;), separating statements in actions: Action Overview. + (line 19) +* separators, field: User-modified. (line 43) +* separators, field, FIELDWIDTHS variable and: User-modified. (line 33) +* separators, field, POSIX and: Fields. (line 6) +* separators, for records: Records. (line 14) +* separators, for records, regular expressions as: Records. (line 112) +* separators, for statements in actions: Action Overview. (line 19) +* separators, record: User-modified. (line 119) +* separators, subscript: User-modified. (line 132) +* set_value internal function: Internals. (line 146) +* shells, piping commands into: Redirection. (line 140) +* shells, quoting: Using Shell Variables. + (line 12) +* shells, quoting, rules for: Quoting. (line 14) +* shells, scripts: One-shot. (line 22) +* shells, variables: Using Shell Variables. + (line 6) +* shift, bitwise: Bitwise Functions. (line 32) +* short-circuit operators: Boolean Ops. (line 57) +* side effects <1>: Increment Ops. (line 11) +* side effects: Concatenation. (line 42) +* side effects, array indexing: Reference to Elements. + (line 30) +* side effects, asort function: Array Sorting. (line 25) +* side effects, assignment expressions: Assignment Ops. (line 23) +* side effects, Boolean operators: Boolean Ops. (line 30) +* side effects, conditional expressions: Conditional Exp. (line 22) +* side effects, decrement/increment operators: Increment Ops. (line 11) +* side effects, FILENAME variable: Getline Notes. (line 19) +* side effects, function calls: Function Calls. (line 49) +* side effects, statements: Action Overview. (line 32) +* signals, HUP/SIGHUP: Profiling. (line 207) +* signals, INT/SIGINT (MS-DOS): Profiling. (line 210) +* signals, QUIT/SIGQUIT (MS-DOS): Profiling. (line 210) +* signals, USR1/SIGUSR1: Profiling. (line 185) +* sin function: Numeric Functions. (line 31) +* single quote (') <1>: Quoting. (line 27) +* single quote (') <2>: Long. (line 33) +* single quote ('): One-shot. (line 15) +* single quote ('), vs. apostrophe: Comments. (line 27) +* single quote ('), with double quotes: Quoting. (line 49) +* single-character fields: Single Character Fields. + (line 6) +* single-precision floating-point: Basic Data Typing. (line 33) +* Skywalker, Luke: Undocumented. (line 6) +* sleep utility: Alarm Program. (line 102) +* sockets: TCP/IP Networking. (line 30) +* Solaris, POSIX compliant awk: Other Versions. (line 96) +* sort function, arrays, sorting: Array Sorting. (line 6) +* sort utility: Word Sorting. (line 54) +* sort utility, coprocesses and: Two-way I/O. (line 84) +* sorting characters in different languages: Explaining gettext. + (line 89) +* source code, awka: Other Versions. (line 76) +* source code, Bell Laboratories awk: Other Versions. (line 13) +* source code, gawk: Gawk Distribution. (line 6) +* source code, mawk: Other Versions. (line 33) +* source code, mixing: Options. (line 231) +* source files, search path for: Igawk Program. (line 358) +* sparse arrays: Array Intro. (line 66) +* Spencer, Henry: Glossary. (line 12) +* split function: String Functions. (line 186) +* split function, array elements, deleting: Delete. (line 56) +* split utility: Split Program. (line 6) +* split.awk program: Split Program. (line 30) +* sprintf function <1>: String Functions. (line 239) +* sprintf function: OFMT. (line 15) +* sprintf function, OFMT variable and: User-modified. (line 109) +* sprintf function, print/printf statements and: Round Function. + (line 6) +* sqrt function: Numeric Functions. (line 18) +* square brackets ([]): Regexp Operators. (line 55) +* srand function: Numeric Functions. (line 80) +* Stallman, Richard <1>: Glossary. (line 284) +* Stallman, Richard <2>: Contributors. (line 24) +* Stallman, Richard <3>: Acknowledgments. (line 18) +* Stallman, Richard: Manual History. (line 6) +* standard input <1>: Special FD. (line 6) +* standard input: Read Terminal. (line 6) +* standard output: Special FD. (line 6) +* stat function, implementing in gawk: Sample Library. (line 6) +* statements, compound, control statements and: Statements. (line 10) +* statements, control, in actions: Statements. (line 6) +* statements, multiple: Statements/Lines. (line 90) +* stlen internal variable: Internals. (line 50) +* stptr internal variable: Internals. (line 50) +* stream editors <1>: Simple Sed. (line 6) +* stream editors: Field Splitting Summary. + (line 47) +* strftime function (gawk): Time Functions. (line 53) +* string constants: Scalar Constants. (line 15) +* string constants, vs. regexp constants: Computed Regexps. (line 38) +* string extraction (internationalization): String Extraction. + (line 6) +* string operators: Concatenation. (line 9) +* string-matching operators: Regexp Usage. (line 19) +* strings: Internals. (line 77) +* strings, converting: Conversion. (line 6) +* strings, converting, numbers to <1>: Bitwise Functions. (line 99) +* strings, converting, numbers to: User-modified. (line 26) +* strings, empty, See null strings: Records. (line 102) +* strings, extracting: String Extraction. (line 6) +* strings, for localization: Programmer i18n. (line 14) +* strings, length of: Scalar Constants. (line 20) +* strings, merging arrays into: Join Function. (line 6) +* strings, NODE internal type: Internals. (line 23) +* strings, null: Regexp Field Splitting. + (line 43) +* strings, numeric: Variable Typing. (line 6) +* strings, splitting: String Functions. (line 200) +* strtonum function (gawk): String Functions. (line 247) +* strtonum function (gawk), --non-decimal-data option and: Nondecimal Data. + (line 36) +* sub function <1>: String Functions. (line 268) +* sub function: Using Constant Regexps. + (line 44) +* sub function, arguments of: String Functions. (line 325) +* sub function, escape processing: Gory Details. (line 6) +* subscript separators: User-modified. (line 132) +* subscripts in arrays, multidimensional: Multi-dimensional. (line 6) +* subscripts in arrays, multidimensional, scanning: Multi-scanning. + (line 11) +* subscripts in arrays, numbers as: Numeric Array Subscripts. + (line 6) +* subscripts in arrays, uninitialized variables as: Uninitialized Subscripts. + (line 6) +* SUBSEP variable: User-modified. (line 132) +* SUBSEP variable, multidimensional arrays: Multi-dimensional. + (line 12) +* substr function: String Functions. (line 412) +* Sumner, Andrew: Other Versions. (line 76) +* switch statement: Switch Statement. (line 6) +* syntactic ambiguity: /= operator vs. /=.../ regexp constant: Assignment Ops. + (line 148) +* system function: I/O Functions. (line 63) +* systime function (gawk): Time Functions. (line 24) +* tandem: Tandem Installation. (line 6) +* Tcl: Library Names. (line 57) +* TCP/IP: TCP/IP Networking. (line 6) +* TCP/IP, support for: Special Network. (line 6) +* tee utility: Tee Program. (line 6) +* tee.awk program: Tee Program. (line 26) +* terminating records: Records. (line 112) +* testbits.awk program: Bitwise Functions. (line 60) +* Texinfo <1>: Adding Code. (line 99) +* Texinfo <2>: Distribution contents. + (line 68) +* Texinfo <3>: Extract Program. (line 12) +* Texinfo <4>: Dupword Program. (line 17) +* Texinfo <5>: Library Functions. (line 22) +* Texinfo <6>: Sample Data Files. (line 66) +* Texinfo: Conventions. (line 6) +* Texinfo, chapter beginnings in files: Regexp Operators. (line 22) +* Texinfo, extracting programs from source files: Extract Program. + (line 6) +* text, printing: Print. (line 22) +* text, printing, unduplicated lines of: Uniq Program. (line 6) +* textdomain function (C library): Explaining gettext. (line 27) +* TEXTDOMAIN variable <1>: Programmer i18n. (line 9) +* TEXTDOMAIN variable: User-modified. (line 138) +* TEXTDOMAIN variable, BEGIN pattern and: Programmer i18n. (line 58) +* TEXTDOMAIN variable, portability and: I18N Portability. (line 20) +* tilde (~), ~ operator <1>: Expression Patterns. (line 24) +* tilde (~), ~ operator <2>: Precedence. (line 81) +* tilde (~), ~ operator <3>: Comparison Operators. + (line 11) +* tilde (~), ~ operator <4>: Regexp Constants. (line 6) +* tilde (~), ~ operator <5>: Computed Regexps. (line 6) +* tilde (~), ~ operator <6>: Case-sensitivity. (line 26) +* tilde (~), ~ operator: Regexp Usage. (line 19) +* time, alarm clock example program: Alarm Program. (line 9) +* time, localization and: Explaining gettext. (line 111) +* time, managing: Gettimeofday Function. + (line 6) +* time, retrieving: Time Functions. (line 17) +* timestamps: Time Functions. (line 6) +* timestamps, converting dates to: Time Functions. (line 72) +* timestamps, formatted: Gettimeofday Function. + (line 6) +* tmp_number internal function: Internals. (line 92) +* tmp_string internal function: Internals. (line 87) +* tolower function: String Functions. (line 454) +* toupper function: String Functions. (line 460) +* tr utility: Translate Program. (line 6) +* translate.awk program: Translate Program. (line 55) +* troubleshooting, --non-decimal-data option: Options. (line 171) +* troubleshooting, -F option: Known Bugs. (line 6) +* troubleshooting, == operator: Comparison Operators. + (line 37) +* troubleshooting, awk uses FS not IFS: Field Separators. (line 28) +* troubleshooting, backslash before nonspecial character: Escape Sequences. + (line 113) +* troubleshooting, division: Arithmetic Ops. (line 44) +* troubleshooting, fatal errors, field widths, specifying: Constant Size. + (line 22) +* troubleshooting, fatal errors, printf format strings: Format Modifiers. + (line 159) +* troubleshooting, fflush function: I/O Functions. (line 51) +* troubleshooting, function call syntax: Function Calls. (line 28) +* troubleshooting, gawk <1>: Compatibility Mode. (line 6) +* troubleshooting, gawk: Known Bugs. (line 6) +* troubleshooting, gawk, bug reports: Bugs. (line 9) +* troubleshooting, gawk, fatal errors, function arguments: Calling Built-in. + (line 16) +* troubleshooting, getline function: File Checking. (line 24) +* troubleshooting, gsub/sub functions: String Functions. (line 335) +* troubleshooting, match function: String Functions. (line 181) +* troubleshooting, print statement, omitting commas: Print Examples. + (line 31) +* troubleshooting, printing: Redirection. (line 115) +* troubleshooting, quotes with file names: Special FD. (line 63) +* troubleshooting, readable data files: File Checking. (line 6) +* troubleshooting, regexp constants vs. string constants: Computed Regexps. + (line 38) +* troubleshooting, string concatenation: Concatenation. (line 27) +* troubleshooting, substr function: String Functions. (line 430) +* troubleshooting, system function: I/O Functions. (line 87) +* troubleshooting, typographical errors, global variables: Options. + (line 101) +* true, logical: Truth Values. (line 6) +* Trueman, David <1>: Contributors. (line 31) +* Trueman, David <2>: Acknowledgments. (line 44) +* Trueman, David: History. (line 30) +* trunc-mod operation: Arithmetic Ops. (line 66) +* truth values: Truth Values. (line 6) +* type conversion: Conversion. (line 21) +* type internal variable: Internals. (line 58) +* undefined functions: Function Caveats. (line 79) +* underscore (_), _ C macro: Explaining gettext. (line 68) +* underscore (_), in names of private variables: Library Names. + (line 29) +* underscore (_), translatable string: Programmer i18n. (line 67) +* undocumented features: Undocumented. (line 6) +* uninitialized variables, as array subscripts: Uninitialized Subscripts. + (line 6) +* uniq utility: Uniq Program. (line 6) +* uniq.awk program: Uniq Program. (line 65) +* Unix: Glossary. (line 582) +* Unix awk, backslashes in escape sequences: Escape Sequences. + (line 125) +* Unix awk, close function and: Close Files And Pipes. + (line 130) +* Unix awk, password files, field separators and: Command Line Field Separator. + (line 72) +* Unix, awk scripts and: Executable Scripts. (line 6) +* unsigned integers: Basic Data Typing. (line 28) +* update_ERRNO internal function: Internals. (line 152) +* update_ERRNO_saved internal function: Internals. (line 157) +* user database, reading: Passwd Functions. (line 6) +* user-defined, functions: User-defined. (line 6) +* user-defined, functions, counts: Profiling. (line 135) +* user-defined, variables: Variables. (line 6) +* user-modifiable variables: User-modified. (line 6) +* users, information about, printing: Id Program. (line 6) +* users, information about, retrieving: Passwd Functions. (line 16) +* USR1 signal: Profiling. (line 185) +* values, numeric: Basic Data Typing. (line 13) +* values, string: Basic Data Typing. (line 13) +* variable typing: Typing and Comparison. + (line 9) +* variables <1>: Basic Data Typing. (line 6) +* variables: Other Features. (line 6) +* variables, assigning on command line: Assignment Options. (line 6) +* variables, built-in <1>: Built-in Variables. (line 6) +* variables, built-in: Using Variables. (line 17) +* variables, built-in, -v option, setting with: Options. (line 38) +* variables, built-in, conveying information: Auto-set. (line 6) +* variables, flag: Boolean Ops. (line 67) +* variables, getline command into, using <1>: Getline/Variable/Coprocess. + (line 6) +* variables, getline command into, using <2>: Getline/Variable/Pipe. + (line 6) +* variables, getline command into, using <3>: Getline/Variable/File. + (line 6) +* variables, getline command into, using: Getline/Variable. (line 6) +* variables, global, for library functions: Library Names. (line 11) +* variables, global, printing list of: Options. (line 95) +* variables, initializing: Using Variables. (line 17) +* variables, names of: Arrays. (line 17) +* variables, private: Library Names. (line 11) +* variables, setting: Options. (line 30) +* variables, shadowing: Definition Syntax. (line 56) +* variables, types of: Assignment Ops. (line 40) +* variables, types of, comparison expressions and: Typing and Comparison. + (line 9) +* variables, uninitialized, as array subscripts: Uninitialized Subscripts. + (line 6) +* variables, user-defined: Variables. (line 6) +* vertical bar (|): Regexp Operators. (line 68) +* vertical bar (|), | operator (I/O) <1>: Precedence. (line 65) +* vertical bar (|), | operator (I/O): Getline/Pipe. (line 6) +* vertical bar (|), |& I/O operator (I/O): Two-way I/O. (line 44) +* vertical bar (|), |& operator (I/O) <1>: Precedence. (line 65) +* vertical bar (|), |& operator (I/O): Getline/Coprocess. (line 6) +* vertical bar (|), |& operator (I/O), two-way communications: Portal Files. + (line 10) +* vertical bar (|), || operator <1>: Precedence. (line 90) +* vertical bar (|), || operator: Boolean Ops. (line 57) +* vname internal variable: Internals. (line 62) +* w utility: Constant Size. (line 22) +* Wall, Larry: Future Extensions. (line 6) +* warnings, issuing: Options. (line 144) +* wc utility: Wc Program. (line 6) +* wc.awk program: Wc Program. (line 45) +* Weinberger, Peter <1>: Contributors. (line 12) +* Weinberger, Peter: History. (line 17) +* while statement <1>: While Statement. (line 6) +* while statement: Regexp Usage. (line 19) +* whitespace, as field separators: Field Separators. (line 63) +* whitespace, functions, calling: Calling Built-in. (line 10) +* whitespace, newlines as: Options. (line 183) +* Williams, Kent: Contributors. (line 37) +* Woods, John: Contributors. (line 28) +* word boundaries, matching: GNU Regexp Operators. + (line 30) +* word, regexp definition of: GNU Regexp Operators. + (line 6) +* word-boundary operator (gawk): GNU Regexp Operators. + (line 55) +* wordfreq.awk program: Word Sorting. (line 60) +* words, counting: Wc Program. (line 6) +* words, duplicate, searching for: Dupword Program. (line 6) +* words, usage counts, generating: Word Sorting. (line 6) +* xgettext utility: String Extraction. (line 13) +* XML: Internals. (line 178) +* XOR bitwise operation: Bitwise Functions. (line 6) +* xor function (gawk): Bitwise Functions. (line 41) +* Zaretskii, Eli: Acknowledgments. (line 53) +* zero, negative vs. positive: Unexpected Results. (line 28) +* zerofile.awk program: Empty Files. (line 21) +* Zoulas, Christos: Contributors. (line 61) +* {} (braces), actions and: Action Overview. (line 19) +* {} (braces), pgawk program: Profiling. (line 140) +* {} (braces), statements, grouping: Statements. (line 10) +* | (vertical bar): Regexp Operators. (line 68) +* | (vertical bar), | operator (I/O) <1>: Precedence. (line 65) +* | (vertical bar), | operator (I/O) <2>: Redirection. (line 54) +* | (vertical bar), | operator (I/O): Getline/Pipe. (line 6) +* | (vertical bar), |& operator (I/O) <1>: Two-way I/O. (line 44) +* | (vertical bar), |& operator (I/O) <2>: Precedence. (line 65) +* | (vertical bar), |& operator (I/O) <3>: Redirection. (line 99) +* | (vertical bar), |& operator (I/O): Getline/Coprocess. (line 6) +* | (vertical bar), |& operator (I/O), pipes, closing: Close Files And Pipes. + (line 117) +* | (vertical bar), |& operator (I/O), two-way communications: Portal Files. + (line 10) +* | (vertical bar), || operator <1>: Precedence. (line 90) +* | (vertical bar), || operator: Boolean Ops. (line 57) +* ~ (tilde), ~ operator <1>: Expression Patterns. (line 24) +* ~ (tilde), ~ operator <2>: Precedence. (line 81) +* ~ (tilde), ~ operator <3>: Comparison Operators. + (line 11) +* ~ (tilde), ~ operator <4>: Regexp Constants. (line 6) +* ~ (tilde), ~ operator <5>: Computed Regexps. (line 6) +* ~ (tilde), ~ operator: Case-sensitivity. (line 26) + + + +Tag Table: +Node: Top1336 +Node: Foreword27371 +Node: Preface31692 +Ref: Preface-Footnote-134571 +Node: History34803 +Node: Names37019 +Ref: Names-Footnote-138491 +Node: This Manual38563 +Ref: This Manual-Footnote-143318 +Node: Conventions43418 +Node: Manual History45292 +Ref: Manual History-Footnote-148745 +Ref: Manual History-Footnote-248786 +Node: How To Contribute48860 +Node: Acknowledgments49458 +Node: Getting Started53260 +Node: Running gawk55632 +Node: One-shot56818 +Node: Read Terminal58043 +Ref: Read Terminal-Footnote-159701 +Node: Long59872 +Node: Executable Scripts61248 +Ref: Executable Scripts-Footnote-163144 +Ref: Executable Scripts-Footnote-263295 +Node: Comments63746 +Node: Quoting66114 +Node: Sample Data Files70615 +Node: Very Simple73647 +Node: Two Rules78252 +Node: More Complex80399 +Ref: More Complex-Footnote-183322 +Ref: More Complex-Footnote-283770 +Node: Statements/Lines83853 +Ref: Statements/Lines-Footnote-188235 +Node: Other Features88500 +Node: When89352 +Ref: When-Footnote-191591 +Node: Regexp91676 +Node: Regexp Usage93130 +Node: Escape Sequences95182 +Node: Regexp Operators100921 +Ref: Regexp Operators-Footnote-1108028 +Ref: Regexp Operators-Footnote-2108175 +Node: Character Lists108273 +Ref: table-char-classes110230 +Node: GNU Regexp Operators112855 +Node: Case-sensitivity116499 +Ref: Case-sensitivity-Footnote-1119672 +Node: Leftmost Longest119907 +Node: Computed Regexps121098 +Node: Locales124479 +Node: Reading Files126745 +Node: Records128502 +Ref: Records-Footnote-1137060 +Node: Fields137097 +Ref: Fields-Footnote-1140127 +Node: Nonconstant Fields140213 +Node: Changing Fields142415 +Node: Field Separators147696 +Node: Regexp Field Splitting151187 +Node: Single Character Fields153652 +Node: Command Line Field Separator154703 +Node: Field Splitting Summary158142 +Ref: Field Splitting Summary-Footnote-1161328 +Node: Constant Size161429 +Node: Multiple Line165906 +Ref: Multiple Line-Footnote-1171637 +Node: Getline171816 +Node: Plain Getline173884 +Node: Getline/Variable175901 +Node: Getline/File177042 +Node: Getline/Variable/File178366 +Node: Getline/Pipe179925 +Node: Getline/Variable/Pipe182522 +Node: Getline/Coprocess183629 +Node: Getline/Variable/Coprocess184872 +Node: Getline Notes185586 +Node: Getline Summary187229 +Ref: table-getline-variants187513 +Node: Printing188079 +Node: Print189708 +Node: Print Examples191034 +Node: Output Separators193829 +Node: OFMT195590 +Node: Printf196945 +Node: Basic Printf197864 +Node: Control Letters199399 +Node: Format Modifiers202617 +Node: Printf Examples208635 +Node: Redirection211352 +Node: Special Files218249 +Node: Special FD218883 +Node: Special Process221909 +Node: Special Network224144 +Node: Special Caveats224986 +Ref: Special Caveats-Footnote-1226184 +Node: Close Files And Pipes226567 +Ref: Close Files And Pipes-Footnote-1233488 +Ref: Close Files And Pipes-Footnote-2233636 +Node: Expressions233784 +Node: Constants235973 +Node: Scalar Constants236654 +Ref: Scalar Constants-Footnote-1237509 +Node: Nondecimal-numbers237691 +Node: Regexp Constants240749 +Node: Using Constant Regexps241222 +Node: Variables244305 +Node: Using Variables244961 +Node: Assignment Options246471 +Node: Conversion248348 +Ref: table-locale-affects253780 +Ref: Conversion-Footnote-1254404 +Node: Arithmetic Ops254513 +Node: Concatenation257025 +Ref: Concatenation-Footnote-1259807 +Node: Assignment Ops259898 +Ref: table-assign-ops264876 +Node: Increment Ops266277 +Node: Truth Values269770 +Node: Typing and Comparison270820 +Node: Variable Typing271523 +Ref: Variable Typing-Footnote-1275198 +Node: Comparison Operators275342 +Ref: table-relational-ops275718 +Node: Boolean Ops279267 +Ref: Boolean Ops-Footnote-1283327 +Node: Conditional Exp283418 +Node: Function Calls285155 +Node: Precedence288437 +Node: Patterns and Actions292093 +Node: Pattern Overview293147 +Node: Regexp Patterns294584 +Node: Expression Patterns295127 +Node: Ranges298677 +Node: BEGIN/END301766 +Node: Using BEGIN/END302516 +Ref: Using BEGIN/END-Footnote-1305248 +Node: I/O And BEGIN/END305362 +Node: Empty307629 +Node: Using Shell Variables307937 +Node: Action Overview310218 +Node: Statements312576 +Node: If Statement314432 +Node: While Statement315931 +Node: Do Statement317963 +Node: For Statement319112 +Node: Switch Statement322252 +Node: Break Statement324528 +Node: Continue Statement326585 +Node: Next Statement328489 +Node: Nextfile Statement330769 +Node: Exit Statement333366 +Node: Built-in Variables335437 +Node: User-modified336532 +Ref: User-modified-Footnote-1343775 +Node: Auto-set343837 +Ref: Auto-set-Footnote-1352177 +Node: ARGC and ARGV352382 +Node: Arrays356094 +Node: Array Intro358002 +Node: Reference to Elements362199 +Node: Assigning Elements364066 +Node: Array Example364533 +Node: Scanning an Array366255 +Node: Delete368522 +Ref: Delete-Footnote-1370904 +Node: Numeric Array Subscripts370961 +Node: Uninitialized Subscripts373148 +Node: Multi-dimensional374754 +Node: Multi-scanning377767 +Node: Array Sorting379382 +Node: Functions383045 +Node: Built-in383780 +Node: Calling Built-in384750 +Node: Numeric Functions386717 +Ref: Numeric Functions-Footnote-1390459 +Ref: Numeric Functions-Footnote-2390785 +Node: String Functions391054 +Ref: String Functions-Footnote-1410916 +Ref: String Functions-Footnote-2411045 +Ref: String Functions-Footnote-3411293 +Node: Gory Details411380 +Ref: table-sub-escapes413015 +Ref: table-sub-posix-92414350 +Ref: table-sub-proposed415689 +Ref: table-posix-2001-sub417041 +Ref: table-gensub-escapes418378 +Ref: Gory Details-Footnote-1419564 +Node: I/O Functions419615 +Ref: I/O Functions-Footnote-1426189 +Node: Time Functions426280 +Ref: Time Functions-Footnote-1437072 +Ref: Time Functions-Footnote-2437140 +Ref: Time Functions-Footnote-3437298 +Ref: Time Functions-Footnote-4437409 +Ref: Time Functions-Footnote-5437534 +Ref: Time Functions-Footnote-6437761 +Node: Bitwise Functions438023 +Ref: table-bitwise-ops438601 +Ref: Bitwise Functions-Footnote-1442835 +Node: I18N Functions443019 +Node: User-defined444740 +Node: Definition Syntax445521 +Node: Function Example449880 +Node: Function Caveats452460 +Node: Return Statement456385 +Node: Dynamic Typing459042 +Node: Internationalization459779 +Node: I18N and L10N461198 +Node: Explaining gettext461882 +Ref: Explaining gettext-Footnote-1466789 +Ref: Explaining gettext-Footnote-2467028 +Node: Programmer i18n467197 +Node: Translator i18n471420 +Node: String Extraction472210 +Ref: String Extraction-Footnote-1473160 +Node: Printf Ordering473286 +Ref: Printf Ordering-Footnote-1476064 +Node: I18N Portability476128 +Ref: I18N Portability-Footnote-1478556 +Node: I18N Example478619 +Ref: I18N Example-Footnote-1481231 +Node: Gawk I18N481303 +Node: Advanced Features481885 +Node: Nondecimal Data483284 +Node: Two-way I/O484843 +Ref: Two-way I/O-Footnote-1490324 +Node: TCP/IP Networking490401 +Node: Portal Files492830 +Node: Profiling493474 +Node: Invoking Gawk500930 +Node: Command Line502110 +Node: Options502895 +Ref: Options-Footnote-1515735 +Node: Other Arguments515760 +Node: AWKPATH Variable518441 +Ref: AWKPATH Variable-Footnote-1521213 +Node: Obsolete521473 +Node: Undocumented522473 +Node: Known Bugs522735 +Node: Library Functions523337 +Ref: Library Functions-Footnote-1526318 +Node: Library Names526489 +Ref: Library Names-Footnote-1529962 +Ref: Library Names-Footnote-2530181 +Node: General Functions530267 +Node: Nextfile Function531326 +Node: Strtonum Function535690 +Node: Assert Function538625 +Node: Round Function541929 +Node: Cliff Random Function543436 +Ref: Cliff Random Function-Footnote-1544425 +Node: Ordinal Functions544496 +Ref: Ordinal Functions-Footnote-1547556 +Node: Join Function547772 +Ref: Join Function-Footnote-1549532 +Node: Gettimeofday Function549732 +Node: Data File Management553435 +Node: Filetrans Function554067 +Node: Rewind Function557493 +Node: File Checking558939 +Node: Empty Files559991 +Node: Ignoring Assigns562216 +Node: Getopt Function563764 +Ref: Getopt Function-Footnote-1575042 +Node: Passwd Functions575243 +Ref: Passwd Functions-Footnote-1583904 +Node: Group Functions583992 +Node: Sample Programs591990 +Node: Running Examples592667 +Node: Clones593395 +Node: Cut Program594527 +Node: Egrep Program604284 +Ref: Egrep Program-Footnote-1612034 +Node: Id Program612144 +Node: Split Program615751 +Node: Tee Program619215 +Node: Uniq Program621892 +Node: Wc Program629260 +Ref: Wc Program-Footnote-1633504 +Node: Miscellaneous Programs633700 +Node: Dupword Program634696 +Node: Alarm Program636727 +Node: Translate Program641267 +Ref: Translate Program-Footnote-1645513 +Ref: Translate Program-Footnote-2645750 +Node: Labels Program645884 +Ref: Labels Program-Footnote-1649175 +Node: Word Sorting649259 +Node: History Sorting653542 +Node: Extract Program655380 +Node: Simple Sed662732 +Node: Igawk Program665787 +Ref: Igawk Program-Footnote-1680492 +Ref: Igawk Program-Footnote-2680693 +Node: Language History680831 +Node: V7/SVR3.1682215 +Node: SVR4684479 +Node: POSIX685918 +Node: BTL687526 +Node: POSIX/GNU689051 +Node: Contributors696885 +Node: Installation700421 +Node: Gawk Distribution701392 +Node: Getting701876 +Node: Extracting703110 +Node: Distribution contents704498 +Node: Unix Installation709579 +Node: Quick Installation710170 +Node: Additional Configuration Options711872 +Node: Configuration Philosophy713734 +Node: Non-Unix Installation716098 +Node: Amiga Installation716685 +Node: BeOS Installation717781 +Node: PC Installation718934 +Node: PC Binary Installation720164 +Node: PC Compiling722007 +Node: PC Dynamic726559 +Node: PC Using728920 +Node: Cygwin733533 +Ref: Cygwin-Footnote-1734531 +Node: VMS Installation734563 +Node: VMS Compilation735167 +Node: VMS Installation Details736744 +Node: VMS Running738374 +Node: VMS POSIX739971 +Node: VMS Old Gawk741269 +Node: Unsupported741738 +Node: Atari Installation742141 +Node: Atari Compiling743430 +Node: Atari Using745315 +Node: Tandem Installation748160 +Node: Bugs749840 +Node: Other Versions753145 +Ref: Other Versions-Footnote-1757571 +Ref: Other Versions-Footnote-2757613 +Ref: Other Versions-Footnote-3757650 +Node: Notes757688 +Node: Compatibility Mode758380 +Node: Additions759174 +Node: Adding Code759924 +Node: New Ports765974 +Node: Dynamic Extensions770106 +Node: Internals771363 +Node: Sample Library782366 +Node: Internal File Description783025 +Node: Internal File Ops786718 +Ref: Internal File Ops-Footnote-1792044 +Node: Using Internal File Ops792192 +Node: Future Extensions794215 +Node: Basic Concepts798168 +Node: Basic High Level798925 +Ref: Basic High Level-Footnote-1802957 +Node: Basic Data Typing803151 +Node: Floating Point Issues807588 +Ref: Floating Point Issues-Footnote-1808674 +Node: String Conversion Precision808727 +Ref: String Conversion Precision-Footnote-1810421 +Node: Unexpected Results810530 +Node: POSIX Floating Point Problems812356 +Ref: POSIX Floating Point Problems-Footnote-1815830 +Node: Glossary815868 +Node: Copying839636 +Node: GNU Free Documentation License877193 +Node: Index899595 + +End Tag Table diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawkinet.info b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawkinet.info new file mode 100644 index 0000000..a496f6a --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/doc/gawkinet.info @@ -0,0 +1,4404 @@ +INFO-DIR-SECTION Network applications +START-INFO-DIR-ENTRY +This is gawkinet.info, produced by makeinfo version 4.11 from gawkinet.texi. + +* Gawkinet: (gawkinet). TCP/IP Internetworking With `gawk'. +END-INFO-DIR-ENTRY + + This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the +3.1.4 (or later) version of the GNU implementation of AWK. + + + Copyright (C) 2000, 2001, 2002, 2004 Free Software Foundation, Inc. + + + Permission is granted to copy, distribute and/or modify this document +under the terms of the GNU Free Documentation License, Version 1.2 or +any later version published by the Free Software Foundation; with the +Invariant Sections being "GNU General Public License", the Front-Cover +texts being (a) (see below), and with the Back-Cover Texts being (b) +(see below). A copy of the license is included in the section entitled +"GNU Free Documentation License". + + a. "A GNU Manual" + + b. "You have freedom to copy and modify this GNU Manual, like GNU + software. Copies published by the Free Software Foundation raise + funds for GNU development." + + This file documents the networking features in GNU `awk'. + + This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the +3.1.4 (or later) version of the GNU implementation of AWK. + + + Copyright (C) 2000, 2001, 2002, 2004 Free Software Foundation, Inc. + + + Permission is granted to copy, distribute and/or modify this document +under the terms of the GNU Free Documentation License, Version 1.2 or +any later version published by the Free Software Foundation; with the +Invariant Sections being "GNU General Public License", the Front-Cover +texts being (a) (see below), and with the Back-Cover Texts being (b) +(see below). A copy of the license is included in the section entitled +"GNU Free Documentation License". + + a. "A GNU Manual" + + b. "You have freedom to copy and modify this GNU Manual, like GNU + software. Copies published by the Free Software Foundation raise + funds for GNU development." + + +File: gawkinet.info, Node: Top, Next: Preface, Prev: (dir), Up: (dir) + +General Introduction +******************** + +This file documents the networking features in GNU Awk (`gawk') version +3.1 and later. + + This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the +3.1.4 (or later) version of the GNU implementation of AWK. + + + Copyright (C) 2000, 2001, 2002, 2004 Free Software Foundation, Inc. + + + Permission is granted to copy, distribute and/or modify this document +under the terms of the GNU Free Documentation License, Version 1.2 or +any later version published by the Free Software Foundation; with the +Invariant Sections being "GNU General Public License", the Front-Cover +texts being (a) (see below), and with the Back-Cover Texts being (b) +(see below). A copy of the license is included in the section entitled +"GNU Free Documentation License". + + a. "A GNU Manual" + + b. "You have freedom to copy and modify this GNU Manual, like GNU + software. Copies published by the Free Software Foundation raise + funds for GNU development." + +* Menu: + +* Preface:: About this document. +* Introduction:: About networking. +* Using Networking:: Some examples. +* Some Applications and Techniques:: More extended examples. +* Links:: Where to find the stuff mentioned in this + document. +* GNU Free Documentation License:: The license for this document. +* Index:: The index. + +* Stream Communications:: Sending data streams. +* Datagram Communications:: Sending self-contained messages. +* The TCP/IP Protocols:: How these models work in the Internet. +* Basic Protocols:: The basic protocols. +* Ports:: The idea behind ports. +* Making Connections:: Making TCP/IP connections. +* Gawk Special Files:: How to do `gawk' networking. +* Special File Fields:: The fields in the special file name. +* Comparing Protocols:: Differences between the protocols. +* File /inet/tcp:: The TCP special file. +* File /inet/udp:: The UDP special file. +* File /inet/raw:: The RAW special file. +* TCP Connecting:: Making a TCP connection. +* Troubleshooting:: Troubleshooting TCP/IP connections. +* Interacting:: Interacting with a service. +* Setting Up:: Setting up a service. +* Email:: Reading email. +* Web page:: Reading a Web page. +* Primitive Service:: A primitive Web service. +* Interacting Service:: A Web service with interaction. +* CGI Lib:: A simple CGI library. +* Simple Server:: A simple Web server. +* Caveats:: Network programming caveats. +* Challenges:: Where to go from here. +* PANIC:: An Emergency Web Server. +* GETURL:: Retrieving Web Pages. +* REMCONF:: Remote Configuration Of Embedded Systems. +* URLCHK:: Look For Changed Web Pages. +* WEBGRAB:: Extract Links From A Page. +* STATIST:: Graphing A Statistical Distribution. +* MAZE:: Walking Through A Maze In Virtual Reality. +* MOBAGWHO:: A Simple Mobile Agent. +* STOXPRED:: Stock Market Prediction As A Service. +* PROTBASE:: Searching Through A Protein Database. + + +File: gawkinet.info, Node: Preface, Next: Introduction, Prev: Top, Up: Top + +Preface +******* + +In May of 1997, Ju"rgen Kahrs felt the need for network access from +`awk', and, with a little help from me, set about adding features to do +this for `gawk'. At that time, he wrote the bulk of this Info file. + + The code and documentation were added to the `gawk' 3.1 development +tree, and languished somewhat until I could finally get down to some +serious work on that version of `gawk'. This finally happened in the +middle of 2000. + + Meantime, Ju"rgen wrote an article about the Internet special files +and `|&' operator for `Linux Journal', and made a networking patch for +the production versions of `gawk' available from his home page. In +August of 2000 (for `gawk' 3.0.6), this patch also made it to the main +GNU `ftp' distribution site. + + For release with `gawk', I edited Ju"rgen's prose for English +grammar and style, as he is not a native English speaker. I also +rearranged the material somewhat for what I felt was a better order of +presentation, and (re)wrote some of the introductory material. + + The majority of this document and the code are his work, and the +high quality and interesting ideas speak for themselves. It is my hope +that these features will be of significant value to the `awk' community. + + +Arnold Robbins +Nof Ayalon, ISRAEL +March, 2001 + + +File: gawkinet.info, Node: Introduction, Next: Using Networking, Prev: Preface, Up: Top + +1 Networking Concepts +********************* + +This major node provides a (necessarily) brief introduction to computer +networking concepts. For many applications of `gawk' to TCP/IP +networking, we hope that this is enough. For more advanced tasks, you +will need deeper background, and it may be necessary to switch to +lower-level programming in C or C++. + + There are two real-life models for the way computers send messages +to each other over a network. While the analogies are not perfect, +they are close enough to convey the major concepts. These two models +are the phone system (reliable byte-stream communications), and the +postal system (best-effort datagrams). + +* Menu: + +* Stream Communications:: Sending data streams. +* Datagram Communications:: Sending self-contained messages. +* The TCP/IP Protocols:: How these models work in the Internet. +* Making Connections:: Making TCP/IP connections. + + +File: gawkinet.info, Node: Stream Communications, Next: Datagram Communications, Prev: Introduction, Up: Introduction + +1.1 Reliable Byte-streams (Phone Calls) +======================================= + +When you make a phone call, the following steps occur: + + 1. You dial a number. + + 2. The phone system connects to the called party, telling them there + is an incoming call. (Their phone rings.) + + 3. The other party answers the call, or, in the case of a computer + network, refuses to answer the call. + + 4. Assuming the other party answers, the connection between you is + now a "duplex" (two-way), "reliable" (no data lost), sequenced + (data comes out in the order sent) data stream. + + 5. You and your friend may now talk freely, with the phone system + moving the data (your voices) from one end to the other. From + your point of view, you have a direct end-to-end connection with + the person on the other end. + + The same steps occur in a duplex reliable computer networking +connection. There is considerably more overhead in setting up the +communications, but once it's done, data moves in both directions, +reliably, in sequence. + + +File: gawkinet.info, Node: Datagram Communications, Next: The TCP/IP Protocols, Prev: Stream Communications, Up: Introduction + +1.2 Best-effort Datagrams (Mailed Letters) +========================================== + +Suppose you mail three different documents to your office on the other +side of the country on two different days. Doing so entails the +following. + + 1. Each document travels in its own envelope. + + 2. Each envelope contains both the sender and the recipient address. + + 3. Each envelope may travel a different route to its destination. + + 4. The envelopes may arrive in a different order from the one in + which they were sent. + + 5. One or more may get lost in the mail. (Although, fortunately, + this does not occur very often.) + + 6. In a computer network, one or more "packets" may also arrive + multiple times. (This doesn't happen with the postal system!) + + + The important characteristics of datagram communications, like those +of the postal system are thus: + + * Delivery is "best effort;" the data may never get there. + + * Each message is self-contained, including the source and + destination addresses. + + * Delivery is _not_ sequenced; packets may arrive out of order, + and/or multiple times. + + * Unlike the phone system, overhead is considerably lower. It is + not necessary to set up the call first. + + The price the user pays for the lower overhead of datagram +communications is exactly the lower reliability; it is often necessary +for user-level protocols that use datagram communications to add their +own reliability features on top of the basic communications. + + +File: gawkinet.info, Node: The TCP/IP Protocols, Next: Making Connections, Prev: Datagram Communications, Up: Introduction + +1.3 The Internet Protocols +========================== + +The Internet Protocol Suite (usually referred to as just TCP/IP)(1) +consists of a number of different protocols at different levels or +"layers." For our purposes, three protocols provide the fundamental +communications mechanisms. All other defined protocols are referred to +as user-level protocols (e.g., HTTP, used later in this Info file). + +* Menu: + +* Basic Protocols:: The basic protocols. +* Ports:: The idea behind ports. + + ---------- Footnotes ---------- + + (1) It should be noted that although the Internet seems to have +conquered the world, there are other networking protocol suites in +existence and in use. + + +File: gawkinet.info, Node: Basic Protocols, Next: Ports, Prev: The TCP/IP Protocols, Up: The TCP/IP Protocols + +1.3.1 The Basic Internet Protocols +---------------------------------- + +IP + The Internet Protocol. This protocol is almost never used + directly by applications. It provides the basic packet delivery + and routing infrastructure of the Internet. Much like the phone + company's switching centers or the Post Office's trucks, it is not + of much day-to-day interest to the regular user (or programmer). + It happens to be a best effort datagram protocol. + +UDP + The User Datagram Protocol. This is a best effort datagram + protocol. It provides a small amount of extra reliability over + IP, and adds the notion of "ports", described in *note TCP and UDP + Ports: Ports. + +TCP + The Transmission Control Protocol. This is a duplex, reliable, + sequenced byte-stream protocol, again layered on top of IP, and + also providing the notion of ports. This is the protocol that you + will most likely use when using `gawk' for network programming. + + All other user-level protocols use either TCP or UDP to do their +basic communications. Examples are SMTP (Simple Mail Transfer +Protocol), FTP (File Transfer Protocol), and HTTP (HyperText Transfer +Protocol). + + +File: gawkinet.info, Node: Ports, Prev: Basic Protocols, Up: The TCP/IP Protocols + +1.3.2 TCP and UDP Ports +----------------------- + +In the postal system, the address on an envelope indicates a physical +location, such as a residence or office building. But there may be +more than one person at a location; thus you have to further quantify +the recipient by putting a person or company name on the envelope. + + In the phone system, one phone number may represent an entire +company, in which case you need a person's extension number in order to +reach that individual directly. Or, when you call a home, you have to +say, "May I please speak to ..." before talking to the person directly. + + IP networking provides the concept of addressing. An IP address +represents a particular computer, but no more. In order to reach the +mail service on a system, or the FTP or WWW service on a system, you +must have some way to further specify which service you want. In the +Internet Protocol suite, this is done with "port numbers", which +represent the services, much like an extension number used with a phone +number. + + Port numbers are 16-bit integers. Unix and Unix-like systems +reserve ports below 1024 for "well known" services, such as SMTP, FTP, +and HTTP. Numbers 1024 and above may be used by any application, +although there is no promise made that a particular port number is +always available. + + +File: gawkinet.info, Node: Making Connections, Prev: The TCP/IP Protocols, Up: Introduction + +1.4 Making TCP/IP Connections (And Some Terminology) +==================================================== + +Two terms come up repeatedly when discussing networking: "client" and +"server". For now, we'll discuss these terms at the "connection +level", when first establishing connections between two processes on +different systems over a network. (Once the connection is established, +the higher level, or "application level" protocols, such as HTTP or +FTP, determine who is the client and who is the server. Often, it +turns out that the client and server are the same in both roles.) + + The "server" is the system providing the service, such as the web +server or email server. It is the "host" (system) which is _connected +to_ in a transaction. For this to work though, the server must be +expecting connections. Much as there has to be someone at the office +building to answer the phone(1), the server process (usually) has to be +started first and be waiting for a connection. + + The "client" is the system requesting the service. It is the system +_initiating the connection_ in a transaction. (Just as when you pick +up the phone to call an office or store.) + + In the TCP/IP framework, each end of a connection is represented by +a pair of (ADDRESS, PORT) pairs. For the duration of the connection, +the ports in use at each end are unique, and cannot be used +simultaneously by other processes on the same system. (Only after +closing a connection can a new one be built up on the same port. This +is contrary to the usual behavior of fully developed web servers which +have to avoid situations in which they are not reachable. We have to +pay this price in order to enjoy the benefits of a simple communication +paradigm in `gawk'.) + + Furthermore, once the connection is established, communications are +"synchronous".(2) I.e., each end waits on the other to finish +transmitting, before replying. This is much like two people in a phone +conversation. While both could talk simultaneously, doing so usually +doesn't work too well. + + In the case of TCP, the synchronicity is enforced by the protocol +when sending data. Data writes "block" until the data have been +received on the other end. For both TCP and UDP, data reads block +until there is incoming data waiting to be read. This is summarized in +the following table, where an "X" indicates that the given action +blocks. + +TCP X X +UDP X +RAW X + + ---------- Footnotes ---------- + + (1) In the days before voice mail systems! + + (2) For the technically savvy, data reads block--if there's no +incoming data, the program is made to wait until there is, instead of +receiving a "there's no data" error return. + + +File: gawkinet.info, Node: Using Networking, Next: Some Applications and Techniques, Prev: Introduction, Up: Top + +2 Networking With `gawk' +************************ + +The `awk' programming language was originally developed as a +pattern-matching language for writing short programs to perform data +manipulation tasks. `awk''s strength is the manipulation of textual +data that is stored in files. It was never meant to be used for +networking purposes. To exploit its features in a networking context, +it's necessary to use an access mode for network connections that +resembles the access of files as closely as possible. + + `awk' is also meant to be a prototyping language. It is used to +demonstrate feasibility and to play with features and user interfaces. +This can be done with file-like handling of network connections. +`gawk' trades the lack of many of the advanced features of the TCP/IP +family of protocols for the convenience of simple connection handling. +The advanced features are available when programming in C or Perl. In +fact, the network programming in this major node is very similar to +what is described in books such as `Internet Programming with Python', +`Advanced Perl Programming', or `Web Client Programming with Perl'. + + However, you can do the programming here without first having to +learn object-oriented ideology; underlying languages such as Tcl/Tk, +Perl, Python; or all of the libraries necessary to extend these +languages before they are ready for the Internet. + + This major node demonstrates how to use the TCP protocol. The other +protocols are much less important for most users (UDP) or even +untractable (RAW). + +* Menu: + +* Gawk Special Files:: How to do `gawk' networking. +* TCP Connecting:: Making a TCP connection. +* Troubleshooting:: Troubleshooting TCP/IP connections. +* Interacting:: Interacting with a service. +* Setting Up:: Setting up a service. +* Email:: Reading email. +* Web page:: Reading a Web page. +* Primitive Service:: A primitive Web service. +* Interacting Service:: A Web service with interaction. +* Simple Server:: A simple Web server. +* Caveats:: Network programming caveats. +* Challenges:: Where to go from here. + + +File: gawkinet.info, Node: Gawk Special Files, Next: TCP Connecting, Prev: Using Networking, Up: Using Networking + +2.1 `gawk''s Networking Mechanisms +================================== + +The `|&' operator introduced in `gawk' 3.1 for use in communicating +with a "coprocess" is described in *note Two-way Communications With +Another Process: (gawk)Two-way I/O. It shows how to do two-way I/O to a +separate process, sending it data with `print' or `printf' and reading +data with `getline'. If you haven't read it already, you should detour +there to do so. + + `gawk' transparently extends the two-way I/O mechanism to simple +networking through the use of special file names. When a "coprocess" +that matches the special files we are about to describe is started, +`gawk' creates the appropriate network connection, and then two-way I/O +proceeds as usual. + + At the C, C++, and Perl level, networking is accomplished via +"sockets", an Application Programming Interface (API) originally +developed at the University of California at Berkeley that is now used +almost universally for TCP/IP networking. Socket level programming, +while fairly straightforward, requires paying attention to a number of +details, as well as using binary data. It is not well-suited for use +from a high-level language like `awk'. The special files provided in +`gawk' hide the details from the programmer, making things much simpler +and easier to use. + + The special file name for network access is made up of several +fields, all of which are mandatory: + + /inet/PROTOCOL/LOCALPORT/HOSTNAME/REMOTEPORT + + The `/inet/' field is, of course, constant when accessing the +network. The LOCALPORT and REMOTEPORT fields do not have a meaning +when used with `/inet/raw' because "ports" only apply to TCP and UDP. +So, when using `/inet/raw', the port fields always have to be `0'. + +* Menu: + +* Special File Fields:: The fields in the special file name. +* Comparing Protocols:: Differences between the protocols. + + +File: gawkinet.info, Node: Special File Fields, Next: Comparing Protocols, Prev: Gawk Special Files, Up: Gawk Special Files + +2.1.1 The Fields of the Special File Name +----------------------------------------- + +This node explains the meaning of all the other fields, as well as the +range of values and the defaults. All of the fields are mandatory. To +let the system pick a value, or if the field doesn't apply to the +protocol, specify it as `0': + +PROTOCOL + Determines which member of the TCP/IP family of protocols is + selected to transport the data across the network. There are three + possible values (always written in lowercase): `tcp', `udp', and + `raw'. The exact meaning of each is explained later in this node. + +LOCALPORT + Determines which port on the local machine is used to communicate + across the network. It has no meaning with `/inet/raw' and must + therefore be `0'. Application-level clients usually use `0' to + indicate they do not care which local port is used--instead they + specify a remote port to connect to. It is vital for + application-level servers to use a number different from `0' here + because their service has to be available at a specific publicly + known port number. It is possible to use a name from + `/etc/services' here. + +HOSTNAME + Determines which remote host is to be at the other end of the + connection. Application-level servers must fill this field with a + `0' to indicate their being open for all other hosts to connect to + them and enforce connection level server behavior this way. It is + not possible for an application-level server to restrict its + availability to one remote host by entering a host name here. + Application-level clients must enter a name different from `0'. + The name can be either symbolic (e.g., `jpl-devvax.jpl.nasa.gov') + or numeric (e.g., `128.149.1.143'). + +REMOTEPORT + Determines which port on the remote machine is used to communicate + across the network. It has no meaning with `/inet/raw' and must + therefore be 0. For `/inet/tcp' and `/inet/udp', + application-level clients _must_ use a number other than `0' to + indicate to which port on the remote machine they want to connect. + Application-level servers must not fill this field with a `0'. + Instead they specify a local port to which clients connect. It is + possible to use a name from `/etc/services' here. + + Experts in network programming will notice that the usual +client/server asymmetry found at the level of the socket API is not +visible here. This is for the sake of simplicity of the high-level +concept. If this asymmetry is necessary for your application, use +another language. For `gawk', it is more important to enable users to +write a client program with a minimum of code. What happens when first +accessing a network connection is seen in the following pseudocode: + + if ((name of remote host given) && (other side accepts connection)) { + rendez-vous successful; transmit with getline or print + } else { + if ((other side did not accept) && (localport == 0)) + exit unsuccessful + if (TCP) { + set up a server accepting connections + this means waiting for the client on the other side to connect + } else + ready + } + + The exact behavior of this algorithm depends on the values of the +fields of the special file name. When in doubt, *note +table-inet-components:: gives you the combinations of values and their +meaning. If this table is too complicated, focus on the three lines +printed in *bold*. All the examples in *note Networking With `gawk': +Using Networking, use only the patterns printed in bold letters. + +PROTOCOL LOCAL PORT HOST NAME REMOTE RESULTING CONNECTION-LEVEL + PORT BEHAVIOR +------------------------------------------------------------------------------ +*tcp* *0* *x* *x* *Dedicated client, fails if + immediately connecting to a + server on the + other side fails* +udp 0 x x Dedicated client +raw 0 x 0 Dedicated client, works only + as `root' +*tcp, udp* *x* *x* *x* *Client, switches to + dedicated server if + necessary* +*tcp, udp* *x* *0* *0* *Dedicated server* +raw 0 0 0 Dedicated server, works only + as `root' +tcp, udp, x x 0 Invalid +raw +tcp, udp, 0 0 x Invalid +raw +tcp, udp, x 0 x Invalid +raw +tcp, udp 0 0 0 Invalid +tcp, udp 0 x 0 Invalid +raw x 0 0 Invalid +raw 0 x x Invalid +raw x x x Invalid + +Table 2.1: /inet Special File Components + + In general, TCP is the preferred mechanism to use. It is the +simplest protocol to understand and to use. Use the others only if +circumstances demand low-overhead. + + +File: gawkinet.info, Node: Comparing Protocols, Prev: Special File Fields, Up: Gawk Special Files + +2.1.2 Comparing Protocols +------------------------- + +This node develops a pair of programs (sender and receiver) that do +nothing but send a timestamp from one machine to another. The sender +and the receiver are implemented with each of the three protocols +available and demonstrate the differences between them. + +* Menu: + +* File /inet/tcp:: The TCP special file. +* File /inet/udp:: The UDP special file. +* File /inet/raw:: The RAW special file. + + +File: gawkinet.info, Node: File /inet/tcp, Next: File /inet/udp, Prev: Comparing Protocols, Up: Comparing Protocols + +2.1.2.1 `/inet/tcp' +................... + +Once again, always use TCP. (Use UDP when low overhead is a necessity, +and use RAW for network experimentation.) The first example is the +sender program: + + # Server + BEGIN { + print strftime() |& "/inet/tcp/8888/0/0" + close("/inet/tcp/8888/0/0") + } + + The receiver is very simple: + + # Client + BEGIN { + "/inet/tcp/0/localhost/8888" |& getline + print $0 + close("/inet/tcp/0/localhost/8888") + } + + TCP guarantees that the bytes arrive at the receiving end in exactly +the same order that they were sent. No byte is lost (except for broken +connections), doubled, or out of order. Some overhead is necessary to +accomplish this, but this is the price to pay for a reliable service. +It does matter which side starts first. The sender/server has to be +started first, and it waits for the receiver to read a line. + + +File: gawkinet.info, Node: File /inet/udp, Next: File /inet/raw, Prev: File /inet/tcp, Up: Comparing Protocols + +2.1.2.2 `/inet/udp' +................... + +The server and client programs that use UDP are almost identical to +their TCP counterparts; only the PROTOCOL has changed. As before, it +does matter which side starts first. The receiving side blocks and +waits for the sender. In this case, the receiver/client has to be +started first: + + # Server + BEGIN { + print strftime() |& "/inet/udp/8888/0/0" + close("/inet/udp/8888/0/0") + } + + The receiver is almost identical to the TCP receiver: + + # Client + BEGIN { + "/inet/udp/0/localhost/8888" |& getline + print $0 + close("/inet/udp/0/localhost/8888") + } + + UDP cannot guarantee that the datagrams at the receiving end will +arrive in exactly the same order they were sent. Some datagrams could be +lost, some doubled, and some out of order. But no overhead is necessary +to accomplish this. This unreliable behavior is good enough for tasks +such as data acquisition, logging, and even stateless services like NFS. + + +File: gawkinet.info, Node: File /inet/raw, Prev: File /inet/udp, Up: Comparing Protocols + +2.1.2.3 `/inet/raw' +................... + +This is an IP-level protocol. Only `root' is allowed to access this +special file. It is meant to be the basis for implementing and +experimenting with transport-level protocols.(1) In the most general +case, the sender has to supply the encapsulating header bytes in front +of the packet and the receiver has to strip the additional bytes from +the message. + + RAW receivers cannot receive packets sent with TCP or UDP because the +operating system does not deliver the packets to a RAW receiver. The +operating system knows about some of the protocols on top of IP and +decides on its own which packet to deliver to which process. (d.c.) +Therefore, the UDP receiver must be used for receiving UDP datagrams +sent with the RAW sender. This is a dark corner, not only of `gawk', +but also of TCP/IP. + + For extended experimentation with protocols, look into the approach +implemented in a tool called SPAK. This tool reflects the hierarchical +layering of protocols (encapsulation) in the way data streams are piped +out of one program into the next one. It shows which protocol is based +on which other (lower-level) protocol by looking at the command-line +ordering of the program calls. Cleverly thought out, SPAK is much +better than `gawk''s `/inet' for learning the meaning of each and every +bit in the protocol headers. + + The next example uses the RAW protocol to emulate the behavior of +UDP. The sender program is the same as above, but with some additional +bytes that fill the places of the UDP fields: + + BEGIN { + Message = "Hello world\n" + SourcePort = 0 + DestinationPort = 8888 + MessageLength = length(Message)+8 + RawService = "/inet/raw/0/localhost/0" + printf("%c%c%c%c%c%c%c%c%s", + SourcePort/256, SourcePort%256, + DestinationPort/256, DestinationPort%256, + MessageLength/256, MessageLength%256, + 0, 0, Message) |& RawService + fflush(RawService) + close(RawService) + } + + Since this program tries to emulate the behavior of UDP, it checks if +the RAW sender is understood by the UDP receiver but not if the RAW +receiver can understand the UDP sender. In a real network, the RAW +receiver is hardly of any use because it gets every IP packet that +comes across the network. There are usually so many packets that `gawk' +would be too slow for processing them. Only on a network with little +traffic can the IP-level receiver program be tested. Programs for +analyzing IP traffic on modem or ISDN channels should be possible. + + Port numbers do not have a meaning when using `/inet/raw'. Their +fields have to be `0'. Only TCP and UDP use ports. Receiving data from +`/inet/raw' is difficult, not only because of processing speed but also +because data is usually binary and not restricted to ASCII. This +implies that line separation with `RS' does not work as usual. + + ---------- Footnotes ---------- + + (1) This special file is reserved, but not otherwise currently +implemented. + + +File: gawkinet.info, Node: TCP Connecting, Next: Troubleshooting, Prev: Gawk Special Files, Up: Using Networking + +2.2 Establishing a TCP Connection +================================= + +Let's observe a network connection at work. Type in the following +program and watch the output. Within a second, it connects via TCP +(`/inet/tcp') to the machine it is running on (`localhost') and asks +the service `daytime' on the machine what time it is: + + BEGIN { + "/inet/tcp/0/localhost/daytime" |& getline + print $0 + close("/inet/tcp/0/localhost/daytime") + } + + Even experienced `awk' users will find the second line strange in two +respects: + + * A special file is used as a shell command that pipes its output + into `getline'. One would rather expect to see the special file + being read like any other file (`getline < + "/inet/tcp/0/localhost/daytime")'. + + * The operator `|&' has not been part of any `awk' implementation + (until now). It is actually the only extension of the `awk' + language needed (apart from the special files) to introduce + network access. + + The `|&' operator was introduced in `gawk' 3.1 in order to overcome +the crucial restriction that access to files and pipes in `awk' is +always unidirectional. It was formerly impossible to use both access +modes on the same file or pipe. Instead of changing the whole concept +of file access, the `|&' operator behaves exactly like the usual pipe +operator except for two additions: + + * Normal shell commands connected to their `gawk' program with a `|&' + pipe can be accessed bidirectionally. The `|&' turns out to be a + quite general, useful, and natural extension of `awk'. + + * Pipes that consist of a special file name for network connections + are not executed as shell commands. Instead, they can be read and + written to, just like a full-duplex network connection. + + In the earlier example, the `|&' operator tells `getline' to read a +line from the special file `/inet/tcp/0/localhost/daytime'. We could +also have printed a line into the special file. But instead we just +read a line with the time, printed it, and closed the connection. +(While we could just let `gawk' close the connection by finishing the +program, in this Info file we are pedantic and always explicitly close +the connections.) + + +File: gawkinet.info, Node: Troubleshooting, Next: Interacting, Prev: TCP Connecting, Up: Using Networking + +2.3 Troubleshooting Connection Problems +======================================= + +It may well be that for some reason the program shown in the previous +example does not run on your machine. When looking at possible reasons +for this, you will learn much about typical problems that arise in +network programming. First of all, your implementation of `gawk' may +not support network access because it is a pre-3.1 version or you do +not have a network interface in your machine. Perhaps your machine +uses some other protocol, such as DECnet or Novell's IPX. For the rest +of this major node, we will assume you work on a Unix machine that +supports TCP/IP. If the previous example program does not run on your +machine, it may help to replace the name `localhost' with the name of +your machine or its IP address. If it does, you could replace +`localhost' with the name of another machine in your vicinity--this +way, the program connects to another machine. Now you should see the +date and time being printed by the program, otherwise your machine may +not support the `daytime' service. Try changing the service to +`chargen' or `ftp'. This way, the program connects to other services +that should give you some response. If you are curious, you should have +a look at your `/etc/services' file. It could look like this: + + # /etc/services: + # + # Network services, Internet style + # + # Name Number/Protcol Alternate name # Comments + + echo 7/tcp + echo 7/udp + discard 9/tcp sink null + discard 9/udp sink null + daytime 13/tcp + daytime 13/udp + chargen 19/tcp ttytst source + chargen 19/udp ttytst source + ftp 21/tcp + telnet 23/tcp + smtp 25/tcp mail + finger 79/tcp + www 80/tcp http # WorldWideWeb HTTP + www 80/udp # HyperText Transfer Protocol + pop-2 109/tcp postoffice # POP version 2 + pop-2 109/udp + pop-3 110/tcp # POP version 3 + pop-3 110/udp + nntp 119/tcp readnews untp # USENET News + irc 194/tcp # Internet Relay Chat + irc 194/udp + ... + + Here, you find a list of services that traditional Unix machines +usually support. If your GNU/Linux machine does not do so, it may be +that these services are switched off in some startup script. Systems +running some flavor of Microsoft Windows usually do _not_ support these +services. Nevertheless, it _is_ possible to do networking with `gawk' +on Microsoft Windows.(1) The first column of the file gives the name of +the service, and the second column gives a unique number and the +protocol that one can use to connect to this service. The rest of the +line is treated as a comment. You see that some services (`echo') +support TCP as well as UDP. + + ---------- Footnotes ---------- + + (1) Microsoft preferred to ignore the TCP/IP family of protocols +until 1995. Then came the rise of the Netscape browser as a landmark +"killer application." Microsoft added TCP/IP support and their own +browser to Microsoft Windows 95 at the last minute. They even +back-ported their TCP/IP implementation to Microsoft Windows for +Workgroups 3.11, but it was a rather rudimentary and half-hearted +implementation. Nevertheless, the equivalent of `/etc/services' resides +under `C:\WINNT\system32\drivers\etc\services' on Microsoft Windows +2000. + + +File: gawkinet.info, Node: Interacting, Next: Setting Up, Prev: Troubleshooting, Up: Using Networking + +2.4 Interacting with a Network Service +====================================== + +The next program makes use of the possibility to really interact with a +network service by printing something into the special file. It asks the +so-called `finger' service if a user of the machine is logged in. When +testing this program, try to change `localhost' to some other machine +name in your local network: + + BEGIN { + NetService = "/inet/tcp/0/localhost/finger" + print "NAME" |& NetService + while ((NetService |& getline) > 0) + print $0 + close(NetService) + } + + After telling the service on the machine which user to look for, the +program repeatedly reads lines that come as a reply. When no more lines +are coming (because the service has closed the connection), the program +also closes the connection. Try replacing `"NAME"' with your login name +(or the name of someone else logged in). For a list of all users +currently logged in, replace NAME with an empty string (`""'). + + The final `close' command could be safely deleted from the above +script, because the operating system closes any open connection by +default when a script reaches the end of execution. In order to avoid +portability problems, it is best to always close connections explicitly. +With the Linux kernel, for example, proper closing results in flushing +of buffers. Letting the close happen by default may result in +discarding buffers. + + When looking at `/etc/services' you may have noticed that the +`daytime' service is also available with `udp'. In the earlier example, +change `tcp' to `udp', and change `finger' to `daytime'. After +starting the modified program, you see the expected day and time +message. The program then hangs, because it waits for more lines +coming from the service. However, they never come. This behavior is a +consequence of the differences between TCP and UDP. When using UDP, +neither party is automatically informed about the other closing the +connection. Continuing to experiment this way reveals many other subtle +differences between TCP and UDP. To avoid such trouble, one should +always remember the advice Douglas E. Comer and David Stevens give in +Volume III of their series `Internetworking With TCP' (page 14): + + When designing client-server applications, beginners are strongly + advised to use TCP because it provides reliable, + connection-oriented communication. Programs only use UDP if the + application protocol handles reliability, the application requires + hardware broadcast or multicast, or the application cannot + tolerate virtual circuit overhead. + + +File: gawkinet.info, Node: Setting Up, Next: Email, Prev: Interacting, Up: Using Networking + +2.5 Setting Up a Service +======================== + +The preceding programs behaved as clients that connect to a server +somewhere on the Internet and request a particular service. Now we set +up such a service to mimic the behavior of the `daytime' service. Such +a server does not know in advance who is going to connect to it over +the network. Therefore, we cannot insert a name for the host to connect +to in our special file name. + + Start the following program in one window. Notice that the service +does not have the name `daytime', but the number `8888'. From looking +at `/etc/services', you know that names like `daytime' are just +mnemonics for predetermined 16-bit integers. Only the system +administrator (`root') could enter our new service into `/etc/services' +with an appropriate name. Also notice that the service name has to be +entered into a different field of the special file name because we are +setting up a server, not a client: + + BEGIN { + print strftime() |& "/inet/tcp/8888/0/0" + close("/inet/tcp/8888/0/0") + } + + Now open another window on the same machine. Copy the client +program given as the first example (*note Establishing a TCP +Connection: TCP Connecting.) to a new file and edit it, changing the +name `daytime' to `8888'. Then start the modified client. You should +get a reply like this: + + Sat Sep 27 19:08:16 CEST 1997 + +Both programs explicitly close the connection. + + Now we will intentionally make a mistake to see what happens when +the name `8888' (the so-called port) is already used by another service. +Start the server program in both windows. The first one works, but the +second one complains that it could not open the connection. Each port +on a single machine can only be used by one server program at a time. +Now terminate the server program and change the name `8888' to `echo'. +After restarting it, the server program does not run any more, and you +know why: there is already an `echo' service running on your machine. +But even if this isn't true, you would not get your own `echo' server +running on a Unix machine, because the ports with numbers smaller than +1024 (`echo' is at port 7) are reserved for `root'. On machines +running some flavor of Microsoft Windows, there is no restriction that +reserves ports 1 to 1024 for a privileged user; hence, you can start an +`echo' server there. + + Turning this short server program into something really useful is +simple. Imagine a server that first reads a file name from the client +through the network connection, then does something with the file and +sends a result back to the client. The server-side processing could be: + + BEGIN { + NetService = "/inet/tcp/8888/0/0" + NetService |& getline + CatPipe = ("cat " $1) # sets $0 and the fields + while ((CatPipe | getline) > 0) + print $0 |& NetService + close(NetService) + } + +and we would have a remote copying facility. Such a server reads the +name of a file from any client that connects to it and transmits the +contents of the named file across the net. The server-side processing +could also be the execution of a command that is transmitted across the +network. From this example, you can see how simple it is to open up a +security hole on your machine. If you allow clients to connect to your +machine and execute arbitrary commands, anyone would be free to do `rm +-rf *'. + + +File: gawkinet.info, Node: Email, Next: Web page, Prev: Setting Up, Up: Using Networking + +2.6 Reading Email +================= + +The distribution of email is usually done by dedicated email servers +that communicate with your machine using special protocols. To receive +email, we will use the Post Office Protocol (POP). Sending can be done +with the much older Simple Mail Transfer Protocol (SMTP). + + When you type in the following program, replace the EMAILHOST by the +name of your local email server. Ask your administrator if the server +has a POP service, and then use its name or number in the program below. +Now the program is ready to connect to your email server, but it will +not succeed in retrieving your mail because it does not yet know your +login name or password. Replace them in the program and it shows you +the first email the server has in store: + + BEGIN { + POPService = "/inet/tcp/0/EMAILHOST/pop3" + RS = ORS = "\r\n" + print "user NAME" |& POPService + POPService |& getline + print "pass PASSWORD" |& POPService + POPService |& getline + print "retr 1" |& POPService + POPService |& getline + if ($1 != "+OK") exit + print "quit" |& POPService + RS = "\r\n\\.\r\n" + POPService |& getline + print $0 + close(POPService) + } + + The record separators `RS' and `ORS' are redefined because the +protocol (POP) requires CR-LF to separate lines. After identifying +yourself to the email service, the command `retr 1' instructs the +service to send the first of all your email messages in line. If the +service replies with something other than `+OK', the program exits; +maybe there is no email. Otherwise, the program first announces that it +intends to finish reading email, and then redefines `RS' in order to +read the entire email as multiline input in one record. From the POP +RFC, we know that the body of the email always ends with a single line +containing a single dot. The program looks for this using `RS = +"\r\n\\.\r\n"'. When it finds this sequence in the mail message, it +quits. You can invoke this program as often as you like; it does not +delete the message it reads, but instead leaves it on the server. + + +File: gawkinet.info, Node: Web page, Next: Primitive Service, Prev: Email, Up: Using Networking + +2.7 Reading a Web Page +====================== + +Retrieving a web page from a web server is as simple as retrieving +email from an email server. We only have to use a similar, but not +identical, protocol and a different port. The name of the protocol is +HyperText Transfer Protocol (HTTP) and the port number is usually 80. +As in the preceding node, ask your administrator about the name of your +local web server or proxy web server and its port number for HTTP +requests. + + The following program employs a rather crude approach toward +retrieving a web page. It uses the prehistoric syntax of HTTP 0.9, +which almost all web servers still support. The most noticeable thing +about it is that the program directs the request to the local proxy +server whose name you insert in the special file name (which in turn +calls `www.yahoo.com'): + + BEGIN { + RS = ORS = "\r\n" + HttpService = "/inet/tcp/0/PROXY/80" + print "GET http://www.yahoo.com" |& HttpService + while ((HttpService |& getline) > 0) + print $0 + close(HttpService) + } + + Again, lines are separated by a redefined `RS' and `ORS'. The `GET' +request that we send to the server is the only kind of HTTP request +that existed when the web was created in the early 1990s. HTTP calls +this `GET' request a "method," which tells the service to transmit a +web page (here the home page of the Yahoo! search engine). Version 1.0 +added the request methods `HEAD' and `POST'. The current version of +HTTP is 1.1,(1) and knows the additional request methods `OPTIONS', +`PUT', `DELETE', and `TRACE'. You can fill in any valid web address, +and the program prints the HTML code of that page to your screen. + + Notice the similarity between the responses of the POP and HTTP +services. First, you get a header that is terminated by an empty line, +and then you get the body of the page in HTML. The lines of the +headers also have the same form as in POP. There is the name of a +parameter, then a colon, and finally the value of that parameter. + + Images (`.png' or `.gif' files) can also be retrieved this way, but +then you get binary data that should be redirected into a file. Another +application is calling a CGI (Common Gateway Interface) script on some +server. CGI scripts are used when the contents of a web page are not +constant, but generated instantly at the moment you send a request for +the page. For example, to get a detailed report about the current +quotes of Motorola stock shares, call a CGI script at Yahoo! with the +following: + + get = "GET http://quote.yahoo.com/q?s=MOT&d=t" + print get |& HttpService + + You can also request weather reports this way. + + ---------- Footnotes ---------- + + (1) Version 1.0 of HTTP was defined in RFC 1945. HTTP 1.1 was +initially specified in RFC 2068. In June 1999, RFC 2068 was made +obsolete by RFC 2616, an update without any substantial changes. + + +File: gawkinet.info, Node: Primitive Service, Next: Interacting Service, Prev: Web page, Up: Using Networking + +2.8 A Primitive Web Service +=========================== + +Now we know enough about HTTP to set up a primitive web service that +just says `"Hello, world"' when someone connects to it with a browser. +Compared to the situation in the preceding node, our program changes +the role. It tries to behave just like the server we have observed. +Since we are setting up a server here, we have to insert the port +number in the `localport' field of the special file name. The other two +fields (HOSTNAME and REMOTEPORT) have to contain a `0' because we do +not know in advance which host will connect to our service. + + In the early 1990s, all a server had to do was send an HTML document +and close the connection. Here, we adhere to the modern syntax of HTTP. +The steps are as follows: + + 1. Send a status line telling the web browser that everything is okay. + + 2. Send a line to tell the browser how many bytes follow in the body + of the message. This was not necessary earlier because both + parties knew that the document ended when the connection closed. + Nowadays it is possible to stay connected after the transmission + of one web page. This is to avoid the network traffic necessary + for repeatedly establishing TCP connections for requesting several + images. Thus, there is the need to tell the receiving party how + many bytes will be sent. The header is terminated as usual with an + empty line. + + 3. Send the `"Hello, world"' body in HTML. The useless `while' loop + swallows the request of the browser. We could actually omit the + loop, and on most machines the program would still work. First, + start the following program: + + BEGIN { + RS = ORS = "\r\n" + HttpService = "/inet/tcp/8080/0/0" + Hello = "<HTML><HEAD>" \ + "<TITLE>A Famous Greeting</TITLE></HEAD>" \ + "<BODY><H1>Hello, world</H1></BODY></HTML>" + Len = length(Hello) + length(ORS) + print "HTTP/1.0 200 OK" |& HttpService + print "Content-Length: " Len ORS |& HttpService + print Hello |& HttpService + while ((HttpService |& getline) > 0) + continue; + close(HttpService) + } + + Now, on the same machine, start your favorite browser and let it +point to `http://localhost:8080' (the browser needs to know on which +port our server is listening for requests). If this does not work, the +browser probably tries to connect to a proxy server that does not know +your machine. If so, change the browser's configuration so that the +browser does not try to use a proxy to connect to your machine. + + +File: gawkinet.info, Node: Interacting Service, Next: Simple Server, Prev: Primitive Service, Up: Using Networking + +2.9 A Web Service with Interaction +================================== + +This node shows how to set up a simple web server. The subnode is a +library file that we will use with all the examples in *note Some +Applications and Techniques::. + +* Menu: + +* CGI Lib:: A simple CGI library. + + Setting up a web service that allows user interaction is more +difficult and shows us the limits of network access in `gawk'. In this +node, we develop a main program (a `BEGIN' pattern and its action) +that will become the core of event-driven execution controlled by a +graphical user interface (GUI). Each HTTP event that the user triggers +by some action within the browser is received in this central +procedure. Parameters and menu choices are extracted from this request, +and an appropriate measure is taken according to the user's choice. +For example: + + BEGIN { + if (MyHost == "") { + "uname -n" | getline MyHost + close("uname -n") + } + if (MyPort == 0) MyPort = 8080 + HttpService = "/inet/tcp/" MyPort "/0/0" + MyPrefix = "http://" MyHost ":" MyPort + SetUpServer() + while ("awk" != "complex") { + # header lines are terminated this way + RS = ORS = "\r\n" + Status = 200 # this means OK + Reason = "OK" + Header = TopHeader + Document = TopDoc + Footer = TopFooter + if (GETARG["Method"] == "GET") { + HandleGET() + } else if (GETARG["Method"] == "HEAD") { + # not yet implemented + } else if (GETARG["Method"] != "") { + print "bad method", GETARG["Method"] + } + Prompt = Header Document Footer + print "HTTP/1.0", Status, Reason |& HttpService + print "Connection: Close" |& HttpService + print "Pragma: no-cache" |& HttpService + len = length(Prompt) + length(ORS) + print "Content-length:", len |& HttpService + print ORS Prompt |& HttpService + # ignore all the header lines + while ((HttpService |& getline) > 0) + ; + # stop talking to this client + close(HttpService) + # wait for new client request + HttpService |& getline + # do some logging + print systime(), strftime(), $0 + # read request parameters + CGI_setup($1, $2, $3) + } + } + + This web server presents menu choices in the form of HTML links. +Therefore, it has to tell the browser the name of the host it is +residing on. When starting the server, the user may supply the name of +the host from the command line with `gawk -v MyHost="Rumpelstilzchen"'. +If the user does not do this, the server looks up the name of the host +it is running on for later use as a web address in HTML documents. The +same applies to the port number. These values are inserted later into +the HTML content of the web pages to refer to the home system. + + Each server that is built around this core has to initialize some +application-dependent variables (such as the default home page) in a +procedure `SetUpServer', which is called immediately before entering the +infinite loop of the server. For now, we will write an instance that +initiates a trivial interaction. With this home page, the client user +can click on two possible choices, and receive the current date either +in human-readable format or in seconds since 1970: + + function SetUpServer() { + TopHeader = "<HTML><HEAD>" + TopHeader = TopHeader \ + "<title>My name is GAWK, GNU AWK</title></HEAD>" + TopDoc = "<BODY><h2>\ + Do you prefer your date <A HREF=" MyPrefix \ + "/human>human</A> or \ + <A HREF=" MyPrefix "/POSIX>POSIXed</A>?</h2>" ORS ORS + TopFooter = "</BODY></HTML>" + } + + On the first run through the main loop, the default line terminators +are set and the default home page is copied to the actual home page. +Since this is the first run, `GETARG["Method"]' is not initialized yet, +hence the case selection over the method does nothing. Now that the +home page is initialized, the server can start communicating to a +client browser. + + It does so by printing the HTTP header into the network connection +(`print ... |& HttpService'). This command blocks execution of the +server script until a client connects. If this server script is +compared with the primitive one we wrote before, you will notice two +additional lines in the header. The first instructs the browser to +close the connection after each request. The second tells the browser +that it should never try to _remember_ earlier requests that had +identical web addresses (no caching). Otherwise, it could happen that +the browser retrieves the time of day in the previous example just once, +and later it takes the web page from the cache, always displaying the +same time of day although time advances each second. + + Having supplied the initial home page to the browser with a valid +document stored in the parameter `Prompt', it closes the connection and +waits for the next request. When the request comes, a log line is +printed that allows us to see which request the server receives. The +final step in the loop is to call the function `CGI_setup', which reads +all the lines of the request (coming from the browser), processes them, +and stores the transmitted parameters in the array `PARAM'. The complete +text of these application-independent functions can be found in *note A +Simple CGI Library: CGI Lib. For now, we use a simplified version of +`CGI_setup': + + function CGI_setup( method, uri, version, i) { + delete GETARG; delete MENU; delete PARAM + GETARG["Method"] = $1 + GETARG["URI"] = $2 + GETARG["Version"] = $3 + i = index($2, "?") + # is there a "?" indicating a CGI request? + if (i > 0) { + split(substr($2, 1, i-1), MENU, "[/:]") + split(substr($2, i+1), PARAM, "&") + for (i in PARAM) { + j = index(PARAM[i], "=") + GETARG[substr(PARAM[i], 1, j-1)] = \ + substr(PARAM[i], j+1) + } + } else { # there is no "?", no need for splitting PARAMs + split($2, MENU, "[/:]") + } + } + + At first, the function clears all variables used for global storage +of request parameters. The rest of the function serves the purpose of +filling the global parameters with the extracted new values. To +accomplish this, the name of the requested resource is split into parts +and stored for later evaluation. If the request contains a `?', then +the request has CGI variables seamlessly appended to the web address. +Everything in front of the `?' is split up into menu items, and +everything behind the `?' is a list of `VARIABLE=VALUE' pairs +(separated by `&') that also need splitting. This way, CGI variables are +isolated and stored. This procedure lacks recognition of special +characters that are transmitted in coded form(1). Here, any optional +request header and body parts are ignored. We do not need header +parameters and the request body. However, when refining our approach or +working with the `POST' and `PUT' methods, reading the header and body +becomes inevitable. Header parameters should then be stored in a global +array as well as the body. + + On each subsequent run through the main loop, one request from a +browser is received, evaluated, and answered according to the user's +choice. This can be done by letting the value of the HTTP method guide +the main loop into execution of the procedure `HandleGET', which +evaluates the user's choice. In this case, we have only one +hierarchical level of menus, but in the general case, menus are nested. +The menu choices at each level are separated by `/', just as in file +names. Notice how simple it is to construct menus of arbitrary depth: + + function HandleGET() { + if ( MENU[2] == "human") { + Footer = strftime() TopFooter + } else if (MENU[2] == "POSIX") { + Footer = systime() TopFooter + } + } + + The disadvantage of this approach is that our server is slow and can +handle only one request at a time. Its main advantage, however, is that +the server consists of just one `gawk' program. No need for installing +an `httpd', and no need for static separate HTML files, CGI scripts, or +`root' privileges. This is rapid prototyping. This program can be +started on the same host that runs your browser. Then let your browser +point to `http://localhost:8080'. + + It is also possible to include images into the HTML pages. Most +browsers support the not very well-known `.xbm' format, which may +contain only monochrome pictures but is an ASCII format. Binary images +are possible but not so easy to handle. Another way of including images +is to generate them with a tool such as GNUPlot, by calling the tool +with the `system' function or through a pipe. + + ---------- Footnotes ---------- + + (1) As defined in RFC 2068. + + +File: gawkinet.info, Node: CGI Lib, Prev: Interacting Service, Up: Interacting Service + +2.9.1 A Simple CGI Library +-------------------------- + + HTTP is like being married: you have to be able to handle whatever + you're given, while being very careful what you send back. + Phil Smith III, + `http://www.netfunny.com/rhf/jokes/99/Mar/http.html' + + In *note A Web Service with Interaction: Interacting Service, we saw +the function `CGI_setup' as part of the web server "core logic" +framework. The code presented there handles almost everything necessary +for CGI requests. One thing it doesn't do is handle encoded characters +in the requests. For example, an `&' is encoded as a percent sign +followed by the hexadecimal value: `%26'. These encoded values should +be decoded. Following is a simple library to perform these tasks. +This code is used for all web server examples used throughout the rest +of this Info file. If you want to use it for your own web server, +store the source code into a file named `inetlib.awk'. Then you can +include these functions into your code by placing the following +statement into your program (on the first line of your script): + + @include inetlib.awk + +But beware, this mechanism is only possible if you invoke your web +server script with `igawk' instead of the usual `awk' or `gawk'. Here +is the code: + + # CGI Library and core of a web server + # Global arrays + # GETARG --- arguments to CGI GET command + # MENU --- menu items (path names) + # PARAM --- parameters of form x=y + + # Optional variable MyHost contains host address + # Optional variable MyPort contains port number + # Needs TopHeader, TopDoc, TopFooter + # Sets MyPrefix, HttpService, Status, Reason + + BEGIN { + if (MyHost == "") { + "uname -n" | getline MyHost + close("uname -n") + } + if (MyPort == 0) MyPort = 8080 + HttpService = "/inet/tcp/" MyPort "/0/0" + MyPrefix = "http://" MyHost ":" MyPort + SetUpServer() + while ("awk" != "complex") { + # header lines are terminated this way + RS = ORS = "\r\n" + Status = 200 # this means OK + Reason = "OK" + Header = TopHeader + Document = TopDoc + Footer = TopFooter + if (GETARG["Method"] == "GET") { + HandleGET() + } else if (GETARG["Method"] == "HEAD") { + # not yet implemented + } else if (GETARG["Method"] != "") { + print "bad method", GETARG["Method"] + } + Prompt = Header Document Footer + print "HTTP/1.0", Status, Reason |& HttpService + print "Connection: Close" |& HttpService + print "Pragma: no-cache" |& HttpService + len = length(Prompt) + length(ORS) + print "Content-length:", len |& HttpService + print ORS Prompt |& HttpService + # ignore all the header lines + while ((HttpService |& getline) > 0) + continue + # stop talking to this client + close(HttpService) + # wait for new client request + HttpService |& getline + # do some logging + print systime(), strftime(), $0 + CGI_setup($1, $2, $3) + } + } + + function CGI_setup( method, uri, version, i) + { + delete GETARG + delete MENU + delete PARAM + GETARG["Method"] = method + GETARG["URI"] = uri + GETARG["Version"] = version + + i = index(uri, "?") + if (i > 0) { # is there a "?" indicating a CGI request? + split(substr(uri, 1, i-1), MENU, "[/:]") + split(substr(uri, i+1), PARAM, "&") + for (i in PARAM) { + PARAM[i] = _CGI_decode(PARAM[i]) + j = index(PARAM[i], "=") + GETARG[substr(PARAM[i], 1, j-1)] = \ + substr(PARAM[i], j+1) + } + } else { # there is no "?", no need for splitting PARAMs + split(uri, MENU, "[/:]") + } + for (i in MENU) # decode characters in path + if (i > 4) # but not those in host name + MENU[i] = _CGI_decode(MENU[i]) + } + + This isolates details in a single function, `CGI_setup'. Decoding +of encoded characters is pushed off to a helper function, +`_CGI_decode'. The use of the leading underscore (`_') in the function +name is intended to indicate that it is an "internal" function, +although there is nothing to enforce this: + + function _CGI_decode(str, hexdigs, i, pre, code1, code2, + val, result) + { + hexdigs = "123456789abcdef" + + i = index(str, "%") + if (i == 0) # no work to do + return str + + do { + pre = substr(str, 1, i-1) # part before %xx + code1 = substr(str, i+1, 1) # first hex digit + code2 = substr(str, i+2, 1) # second hex digit + str = substr(str, i+3) # rest of string + + code1 = tolower(code1) + code2 = tolower(code2) + val = index(hexdigs, code1) * 16 \ + + index(hexdigs, code2) + + result = result pre sprintf("%c", val) + i = index(str, "%") + } while (i != 0) + if (length(str) > 0) + result = result str + return result + } + + This works by splitting the string apart around an encoded character. +The two digits are converted to lowercase characters and looked up in a +string of hex digits. Note that `0' is not in the string on purpose; +`index' returns zero when it's not found, automatically giving the +correct value! Once the hexadecimal value is converted from characters +in a string into a numerical value, `sprintf' converts the value back +into a real character. The following is a simple test harness for the +above functions: + + BEGIN { + CGI_setup("GET", + "http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \ + "&percent=a %25 sign", + "1.0") + for (i in MENU) + printf "MENU[\"%s\"] = %s\n", i, MENU[i] + for (i in PARAM) + printf "PARAM[\"%s\"] = %s\n", i, PARAM[i] + for (i in GETARG) + printf "GETARG[\"%s\"] = %s\n", i, GETARG[i] + } + + And this is the result when we run it: + + $ gawk -f testserv.awk + -| MENU["4"] = www.gnu.org + -| MENU["5"] = cgi-bin + -| MENU["6"] = foo + -| MENU["1"] = http + -| MENU["2"] = + -| MENU["3"] = + -| PARAM["1"] = p1=stuff + -| PARAM["2"] = p2=stuff&junk + -| PARAM["3"] = percent=a % sign + -| GETARG["p1"] = stuff + -| GETARG["percent"] = a % sign + -| GETARG["p2"] = stuff&junk + -| GETARG["Method"] = GET + -| GETARG["Version"] = 1.0 + -| GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff& + p2=stuff%26junk&percent=a %25 sign + + +File: gawkinet.info, Node: Simple Server, Next: Caveats, Prev: Interacting Service, Up: Using Networking + +2.10 A Simple Web Server +======================== + +In the preceding node, we built the core logic for event-driven GUIs. +In this node, we finally extend the core to a real application. No one +would actually write a commercial web server in `gawk', but it is +instructive to see that it is feasible in principle. + + The application is ELIZA, the famous program by Joseph Weizenbaum +that mimics the behavior of a professional psychotherapist when talking +to you. Weizenbaum would certainly object to this description, but +this is part of the legend around ELIZA. Take the site-independent +core logic and append the following code: + + function SetUpServer() { + SetUpEliza() + TopHeader = \ + "<HTML><title>An HTTP-based System with GAWK</title>\ + <HEAD><META HTTP-EQUIV=\"Content-Type\"\ + CONTENT=\"text/html; charset=iso-8859-1\"></HEAD>\ + <BODY BGCOLOR=\"#ffffff\" TEXT=\"#000000\"\ + LINK=\"#0000ff\" VLINK=\"#0000ff\"\ + ALINK=\"#0000ff\"> <A NAME=\"top\">" + TopDoc = "\ + <h2>Please choose one of the following actions:</h2>\ + <UL>\ + <LI>\ + <A HREF=" MyPrefix "/AboutServer>About this server</A>\ + </LI><LI>\ + <A HREF=" MyPrefix "/AboutELIZA>About Eliza</A></LI>\ + <LI>\ + <A HREF=" MyPrefix \ + "/StartELIZA>Start talking to Eliza</A></LI></UL>" + TopFooter = "</BODY></HTML>" + } + + `SetUpServer' is similar to the previous example, except for calling +another function, `SetUpEliza'. This approach can be used to implement +other kinds of servers. The only changes needed to do so are hidden in +the functions `SetUpServer' and `HandleGET'. Perhaps it might be +necessary to implement other HTTP methods. The `igawk' program that +comes with `gawk' may be useful for this process. + + When extending this example to a complete application, the first +thing to do is to implement the function `SetUpServer' to initialize +the HTML pages and some variables. These initializations determine the +way your HTML pages look (colors, titles, menu items, etc.). + + The function `HandleGET' is a nested case selection that decides +which page the user wants to see next. Each nesting level refers to a +menu level of the GUI. Each case implements a certain action of the +menu. On the deepest level of case selection, the handler essentially +knows what the user wants and stores the answer into the variable that +holds the HTML page contents: + + function HandleGET() { + # A real HTTP server would treat some parts of the URI as a file name. + # We take parts of the URI as menu choices and go on accordingly. + if(MENU[2] == "AboutServer") { + Document = "This is not a CGI script.\ + This is an httpd, an HTML file, and a CGI script all \ + in one GAWK script. It needs no separate www-server, \ + no installation, and no root privileges.\ + <p>To run it, do this:</p><ul>\ + <li> start this script with \"gawk -f httpserver.awk\",</li>\ + <li> and on the same host let your www browser open location\ + \"http://localhost:8080\"</li>\ + </ul>\<p>\ Details of HTTP come from:</p><ul>\ + <li>Hethmon: Illustrated Guide to HTTP</p>\ + <li>RFC 2068</li></ul><p>JK 14.9.1997</p>" + } else if (MENU[2] == "AboutELIZA") { + Document = "This is an implementation of the famous ELIZA\ + program by Joseph Weizenbaum. It is written in GAWK and\ + /bin/sh: expad: command not found + } else if (MENU[2] == "StartELIZA") { + gsub(/\+/, " ", GETARG["YouSay"]) + # Here we also have to substitute coded special characters + Document = "<form method=GET>" \ + "<h3>" ElizaSays(GETARG["YouSay"]) "</h3>\ + <p><input type=text name=YouSay value=\"\" size=60>\ + <br><input type=submit value=\"Tell her about it\"></p></form>" + } + } + + Now we are down to the heart of ELIZA, so you can see how it works. +Initially the user does not say anything; then ELIZA resets its money +counter and asks the user to tell what comes to mind open heartedly. +The subsequent answers are converted to uppercase characters and stored +for later comparison. ELIZA presents the bill when being confronted with +a sentence that contains the phrase "shut up." Otherwise, it looks for +keywords in the sentence, conjugates the rest of the sentence, remembers +the keyword for later use, and finally selects an answer from the set of +possible answers: + + function ElizaSays(YouSay) { + if (YouSay == "") { + cost = 0 + answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM" + } else { + q = toupper(YouSay) + gsub("'", "", q) + if(q == qold) { + answer = "PLEASE DONT REPEAT YOURSELF !" + } else { + if (index(q, "SHUT UP") > 0) { + answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\ + int(100*rand()+30+cost/100) + } else { + qold = q + w = "-" # no keyword recognized yet + for (i in k) { # search for keywords + if (index(q, i) > 0) { + w = i + break + } + } + if (w == "-") { # no keyword, take old subject + w = wold + subj = subjold + } else { # find subject + subj = substr(q, index(q, w) + length(w)+1) + wold = w + subjold = subj # remember keyword and subject + } + for (i in conj) + gsub(i, conj[i], q) # conjugation + # from all answers to this keyword, select one randomly + answer = r[indices[int(split(k[w], indices) * rand()) + 1]] + # insert subject into answer + gsub("_", subj, answer) + } + } + } + cost += length(answer) # for later payment : 1 cent per character + return answer + } + + In the long but simple function `SetUpEliza', you can see tables for +conjugation, keywords, and answers.(1) The associative array `k' +contains indices into the array of answers `r'. To choose an answer, +ELIZA just picks an index randomly: + + function SetUpEliza() { + srand() + wold = "-" + subjold = " " + + # table for conjugation + conj[" ARE " ] = " AM " + conj["WERE " ] = "WAS " + conj[" YOU " ] = " I " + conj["YOUR " ] = "MY " + conj[" IVE " ] =\ + conj[" I HAVE " ] = " YOU HAVE " + conj[" YOUVE " ] =\ + conj[" YOU HAVE "] = " I HAVE " + conj[" IM " ] =\ + conj[" I AM " ] = " YOU ARE " + conj[" YOURE " ] =\ + conj[" YOU ARE " ] = " I AM " + + # table of all answers + r[1] = "DONT YOU BELIEVE THAT I CAN _" + r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?" + ... + + # table for looking up answers that + # fit to a certain keyword + k["CAN YOU"] = "1 2 3" + k["CAN I"] = "4 5" + k["YOU ARE"] =\ + k["YOURE"] = "6 7 8 9" + ... + + } + + Some interesting remarks and details (including the original source +code of ELIZA) are found on Mark Humphrys' home page. Yahoo! also has +a page with a collection of ELIZA-like programs. Many of them are +written in Java, some of them disclosing the Java source code, and a +few even explain how to modify the Java source code. + + ---------- Footnotes ---------- + + (1) The version shown here is abbreviated. The full version comes +with the `gawk' distribution. + + +File: gawkinet.info, Node: Caveats, Next: Challenges, Prev: Simple Server, Up: Using Networking + +2.11 Network Programming Caveats +================================ + +By now it should be clear that debugging a networked application is more +complicated than debugging a single-process single-hosted application. +The behavior of a networked application sometimes looks noncausal +because it is not reproducible in a strong sense. Whether a network +application works or not sometimes depends on the following: + + * How crowded the underlying network is + + * If the party at the other end is running or not + + * The state of the party at the other end + + The most difficult problems for a beginner arise from the hidden +states of the underlying network. After closing a TCP connection, it's +often necessary to wait a short while before reopening the connection. +Even more difficult is the establishment of a connection that +previously ended with a "broken pipe." Those connections have to "time +out" for a minute or so before they can reopen. Check this with the +command `netstat -a', which provides a list of still "active" +connections. + + +File: gawkinet.info, Node: Challenges, Prev: Caveats, Up: Using Networking + +2.12 Where To Go From Here +========================== + +Now, you have learned enough to build your own application. You could, +for example, take part in the Loebner Contest to win $100,000. The +Loebner Prize is the first formal instantiation of a Turing Test. Hugh +Loebner agreed with The Cambridge Center for Behavioral Studies to +underwrite a contest designed to implement the Turing Test. Dr. +Loebner pledged a Grand Prize of $100,000 for the first computer whose +responses were indistinguishable from a human's. Each year an annual +prize of $2000 and a bronze medal is awarded to the _most_ human +computer. The winner of the annual contest is the best entry relative +to other entries that year, irrespective of how good it is in an +absolute sense. Here is an example of a conversation with the winning +program of 1997: + + (c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE] + [Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40] + PROGRAM[10:39:20]Hi, my name is Catherine, what's yours? + JUDGE02[10:39:36]My name is Nathan. + PROGRAM[10:39:37]Well, it's nice to meet you, Nathan. + PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian + PROGRAM[10:40:03]couple who came out at a White House party on Sunday? + JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it? + PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover + PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very + PROGRAM[10:41:21]embarrassed? + JUDGE02[10:41:37]You tell me. I didn't see it. + PROGRAM[10:41:38]Are you still a Friend of Bill Clinton? + JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture. + PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he + PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity, + PROGRAM[10:42:51]wouldnt you say--can it all be bad luck? + JUDGE02[10:43:20]I asked you if you knew anything about sculpture. + PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with + PROGRAM[10:43:36]everyone waiting to see how much his friends have said about + PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something + PROGRAM[10:44:01]dramatic actually happen? + JUDGE02[10:44:19]Do you know what sculpture is? + PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I + PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I + PROGRAM[10:44:51]must say. + JUDGE02[10:45:26]Have you ever been to the Salmagundi Club? + PROGRAM[10:45:29]Never. to go back to the original discussion Time to get + PROGRAM[10:45:43]off this one I think and onto something more down to earth! + JUDGE02[10:46:20]What is more down to earth than art? + PROGRAM[10:46:21]I don't know what -- to be honest. - + PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the + PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a + PROGRAM[10:47:03]man? " + JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are" + JUDGE02[10:48:10]from another play the name of which I cannot remember. + PROGRAM[10:48:12]What, if anything, do you enjoy about being a man? + JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender. + PROGRAM[10:49:02]Do you think of yourself as being attractive? + + This program insists on always speaking about the same story around +Bill Clinton. You see, even a program with a rather narrow mind can +behave so much like a human being that it can win this prize. It is +quite common to let these programs talk to each other via network +connections. But during the competition itself, the program and its +computer have to be present at the place the competition is held. We +all would love to see a `gawk' program win in such an event. Maybe it +is up to you to accomplish this? + + Some other ideas for useful networked applications: + * Read the file `doc/awkforai.txt' in the `gawk' distribution. It + was written by Ronald P. Loui (Associate Professor of Computer + Science, at Washington University in St. Louis, + <loui@ai.wustl.edu>) and summarizes why he teaches `gawk' to + students of Artificial Intelligence. Here are some passages from + the text: + + The GAWK manual can be consumed in a single lab session and + the language can be mastered by the next morning by the + average student. GAWK's automatic initialization, implicit + coercion, I/O support and lack of pointers forgive many of + the mistakes that young programmers are likely to make. + Those who have seen C but not mastered it are happy to see + that GAWK retains some of the same sensibilities while adding + what must be regarded as spoonsful of syntactic sugar. + ... + There are further simple answers. Probably the best is the + fact that increasingly, undergraduate AI programming is + involving the Web. Oren Etzioni (University of Washington, + Seattle) has for a while been arguing that the "softbot" is + replacing the mechanical engineers' robot as the most + glamorous AI testbed. If the artifact whose behavior needs + to be controlled in an intelligent way is the software agent, + then a language that is well-suited to controlling the + software environment is the appropriate language. That would + imply a scripting language. If the robot is KAREL, then the + right language is "turn left; turn right." If the robot is + Netscape, then the right language is something that can + generate `netscape -remote + 'openURL(http://cs.wustl.edu/~loui)'' with elan. + ... + AI programming requires high-level thinking. There have + always been a few gifted programmers who can write high-level + programs in assembly language. Most however need the ambient + abstraction to have a higher floor. + ... + Second, inference is merely the expansion of notation. No + matter whether the logic that underlies an AI program is + fuzzy, probabilistic, deontic, defeasible, or deductive, the + logic merely defines how strings can be transformed into + other strings. A language that provides the best support for + string processing in the end provides the best support for + logic, for the exploration of various logics, and for most + forms of symbolic processing that AI might choose to call + "reasoning" instead of "logic." The implication is that + PROLOG, which saves the AI programmer from having to write a + unifier, saves perhaps two dozen lines of GAWK code at the + expense of strongly biasing the logic and representational + expressiveness of any approach. + + Now that `gawk' itself can connect to the Internet, it should be + obvious that it is suitable for writing intelligent web agents. + + * `awk' is strong at pattern recognition and string processing. So, + it is well suited to the classic problem of language translation. + A first try could be a program that knows the 100 most frequent + English words and their counterparts in German or French. The + service could be implemented by regularly reading email with the + program above, replacing each word by its translation and sending + the translation back via SMTP. Users would send English email to + their translation service and get back a translated email message + in return. As soon as this works, more effort can be spent on a + real translation program. + + * Another dialogue-oriented application (on the verge of ridicule) + is the email "support service." Troubled customers write an email + to an automatic `gawk' service that reads the email. It looks for + keywords in the mail and assembles a reply email accordingly. By + carefully investigating the email header, and repeating these + keywords through the reply email, it is rather simple to give the + customer a feeling that someone cares. Ideally, such a service + would search a database of previous cases for solutions. If none + exists, the database could, for example, consist of all the + newsgroups, mailing lists and FAQs on the Internet. + + +File: gawkinet.info, Node: Some Applications and Techniques, Next: Links, Prev: Using Networking, Up: Top + +3 Some Applications and Techniques +********************************** + +In this major node, we look at a number of self-contained scripts, with +an emphasis on concise networking. Along the way, we work towards +creating building blocks that encapsulate often needed functions of the +networking world, show new techniques that broaden the scope of +problems that can be solved with `gawk', and explore leading edge +technology that may shape the future of networking. + + We often refer to the site-independent core of the server that we +built in *note A Simple Web Server: Simple Server. When building new +and nontrivial servers, we always copy this building block and append +new instances of the two functions `SetUpServer' and `HandleGET'. + + This makes a lot of sense, since this scheme of event-driven +execution provides `gawk' with an interface to the most widely accepted +standard for GUIs: the web browser. Now, `gawk' can rival even Tcl/Tk. + + Tcl and `gawk' have much in common. Both are simple scripting +languages that allow us to quickly solve problems with short programs. +But Tcl has Tk on top of it, and `gawk' had nothing comparable up to +now. While Tcl needs a large and ever-changing library (Tk, which was +bound to the X Window System until recently), `gawk' needs just the +networking interface and some kind of browser on the client's side. +Besides better portability, the most important advantage of this +approach (embracing well-established standards such HTTP and HTML) is +that _we do not need to change the language_. We let others do the work +of fighting over protocols and standards. We can use HTML, JavaScript, +VRML, or whatever else comes along to do our work. + +* Menu: + +* PANIC:: An Emergency Web Server. +* GETURL:: Retrieving Web Pages. +* REMCONF:: Remote Configuration Of Embedded Systems. +* URLCHK:: Look For Changed Web Pages. +* WEBGRAB:: Extract Links From A Page. +* STATIST:: Graphing A Statistical Distribution. +* MAZE:: Walking Through A Maze In Virtual Reality. +* MOBAGWHO:: A Simple Mobile Agent. +* STOXPRED:: Stock Market Prediction As A Service. +* PROTBASE:: Searching Through A Protein Database. + + +File: gawkinet.info, Node: PANIC, Next: GETURL, Prev: Some Applications and Techniques, Up: Some Applications and Techniques + +3.1 PANIC: An Emergency Web Server +================================== + +At first glance, the `"Hello, world"' example in *note A Primitive Web +Service: Primitive Service, seems useless. By adding just a few lines, +we can turn it into something useful. + + The PANIC program tells everyone who connects that the local site is +not working. When a web server breaks down, it makes a difference if +customers get a strange "network unreachable" message, or a short +message telling them that the server has a problem. In such an +emergency, the hard disk and everything on it (including the regular +web service) may be unavailable. Rebooting the web server off a +diskette makes sense in this setting. + + To use the PANIC program as an emergency web server, all you need +are the `gawk' executable and the program below on a diskette. By +default, it connects to port 8080. A different value may be supplied on +the command line: + + BEGIN { + RS = ORS = "\r\n" + if (MyPort == 0) MyPort = 8080 + HttpService = "/inet/tcp/" MyPort "/0/0" + Hello = "<HTML><HEAD><TITLE>Out Of Service</TITLE>" \ + "</HEAD><BODY><H1>" \ + "This site is temporarily out of service." \ + "</H1></BODY></HTML>" + Len = length(Hello) + length(ORS) + while ("awk" != "complex") { + print "HTTP/1.0 200 OK" |& HttpService + print "Content-Length: " Len ORS |& HttpService + print Hello |& HttpService + while ((HttpService |& getline) > 0) + continue; + close(HttpService) + } + } + + +File: gawkinet.info, Node: GETURL, Next: REMCONF, Prev: PANIC, Up: Some Applications and Techniques + +3.2 GETURL: Retrieving Web Pages +================================ + +GETURL is a versatile building block for shell scripts that need to +retrieve files from the Internet. It takes a web address as a +command-line parameter and tries to retrieve the contents of this +address. The contents are printed to standard output, while the header +is printed to `/dev/stderr'. A surrounding shell script could analyze +the contents and extract the text or the links. An ASCII browser could +be written around GETURL. But more interestingly, web robots are +straightforward to write on top of GETURL. On the Internet, you can find +several programs of the same name that do the same job. They are usually +much more complex internally and at least 10 times longer. + + At first, GETURL checks if it was called with exactly one web +address. Then, it checks if the user chose to use a special proxy +server whose name is handed over in a variable. By default, it is +assumed that the local machine serves as proxy. GETURL uses the `GET' +method by default to access the web page. By handing over the name of a +different method (such as `HEAD'), it is possible to choose a different +behavior. With the `HEAD' method, the user does not receive the body of +the page content, but does receive the header: + + BEGIN { + if (ARGC != 2) { + print "GETURL - retrieve Web page via HTTP 1.0" + print "IN:\n the URL as a command-line parameter" + print "PARAM(S):\n -v Proxy=MyProxy" + print "OUT:\n the page content on stdout" + print " the page header on stderr" + print "JK 16.05.1997" + print "ADR 13.08.2000" + exit + } + URL = ARGV[1]; ARGV[1] = "" + if (Proxy == "") Proxy = "127.0.0.1" + if (ProxyPort == 0) ProxyPort = 80 + if (Method == "") Method = "GET" + HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort + ORS = RS = "\r\n\r\n" + print Method " " URL " HTTP/1.0" |& HttpService + HttpService |& getline Header + print Header > "/dev/stderr" + while ((HttpService |& getline) > 0) + printf "%s", $0 + close(HttpService) + } + + This program can be changed as needed, but be careful with the last +lines. Make sure transmission of binary data is not corrupted by +additional line breaks. Even as it is now, the byte sequence +`"\r\n\r\n"' would disappear if it were contained in binary data. Don't +get caught in a trap when trying a quick fix on this one. + + +File: gawkinet.info, Node: REMCONF, Next: URLCHK, Prev: GETURL, Up: Some Applications and Techniques + +3.3 REMCONF: Remote Configuration of Embedded Systems +===================================================== + +Today, you often find powerful processors in embedded systems. +Dedicated network routers and controllers for all kinds of machinery +are examples of embedded systems. Processors like the Intel 80x86 or +the AMD Elan are able to run multitasking operating systems, such as +XINU or GNU/Linux in embedded PCs. These systems are small and usually +do not have a keyboard or a display. Therefore it is difficult to set +up their configuration. There are several widespread ways to set them +up: + + * DIP switches + + * Read Only Memories such as EPROMs + + * Serial lines or some kind of keyboard + + * Network connections via `telnet' or SNMP + + * HTTP connections with HTML GUIs + + In this node, we look at a solution that uses HTTP connections to +control variables of an embedded system that are stored in a file. +Since embedded systems have tight limits on resources like memory, it +is difficult to employ advanced techniques such as SNMP and HTTP +servers. `gawk' fits in quite nicely with its single executable which +needs just a short script to start working. The following program +stores the variables in a file, and a concurrent process in the +embedded system may read the file. The program uses the +site-independent part of the simple web server that we developed in +*note A Web Service with Interaction: Interacting Service. As +mentioned there, all we have to do is to write two new procedures +`SetUpServer' and `HandleGET': + + function SetUpServer() { + TopHeader = "<HTML><title>Remote Configuration</title>" + TopDoc = "<BODY>\ + <h2>Please choose one of the following actions:</h2>\ + <UL>\ + <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\ + <LI><A HREF=" MyPrefix "/ReadConfig>Read Configuration</A></LI>\ + <LI><A HREF=" MyPrefix "/CheckConfig>Check Configuration</A></LI>\ + <LI><A HREF=" MyPrefix "/ChangeConfig>Change Configuration</A></LI>\ + <LI><A HREF=" MyPrefix "/SaveConfig>Save Configuration</A></LI>\ + </UL>" + TopFooter = "</BODY></HTML>" + if (ConfigFile == "") ConfigFile = "config.asc" + } + + The function `SetUpServer' initializes the top level HTML texts as +usual. It also initializes the name of the file that contains the +configuration parameters and their values. In case the user supplies a +name from the command line, that name is used. The file is expected to +contain one parameter per line, with the name of the parameter in +column one and the value in column two. + + The function `HandleGET' reflects the structure of the menu tree as +usual. The first menu choice tells the user what this is all about. The +second choice reads the configuration file line by line and stores the +parameters and their values. Notice that the record separator for this +file is `"\n"', in contrast to the record separator for HTTP. The third +menu choice builds an HTML table to show the contents of the +configuration file just read. The fourth choice does the real work of +changing parameters, and the last one just saves the configuration into +a file: + + function HandleGET() { + if(MENU[2] == "AboutServer") { + Document = "This is a GUI for remote configuration of an\ + embedded system. It is is implemented as one GAWK script." + } else if (MENU[2] == "ReadConfig") { + RS = "\n" + while ((getline < ConfigFile) > 0) + config[$1] = $2; + close(ConfigFile) + RS = "\r\n" + Document = "Configuration has been read." + } else if (MENU[2] == "CheckConfig") { + Document = "<TABLE BORDER=1 CELLPADDING=5>" + for (i in config) + Document = Document "<TR><TD>" i "</TD>" \ + "<TD>" config[i] "</TD></TR>" + Document = Document "</TABLE>" + } else if (MENU[2] == "ChangeConfig") { + if ("Param" in GETARG) { # any parameter to set? + if (GETARG["Param"] in config) { # is parameter valid? + config[GETARG["Param"]] = GETARG["Value"] + Document = (GETARG["Param"] " = " GETARG["Value"] ".") + } else { + Document = "Parameter <b>" GETARG["Param"] "</b> is invalid." + } + } else { + Document = "<FORM method=GET><h4>Change one parameter</h4>\ + <TABLE BORDER CELLPADDING=5>\ + <TR><TD>Parameter</TD><TD>Value</TD></TR>\ + <TR><TD><input type=text name=Param value=\"\" size=20></TD>\ + <TD><input type=text name=Value value=\"\" size=40></TD>\ + </TR></TABLE><input type=submit value=\"Set\"></FORM>" + } + } else if (MENU[2] == "SaveConfig") { + for (i in config) + printf("%s %s\n", i, config[i]) > ConfigFile + close(ConfigFile) + Document = "Configuration has been saved." + } + } + + We could also view the configuration file as a database. From this +point of view, the previous program acts like a primitive database +server. Real SQL database systems also make a service available by +providing a TCP port that clients can connect to. But the application +level protocols they use are usually proprietary and also change from +time to time. This is also true for the protocol that MiniSQL uses. + + +File: gawkinet.info, Node: URLCHK, Next: WEBGRAB, Prev: REMCONF, Up: Some Applications and Techniques + +3.4 URLCHK: Look for Changed Web Pages +====================================== + +Most people who make heavy use of Internet resources have a large +bookmark file with pointers to interesting web sites. It is impossible +to regularly check by hand if any of these sites have changed. A program +is needed to automatically look at the headers of web pages and tell +which ones have changed. URLCHK does the comparison after using GETURL +with the `HEAD' method to retrieve the header. + + Like GETURL, this program first checks that it is called with exactly +one command-line parameter. URLCHK also takes the same command-line +variables `Proxy' and `ProxyPort' as GETURL, because these variables +are handed over to GETURL for each URL that gets checked. The one and +only parameter is the name of a file that contains one line for each +URL. In the first column, we find the URL, and the second and third +columns hold the length of the URL's body when checked for the two last +times. Now, we follow this plan: + + 1. Read the URLs from the file and remember their most recent lengths + + 2. Delete the contents of the file + + 3. For each URL, check its new length and write it into the file + + 4. If the most recent and the new length differ, tell the user + + It may seem a bit peculiar to read the URLs from a file together +with their two most recent lengths, but this approach has several +advantages. You can call the program again and again with the same +file. After running the program, you can regenerate the changed URLs by +extracting those lines that differ in their second and third columns: + + BEGIN { + if (ARGC != 2) { + print "URLCHK - check if URLs have changed" + print "IN:\n the file with URLs as a command-line parameter" + print " file contains URL, old length, new length" + print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080" + print "OUT:\n same as file with URLs" + print "JK 02.03.1998" + exit + } + URLfile = ARGV[1]; ARGV[1] = "" + if (Proxy != "") Proxy = " -v Proxy=" Proxy + if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort + while ((getline < URLfile) > 0) + Length[$1] = $3 + 0 + close(URLfile) # now, URLfile is read in and can be updated + GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk " + for (i in Length) { + GetThisHeader = GetHeader i " 2>&1" + while ((GetThisHeader | getline) > 0) + if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0 + close(GetThisHeader) + print i, Length[i], NewLength > URLfile + if (Length[i] != NewLength) # report only changed URLs + print i, Length[i], NewLength + } + close(URLfile) + } + + Another thing that may look strange is the way GETURL is called. +Before calling GETURL, we have to check if the proxy variables need to +be passed on. If so, we prepare strings that will become part of the +command line later. In `GetHeader', we store these strings together +with the longest part of the command line. Later, in the loop over the +URLs, `GetHeader' is appended with the URL and a redirection operator +to form the command that reads the URL's header over the Internet. +GETURL always produces the headers over `/dev/stderr'. That is the +reason why we need the redirection operator to have the header piped in. + + This program is not perfect because it assumes that changing URLs +results in changed lengths, which is not necessarily true. A more +advanced approach is to look at some other header line that holds time +information. But, as always when things get a bit more complicated, +this is left as an exercise to the reader. + + +File: gawkinet.info, Node: WEBGRAB, Next: STATIST, Prev: URLCHK, Up: Some Applications and Techniques + +3.5 WEBGRAB: Extract Links from a Page +====================================== + +Sometimes it is necessary to extract links from web pages. Browsers do +it, web robots do it, and sometimes even humans do it. Since we have a +tool like GETURL at hand, we can solve this problem with some help from +the Bourne shell: + + BEGIN { RS = "http://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" } + RT != "" { + command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \ + " > doc" NR ".html") + print command + } + + Notice that the regular expression for URLs is rather crude. A +precise regular expression is much more complex. But this one works +rather well. One problem is that it is unable to find internal links of +an HTML document. Another problem is that `ftp', `telnet', `news', +`mailto', and other kinds of links are missing in the regular +expression. However, it is straightforward to add them, if doing so is +necessary for other tasks. + + This program reads an HTML file and prints all the HTTP links that +it finds. It relies on `gawk''s ability to use regular expressions as +record separators. With `RS' set to a regular expression that matches +links, the second action is executed each time a non-empty link is +found. We can find the matching link itself in `RT'. + + The action could use the `system' function to let another GETURL +retrieve the page, but here we use a different approach. This simple +program prints shell commands that can be piped into `sh' for +execution. This way it is possible to first extract the links, wrap +shell commands around them, and pipe all the shell commands into a +file. After editing the file, execution of the file retrieves exactly +those files that we really need. In case we do not want to edit, we can +retrieve all the pages like this: + + gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh + + After this, you will find the contents of all referenced documents in +files named `doc*.html' even if they do not contain HTML code. The +most annoying thing is that we always have to pass the proxy to GETURL. +If you do not like to see the headers of the web pages appear on the +screen, you can redirect them to `/dev/null'. Watching the headers +appear can be quite interesting, because it reveals interesting details +such as which web server the companies use. Now, it is clear how the +clever marketing people use web robots to determine the market shares +of Microsoft and Netscape in the web server market. + + Port 80 of any web server is like a small hole in a repellent +firewall. After attaching a browser to port 80, we usually catch a +glimpse of the bright side of the server (its home page). With a tool +like GETURL at hand, we are able to discover some of the more concealed +or even "indecent" services (i.e., lacking conformity to standards of +quality). It can be exciting to see the fancy CGI scripts that lie +there, revealing the inner workings of the server, ready to be called: + + * With a command such as: + + gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/ + + some servers give you a directory listing of the CGI files. + Knowing the names, you can try to call some of them and watch for + useful results. Sometimes there are executables in such directories + (such as Perl interpreters) that you may call remotely. If there + are subdirectories with configuration data of the web server, this + can also be quite interesting to read. + + * The well-known Apache web server usually has its CGI files in the + directory `/cgi-bin'. There you can often find the scripts + `test-cgi' and `printenv'. Both tell you some things about the + current connection and the installation of the web server. Just + call: + + gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi + gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv + + * Sometimes it is even possible to retrieve system files like the web + server's log file--possibly containing customer data--or even the + file `/etc/passwd'. (We don't recommend this!) + + *Caution:* Although this may sound funny or simply irrelevant, we +are talking about severe security holes. Try to explore your own system +this way and make sure that none of the above reveals too much +information about your system. + + +File: gawkinet.info, Node: STATIST, Next: MAZE, Prev: WEBGRAB, Up: Some Applications and Techniques + +3.6 STATIST: Graphing a Statistical Distribution +================================================ + +In the HTTP server examples we've shown thus far, we never present an +image to the browser and its user. Presenting images is one task. +Generating images that reflect some user input and presenting these +dynamically generated images is another. In this node, we use GNUPlot +for generating `.png', `.ps', or `.gif' files.(1) + + The program we develop takes the statistical parameters of two +samples and computes the t-test statistics. As a result, we get the +probabilities that the means and the variances of both samples are the +same. In order to let the user check plausibility, the program presents +an image of the distributions. The statistical computation follows +`Numerical Recipes in C: The Art of Scientific Computing' by William H. +Press, Saul A. Teukolsky, William T. Vetterling, and Brian P. Flannery. +Since `gawk' does not have a built-in function for the computation of +the beta function, we use the `ibeta' function of GNUPlot. As a side +effect, we learn how to use GNUPlot as a sophisticated calculator. The +comparison of means is done as in `tutest', paragraph 14.2, page 613, +and the comparison of variances is done as in `ftest', page 611 in +`Numerical Recipes'. + + As usual, we take the site-independent code for servers and append +our own functions `SetUpServer' and `HandleGET': + + function SetUpServer() { + TopHeader = "<HTML><title>Statistics with GAWK</title>" + TopDoc = "<BODY>\ + <h2>Please choose one of the following actions:</h2>\ + <UL>\ + <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\ + <LI><A HREF=" MyPrefix "/EnterParameters>Enter Parameters</A></LI>\ + </UL>" + TopFooter = "</BODY></HTML>" + GnuPlot = "gnuplot 2>&1" + m1=m2=0; v1=v2=1; n1=n2=10 + } + + Here, you see the menu structure that the user sees. Later, we will +see how the program structure of the `HandleGET' function reflects the +menu structure. What is missing here is the link for the image we +generate. In an event-driven environment, request, generation, and +delivery of images are separated. + + Notice the way we initialize the `GnuPlot' command string for the +pipe. By default, GNUPlot outputs the generated image via standard +output, as well as the results of `print'(ed) calculations via standard +error. The redirection causes standard error to be mixed into standard +output, enabling us to read results of calculations with `getline'. By +initializing the statistical parameters with some meaningful defaults, +we make sure the user gets an image the first time he uses the program. + + Following is the rather long function `HandleGET', which implements +the contents of this service by reacting to the different kinds of +requests from the browser. Before you start playing with this script, +make sure that your browser supports JavaScript and that it also has +this option switched on. The script uses a short snippet of JavaScript +code for delayed opening of a window with an image. A more detailed +explanation follows: + + function HandleGET() { + if(MENU[2] == "AboutServer") { + Document = "This is a GUI for a statistical computation.\ + It compares means and variances of two distributions.\ + It is implemented as one GAWK script and uses GNUPLOT." + } else if (MENU[2] == "EnterParameters") { + Document = "" + if ("m1" in GETARG) { # are there parameters to compare? + Document = Document "<SCRIPT LANGUAGE=\"JavaScript\">\ + setTimeout(\"window.open(\\\"" MyPrefix "/Image" systime()\ + "\\\",\\\"dist\\\", \\\"status=no\\\");\", 1000); </SCRIPT>" + m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"] + m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"] + t = (m1-m2)/sqrt(v1/n1+v2/n2) + df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \ + + (v2/n2)*(v2/n2) /(n2-1)) + if (v1>v2) { + f = v1/v2 + df1 = n1 - 1 + df2 = n2 - 1 + } else { + f = v2/v1 + df1 = n2 - 1 + df2 = n1 - 1 + } + print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot + print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \ + df2/(df2+df1*f) ")" |& GnuPlot + print "print pt, pF" |& GnuPlot + RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF + print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot + print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot + print "set term png small color" |& GnuPlot + #print "set term postscript color" |& GnuPlot + #print "set term gif medium size 320,240" |& GnuPlot + print "set yrange[-0.3:]" |& GnuPlot + print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot + print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot + print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\ + mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot + print "quit" |& GnuPlot + GnuPlot |& getline Image + while ((GnuPlot |& getline) > 0) + Image = Image RS $0 + close(GnuPlot) + } + Document = Document "\ + <h3>Do these samples have the same Gaussian distribution?</h3>\ + <FORM METHOD=GET> <TABLE BORDER CELLPADDING=5>\ + <TR>\ + <TD>1. Mean </TD> + <TD><input type=text name=m1 value=" m1 " size=8></TD>\ + <TD>1. Variance</TD> + <TD><input type=text name=v1 value=" v1 " size=8></TD>\ + <TD>1. Count </TD> + <TD><input type=text name=n1 value=" n1 " size=8></TD>\ + </TR><TR>\ + <TD>2. Mean </TD> + <TD><input type=text name=m2 value=" m2 " size=8></TD>\ + <TD>2. Variance</TD> + <TD><input type=text name=v2 value=" v2 " size=8></TD>\ + <TD>2. Count </TD> + <TD><input type=text name=n2 value=" n2 " size=8></TD>\ + </TR> <input type=submit value=\"Compute\">\ + </TABLE></FORM><BR>" + } else if (MENU[2] ~ "Image") { + Reason = "OK" ORS "Content-type: image/png" + #Reason = "OK" ORS "Content-type: application/x-postscript" + #Reason = "OK" ORS "Content-type: image/gif" + Header = Footer = "" + Document = Image + } + } + + As usual, we give a short description of the service in the first +menu choice. The third menu choice shows us that generation and +presentation of an image are two separate actions. While the latter +takes place quite instantly in the third menu choice, the former takes +place in the much longer second choice. Image data passes from the +generating action to the presenting action via the variable `Image' +that contains a complete `.png' image, which is otherwise stored in a +file. If you prefer `.ps' or `.gif' images over the default `.png' +images, you may select these options by uncommenting the appropriate +lines. But remember to do so in two places: when telling GNUPlot which +kind of images to generate, and when transmitting the image at the end +of the program. + + Looking at the end of the program, the way we pass the +`Content-type' to the browser is a bit unusual. It is appended to the +`OK' of the first header line to make sure the type information becomes +part of the header. The other variables that get transmitted across +the network are made empty, because in this case we do not have an HTML +document to transmit, but rather raw image data to contain in the body. + + Most of the work is done in the second menu choice. It starts with a +strange JavaScript code snippet. When first implementing this server, +we used a short `"<IMG SRC=" MyPrefix "/Image>"' here. But then +browsers got smarter and tried to improve on speed by requesting the +image and the HTML code at the same time. When doing this, the browser +tries to build up a connection for the image request while the request +for the HTML text is not yet completed. The browser tries to connect to +the `gawk' server on port 8080 while port 8080 is still in use for +transmission of the HTML text. The connection for the image cannot be +built up, so the image appears as "broken" in the browser window. We +solved this problem by telling the browser to open a separate window +for the image, but only after a delay of 1000 milliseconds. By this +time, the server should be ready for serving the next request. + + But there is one more subtlety in the JavaScript code. Each time +the JavaScript code opens a window for the image, the name of the image +is appended with a timestamp (`systime'). Why this constant change of +name for the image? Initially, we always named the image `Image', but +then the Netscape browser noticed the name had _not_ changed since the +previous request and displayed the previous image (caching behavior). +The server core is implemented so that browsers are told _not_ to cache +anything. Obviously HTTP requests do not always work as expected. One +way to circumvent the cache of such overly smart browsers is to change +the name of the image with each request. These three lines of JavaScript +caused us a lot of trouble. + + The rest can be broken down into two phases. At first, we check if +there are statistical parameters. When the program is first started, +there usually are no parameters because it enters the page coming from +the top menu. Then, we only have to present the user a form that he +can use to change statistical parameters and submit them. Subsequently, +the submission of the form causes the execution of the first phase +because _now_ there _are_ parameters to handle. + + Now that we have parameters, we know there will be an image +available. Therefore we insert the JavaScript code here to initiate +the opening of the image in a separate window. Then, we prepare some +variables that will be passed to GNUPlot for calculation of the +probabilities. Prior to reading the results, we must temporarily change +`RS' because GNUPlot separates lines with newlines. After instructing +GNUPlot to generate a `.png' (or `.ps' or `.gif') image, we initiate +the insertion of some text, explaining the resulting probabilities. The +final `plot' command actually generates the image data. This raw binary +has to be read in carefully without adding, changing, or deleting a +single byte. Hence the unusual initialization of `Image' and completion +with a `while' loop. + + When using this server, it soon becomes clear that it is far from +being perfect. It mixes source code of six scripting languages or +protocols: + + * GNU `awk' implements a server for the protocol: + + * HTTP which transmits: + + * HTML text which contains a short piece of: + + * JavaScript code opening a separate window. + + * A Bourne shell script is used for piping commands into: + + * GNUPlot to generate the image to be opened. + + After all this work, the GNUPlot image opens in the JavaScript window +where it can be viewed by the user. + + It is probably better not to mix up so many different languages. +The result is not very readable. Furthermore, the statistical part of +the server does not take care of invalid input. Among others, using +negative variances will cause invalid results. + + ---------- Footnotes ---------- + + (1) Due to licensing problems, the default installation of GNUPlot +disables the generation of `.gif' files. If your installed version +does not accept `set term gif', just download and install the most +recent version of GNUPlot and the GD library +(http://www.boutell.com/gd/) by Thomas Boutell. Otherwise you still +have the chance to generate some ASCII-art style images with GNUPlot by +using `set term dumb'. (We tried it and it worked.) + + +File: gawkinet.info, Node: MAZE, Next: MOBAGWHO, Prev: STATIST, Up: Some Applications and Techniques + +3.7 MAZE: Walking Through a Maze In Virtual Reality +=================================================== + + In the long run, every program becomes rococo, and then rubble. + Alan Perlis + + By now, we know how to present arbitrary `Content-type's to a +browser. In this node, our server will present a 3D world to our +browser. The 3D world is described in a scene description language +(VRML, Virtual Reality Modeling Language) that allows us to travel +through a perspective view of a 2D maze with our browser. Browsers with +a VRML plugin enable exploration of this technology. We could do one of +those boring `Hello world' examples here, that are usually presented +when introducing novices to VRML. If you have never written any VRML +code, have a look at the VRML FAQ. Presenting a static VRML scene is a +bit trivial; in order to expose `gawk''s new capabilities, we will +present a dynamically generated VRML scene. The function `SetUpServer' +is very simple because it only sets the default HTML page and +initializes the random number generator. As usual, the surrounding +server lets you browse the maze. + + function SetUpServer() { + TopHeader = "<HTML><title>Walk through a maze</title>" + TopDoc = "\ + <h2>Please choose one of the following actions:</h2>\ + <UL>\ + <LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\ + <LI><A HREF=" MyPrefix "/VRMLtest>Watch a simple VRML scene</A>\ + </UL>" + TopFooter = "</HTML>" + srand() + } + + The function `HandleGET' is a bit longer because it first computes +the maze and afterwards generates the VRML code that is sent across the +network. As shown in the STATIST example (*note STATIST::), we set the +type of the content to VRML and then store the VRML representation of +the maze as the page content. We assume that the maze is stored in a 2D +array. Initially, the maze consists of walls only. Then, we add an +entry and an exit to the maze and let the rest of the work be done by +the function `MakeMaze'. Now, only the wall fields are left in the +maze. By iterating over the these fields, we generate one line of VRML +code for each wall field. + + function HandleGET() { + if (MENU[2] == "AboutServer") { + Document = "If your browser has a VRML 2 plugin,\ + this server shows you a simple VRML scene." + } else if (MENU[2] == "VRMLtest") { + XSIZE = YSIZE = 11 # initially, everything is wall + for (y = 0; y < YSIZE; y++) + for (x = 0; x < XSIZE; x++) + Maze[x, y] = "#" + delete Maze[0, 1] # entry is not wall + delete Maze[XSIZE-1, YSIZE-2] # exit is not wall + MakeMaze(1, 1) + Document = "\ + #VRML V2.0 utf8\n\ + Group {\n\ + children [\n\ + PointLight {\n\ + ambientIntensity 0.2\n\ + color 0.7 0.7 0.7\n\ + location 0.0 8.0 10.0\n\ + }\n\ + DEF B1 Background {\n\ + skyColor [0 0 0, 1.0 1.0 1.0 ]\n\ + skyAngle 1.6\n\ + groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\ + groundAngle [ 1.2 1.57 ]\n\ + }\n\ + DEF Wall Shape {\n\ + geometry Box {size 1 1 1}\n\ + appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\ + }\n\ + DEF Entry Viewpoint {\n\ + position 0.5 1.0 5.0\n\ + orientation 0.0 0.0 -1.0 0.52\n\ + }\n" + for (i in Maze) { + split(i, t, SUBSEP) + Document = Document " Transform { translation " + Document = Document t[1] " 0 -" t[2] " children USE Wall }\n" + } + Document = Document " ] # end of group for world\n}" + Reason = "OK" ORS "Content-type: model/vrml" + Header = Footer = "" + } + } + + Finally, we have a look at `MakeMaze', the function that generates +the `Maze' array. When entered, this function assumes that the array +has been initialized so that each element represents a wall element and +the maze is initially full of wall elements. Only the entrance and the +exit of the maze should have been left free. The parameters of the +function tell us which element must be marked as not being a wall. +After this, we take a look at the four neighbouring elements and +remember which we have already treated. Of all the neighbouring +elements, we take one at random and walk in that direction. Therefore, +the wall element in that direction has to be removed and then, we call +the function recursively for that element. The maze is only completed +if we iterate the above procedure for _all_ neighbouring elements (in +random order) and for our present element by recursively calling the +function for the present element. This last iteration could have been +done in a loop, but it is done much simpler recursively. + + Notice that elements with coordinates that are both odd are assumed +to be on our way through the maze and the generating process cannot +terminate as long as there is such an element not being `delete'd. All +other elements are potentially part of the wall. + + function MakeMaze(x, y) { + delete Maze[x, y] # here we are, we have no wall here + p = 0 # count unvisited fields in all directions + if (x-2 SUBSEP y in Maze) d[p++] = "-x" + if (x SUBSEP y-2 in Maze) d[p++] = "-y" + if (x+2 SUBSEP y in Maze) d[p++] = "+x" + if (x SUBSEP y+2 in Maze) d[p++] = "+y" + if (p>0) { # if there are univisited fields, go there + p = int(p*rand()) # choose one unvisited field at random + if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y) + } else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2) + } else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y) + } else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2) + } # we are back from recursion + MakeMaze(x, y); # try again while there are unvisited fields + } + } + + +File: gawkinet.info, Node: MOBAGWHO, Next: STOXPRED, Prev: MAZE, Up: Some Applications and Techniques + +3.8 MOBAGWHO: a Simple Mobile Agent +=================================== + + There are two ways of constructing a software design: One way is to + make it so simple that there are obviously no deficiencies, and the + other way is to make it so complicated that there are no obvious + deficiencies. + C. A. R. Hoare + + A "mobile agent" is a program that can be dispatched from a computer +and transported to a remote server for execution. This is called +"migration", which means that a process on another system is started +that is independent from its originator. Ideally, it wanders through a +network while working for its creator or owner. In places like the UMBC +Agent Web, people are quite confident that (mobile) agents are a +software engineering paradigm that enables us to significantly increase +the efficiency of our work. Mobile agents could become the mediators +between users and the networking world. For an unbiased view at this +technology, see the remarkable paper `Mobile Agents: Are they a good +idea?'.(1) + + When trying to migrate a process from one system to another, a +server process is needed on the receiving side. Depending on the kind +of server process, several ways of implementation come to mind. How +the process is implemented depends upon the kind of server process: + + * HTTP can be used as the protocol for delivery of the migrating + process. In this case, we use a common web server as the receiving + server process. A universal CGI script mediates between migrating + process and web server. Each server willing to accept migrating + agents makes this universal service available. HTTP supplies the + `POST' method to transfer some data to a file on the web server. + When a CGI script is called remotely with the `POST' method + instead of the usual `GET' method, data is transmitted from the + client process to the standard input of the server's CGI script. + So, to implement a mobile agent, we must not only write the agent + program to start on the client side, but also the CGI script to + receive the agent on the server side. + + * The `PUT' method can also be used for migration. HTTP does not + require a CGI script for migration via `PUT'. However, with common + web servers there is no advantage to this solution, because web + servers such as Apache require explicit activation of a special + `PUT' script. + + * `Agent Tcl' pursues a different course; it relies on a dedicated + server process with a dedicated protocol specialized for receiving + mobile agents. + + Our agent example abuses a common web server as a migration tool. +So, it needs a universal CGI script on the receiving side (the web +server). The receiving script is activated with a `POST' request when +placed into a location like `/httpd/cgi-bin/PostAgent.sh'. Make sure +that the server system uses a version of `gawk' that supports network +access (Version 3.1 or later; verify with `gawk --version'). + + #!/bin/sh + MobAg=/tmp/MobileAgent.$$ + # direct script to mobile agent file + cat > $MobAg + # execute agent concurrently + gawk -f $MobAg $MobAg > /dev/null & + # HTTP header, terminator and body + gawk 'BEGIN { print "\r\nAgent started" }' + rm $MobAg # delete script file of agent + + By making its process id (`$$') part of the unique file name, the +script avoids conflicts between concurrent instances of the script. +First, all lines from standard input (the mobile agent's source code) +are copied into this unique file. Then, the agent is started as a +concurrent process and a short message reporting this fact is sent to +the submitting client. Finally, the script file of the mobile agent is +removed because it is no longer needed. Although it is a short script, +there are several noteworthy points: + +Security + _There is none_. In fact, the CGI script should never be made + available on a server that is part of the Internet because everyone + would be allowed to execute arbitrary commands with it. This + behavior is acceptable only when performing rapid prototyping. + +Self-Reference + Each migrating instance of an agent is started in a way that + enables it to read its own source code from standard input and use + the code for subsequent migrations. This is necessary because it + needs to treat the agent's code as data to transmit. `gawk' is not + the ideal language for such a job. Lisp and Tcl are more suitable + because they do not make a distinction between program code and + data. + +Independence + After migration, the agent is not linked to its former home in any + way. By reporting `Agent started', it waves "Goodbye" to its + origin. The originator may choose to terminate or not. + + The originating agent itself is started just like any other +command-line script, and reports the results on standard output. By +letting the name of the original host migrate with the agent, the agent +that migrates to a host far away from its origin can report the result +back home. Having arrived at the end of the journey, the agent +establishes a connection and reports the results. This is the reason +for determining the name of the host with `uname -n' and storing it in +`MyOrigin' for later use. We may also set variables with the `-v' +option from the command line. This interactivity is only of importance +in the context of starting a mobile agent; therefore this `BEGIN' +pattern and its action do not take part in migration: + + BEGIN { + if (ARGC != 2) { + print "MOBAG - a simple mobile agent" + print "CALL:\n gawk -f mobag.awk mobag.awk" + print "IN:\n the name of this script as a command-line parameter" + print "PARAM:\n -v MyOrigin=myhost.com" + print "OUT:\n the result on stdout" + print "JK 29.03.1998 01.04.1998" + exit + } + if (MyOrigin == "") { + "uname -n" | getline MyOrigin + close("uname -n") + } + } + + Since `gawk' cannot manipulate and transmit parts of the program +directly, the source code is read and stored in strings. Therefore, +the program scans itself for the beginning and the ending of functions. +Each line in between is appended to the code string until the end of +the function has been reached. A special case is this part of the +program itself. It is not a function. Placing a similar framework +around it causes it to be treated like a function. Notice that this +mechanism works for all the functions of the source code, but it cannot +guarantee that the order of the functions is preserved during migration: + + #ReadMySelf + /^function / { FUNC = $2 } + /^END/ || /^#ReadMySelf/ { FUNC = $1 } + FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 } + (FUNC != "") && (/^}/ || /^#EndOfMySelf/) \ + { FUNC = "" } + #EndOfMySelf + + The web server code in *note A Web Service with Interaction: +Interacting Service, was first developed as a site-independent core. +Likewise, the `gawk'-based mobile agent starts with an +agent-independent core, to which can be appended application-dependent +functions. What follows is the only application-independent function +needed for the mobile agent: + + function migrate(Destination, MobCode, Label) { + MOBVAR["Label"] = Label + MOBVAR["Destination"] = Destination + RS = ORS = "\r\n" + HttpService = "/inet/tcp/0/" Destination + for (i in MOBFUN) + MobCode = (MobCode "\n" MOBFUN[i]) + MobCode = MobCode "\n\nBEGIN {" + for (i in MOBVAR) + MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"") + MobCode = MobCode "\n}\n" + print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService + print "Content-length:", length(MobCode) ORS |& HttpService + printf "%s", MobCode |& HttpService + while ((HttpService |& getline) > 0) + print $0 + close(HttpService) + } + + The `migrate' function prepares the aforementioned strings +containing the program code and transmits them to a server. A +consequence of this modular approach is that the `migrate' function +takes some parameters that aren't needed in this application, but that +will be in future ones. Its mandatory parameter `Destination' holds the +name (or IP address) of the server that the agent wants as a host for +its code. The optional parameter `MobCode' may contain some `gawk' code +that is inserted during migration in front of all other code. The +optional parameter `Label' may contain a string that tells the agent +what to do in program execution after arrival at its new home site. One +of the serious obstacles in implementing a framework for mobile agents +is that it does not suffice to migrate the code. It is also necessary +to migrate the state of execution of the agent. In contrast to `Agent +Tcl', this program does not try to migrate the complete set of +variables. The following conventions are used: + + * Each variable in an agent program is local to the current host and + does _not_ migrate. + + * The array `MOBFUN' shown above is an exception. It is handled by + the function `migrate' and does migrate with the application. + + * The other exception is the array `MOBVAR'. Each variable that + takes part in migration has to be an element of this array. + `migrate' also takes care of this. + + Now it's clear what happens to the `Label' parameter of the function +`migrate'. It is copied into `MOBVAR["Label"]' and travels alongside +the other data. Since travelling takes place via HTTP, records must be +separated with `"\r\n"' in `RS' and `ORS' as usual. The code assembly +for migration takes place in three steps: + + * Iterate over `MOBFUN' to collect all functions verbatim. + + * Prepare a `BEGIN' pattern and put assignments to mobile variables + into the action part. + + * Transmission itself resembles GETURL: the header with the request + and the `Content-length' is followed by the body. In case there is + any reply over the network, it is read completely and echoed to + standard output to avoid irritating the server. + + The application-independent framework is now almost complete. What +follows is the `END' pattern that is executed when the mobile agent has +finished reading its own code. First, it checks whether it is already +running on a remote host or not. In case initialization has not yet +taken place, it starts `MyInit'. Otherwise (later, on a remote host), it +starts `MyJob': + + END { + if (ARGC != 2) exit # stop when called with wrong parameters + if (MyOrigin != "") # is this the originating host? + MyInit() # if so, initialize the application + else # we are on a host with migrated data + MyJob() # so we do our job + } + + All that's left to extend the framework into a complete application +is to write two application-specific functions: `MyInit' and `MyJob'. +Keep in mind that the former is executed once on the originating host, +while the latter is executed after each migration: + + function MyInit() { + MOBVAR["MyOrigin"] = MyOrigin + MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80" + split(MOBVAR["Machines"], Machines) # which host is the first? + migrate(Machines[1], "", "") # go to the first host + while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result + print $0 # print result + close("/inet/tcp/8080/0/0") + } + + As mentioned earlier, this agent takes the name of its origin +(`MyOrigin') with it. Then, it takes the name of its first destination +and goes there for further work. Notice that this name has the port +number of the web server appended to the name of the server, because +the function `migrate' needs it this way to create the `HttpService' +variable. Finally, it waits for the result to arrive. The `MyJob' +function runs on the remote host: + + function MyJob() { + # forget this host + sub(MOBVAR["Destination"], "", MOBVAR["Machines"]) + MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":" + while (("who" | getline) > 0) # who is logged in? + MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0 + close("who") + if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit? + split(MOBVAR["Machines"], Machines) # which host is next? + migrate(Machines[1], "", "") # go there + } else { # no more machines + gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin + print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080" + close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080") + } + } + + After migrating, the first thing to do in `MyJob' is to delete the +name of the current host from the list of hosts to visit. Now, it is +time to start the real work by appending the host's name to the result +string, and reading line by line who is logged in on this host. A very +annoying circumstance is the fact that the elements of `MOBVAR' cannot +hold the newline character (`"\n"'). If they did, migration of this +string did not work because the string didn't obey the syntax rule for +a string in `gawk'. `SUBSEP' is used as a temporary replacement. If +the list of hosts to visit holds at least one more entry, the agent +migrates to that place to go on working there. Otherwise, we replace +the `SUBSEP's with a newline character in the resulting string, and +report it to the originating host, whose name is stored in +`MOBVAR["MyOrigin"]'. + + ---------- Footnotes ---------- + + (1) `http://www.research.ibm.com/massive/mobag.ps' + + +File: gawkinet.info, Node: STOXPRED, Next: PROTBASE, Prev: MOBAGWHO, Up: Some Applications and Techniques + +3.9 STOXPRED: Stock Market Prediction As A Service +================================================== + + Far out in the uncharted backwaters of the unfashionable end of + the Western Spiral arm of the Galaxy lies a small unregarded + yellow sun. + + Orbiting this at a distance of roughly ninety-two million miles is + an utterly insignificant little blue-green planet whose + ape-descendent life forms are so amazingly primitive that they + still think digital watches are a pretty neat idea. + + This planet has -- or rather had -- a problem, which was this: + most of the people living on it were unhappy for pretty much of + the time. Many solutions were suggested for this problem, but + most of these were largely concerned with the movements of small + green pieces of paper, which is odd because it wasn't the small + green pieces of paper that were unhappy. + Douglas Adams, `The Hitch Hiker's Guide to the Galaxy' + + Valuable services on the Internet are usually _not_ implemented as +mobile agents. There are much simpler ways of implementing services. +All Unix systems provide, for example, the `cron' service. Unix system +users can write a list of tasks to be done each day, each week, twice a +day, or just once. The list is entered into a file named `crontab'. +For example, to distribute a newsletter on a daily basis this way, use +`cron' for calling a script each day early in the morning. + + # run at 8 am on weekdays, distribute the newsletter + 0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1 + + The script first looks for interesting information on the Internet, +assembles it in a nice form and sends the results via email to the +customers. + + The following is an example of a primitive newsletter on stock +market prediction. It is a report which first tries to predict the +change of each share in the Dow Jones Industrial Index for the +particular day. Then it mentions some especially promising shares as +well as some shares which look remarkably bad on that day. The report +ends with the usual disclaimer which tells every child _not_ to try +this at home and hurt anybody. + + Good morning Uncle Scrooge, + + This is your daily stock market report for Monday, October 16, 2000. + Here are the predictions for today: + + AA neutral + GE up + JNJ down + MSFT neutral + ... + UTX up + DD down + IBM up + MO down + WMT up + DIS up + INTC up + MRK down + XOM down + EK down + IP down + + The most promising shares for today are these: + + INTC http://biz.yahoo.com/n/i/intc.html + + The stock shares to avoid today are these: + + EK http://biz.yahoo.com/n/e/ek.html + IP http://biz.yahoo.com/n/i/ip.html + DD http://biz.yahoo.com/n/d/dd.html + ... + + The script as a whole is rather long. In order to ease the pain of +studying other people's source code, we have broken the script up into +meaningful parts which are invoked one after the other. The basic +structure of the script is as follows: + + BEGIN { + Init() + ReadQuotes() + CleanUp() + Prediction() + Report() + SendMail() + } + + The earlier parts store data into variables and arrays which are +subsequently used by later parts of the script. The `Init' function +first checks if the script is invoked correctly (without any +parameters). If not, it informs the user of the correct usage. What +follows are preparations for the retrieval of the historical quote +data. The names of the 30 stock shares are stored in an array `name' +along with the current date in `day', `month', and `year'. + + All users who are separated from the Internet by a firewall and have +to direct their Internet accesses to a proxy must supply the name of +the proxy to this script with the `-v Proxy=NAME' option. For most +users, the default proxy and port number should suffice. + + function Init() { + if (ARGC != 1) { + print "STOXPRED - daily stock share prediction" + print "IN:\n no parameters, nothing on stdin" + print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80" + print "OUT:\n commented predictions as email" + print "JK 09.10.2000" + exit + } + # Remember ticker symbols from Dow Jones Industrial Index + StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \ + SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \ + MRK XOM EK IP", name); + # Remember the current date as the end of the time series + day = strftime("%d") + month = strftime("%m") + year = strftime("%Y") + if (Proxy == "") Proxy = "chart.yahoo.com" + if (ProxyPort == 0) ProxyPort = 80 + YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort + } + + There are two really interesting parts in the script. One is the +function which reads the historical stock quotes from an Internet +server. The other is the one that does the actual prediction. In the +following function we see how the quotes are read from the Yahoo +server. The data which comes from the server is in CSV format +(comma-separated values): + + Date,Open,High,Low,Close,Volume + 9-Oct-00,22.75,22.75,21.375,22.375,7888500 + 6-Oct-00,23.8125,24.9375,21.5625,22,10701100 + 5-Oct-00,24.4375,24.625,23.125,23.50,5810300 + + Lines contain values of the same time instant, whereas columns are +separated by commas and contain the kind of data that is described in +the header (first) line. At first, `gawk' is instructed to separate +columns by commas (`FS = ","'). In the loop that follows, a connection +to the Yahoo server is first opened, then a download takes place, and +finally the connection is closed. All this happens once for each ticker +symbol. In the body of this loop, an Internet address is built up as a +string according to the rules of the Yahoo server. The starting and +ending date are chosen to be exactly the same, but one year apart in +the past. All the action is initiated within the `printf' command which +transmits the request for data to the Yahoo server. + + In the inner loop, the server's data is first read and then scanned +line by line. Only lines which have six columns and the name of a month +in the first column contain relevant data. This data is stored in the +two-dimensional array `quote'; one dimension being time, the other +being the ticker symbol. During retrieval of the first stock's data, +the calendar names of the time instances are stored in the array `day' +because we need them later. + + function ReadQuotes() { + # Retrieve historical data for each ticker symbol + FS = "," + for (stock = 1; stock <= StockCount; stock++) { + URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \ + "&a=" month "&b=" day "&c=" year-1 \ + "&d=" month "&e=" day "&f=" year \ + "g=d&q=q&y=0&z=" name[stock] "&x=.csv" + printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData + while ((YahooData |& getline) > 0) { + if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) { + if (stock == 1) + days[++daycount] = $1; + quote[$1, stock] = $5 + } + } + close(YahooData) + } + FS = " " + } + + Now that we _have_ the data, it can be checked once again to make +sure that no individual stock is missing or invalid, and that all the +stock quotes are aligned correctly. Furthermore, we renumber the time +instances. The most recent day gets day number 1 and all other days get +consecutive numbers. All quotes are rounded toward the nearest whole +number in US Dollars. + + function CleanUp() { + # clean up time series; eliminate incomplete data sets + for (d = 1; d <= daycount; d++) { + for (stock = 1; stock <= StockCount; stock++) + if (! ((days[d], stock) in quote)) + stock = StockCount + 10 + if (stock > StockCount + 1) + continue + datacount++ + for (stock = 1; stock <= StockCount; stock++) + data[datacount, stock] = int(0.5 + quote[days[d], stock]) + } + delete quote + delete days + } + + Now we have arrived at the second really interesting part of the +whole affair. What we present here is a very primitive prediction +algorithm: _If a stock fell yesterday, assume it will also fall today; +if it rose yesterday, assume it will rise today_. (Feel free to +replace this algorithm with a smarter one.) If a stock changed in the +same direction on two consecutive days, this is an indication which +should be highlighted. Two-day advances are stored in `hot' and +two-day declines in `avoid'. + + The rest of the function is a sanity check. It counts the number of +correct predictions in relation to the total number of predictions one +could have made in the year before. + + function Prediction() { + # Predict each ticker symbol by prolonging yesterday's trend + for (stock = 1; stock <= StockCount; stock++) { + if (data[1, stock] > data[2, stock]) { + predict[stock] = "up" + } else if (data[1, stock] < data[2, stock]) { + predict[stock] = "down" + } else { + predict[stock] = "neutral" + } + if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock])) + hot[stock] = 1 + if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock])) + avoid[stock] = 1 + } + # Do a plausibility check: how many predictions proved correct? + for (s = 1; s <= StockCount; s++) { + for (d = 1; d <= datacount-2; d++) { + if (data[d+1, s] > data[d+2, s]) { + UpCount++ + } else if (data[d+1, s] < data[d+2, s]) { + DownCount++ + } else { + NeutralCount++ + } + if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) || + ((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) || + ((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s]))) + CorrectCount++ + } + } + } + + At this point the hard work has been done: the array `predict' +contains the predictions for all the ticker symbols. It is up to the +function `Report' to find some nice words to introduce the desired +information. + + function Report() { + # Generate report + report = "\nThis is your daily " + report = report "stock market report for "strftime("%A, %B %d, %Y")".\n" + report = report "Here are the predictions for today:\n\n" + for (stock = 1; stock <= StockCount; stock++) + report = report "\t" name[stock] "\t" predict[stock] "\n" + for (stock in hot) { + if (HotCount++ == 0) + report = report "\nThe most promising shares for today are these:\n\n" + report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ + tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" + } + for (stock in avoid) { + if (AvoidCount++ == 0) + report = report "\nThe stock shares to avoid today are these:\n\n" + report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ + tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" + } + report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0 + report = report " losers. When using this kind\nof prediction scheme for" + report = report " the 12 months which lie behind us,\nwe get " UpCount + report = report " 'ups' and " DownCount " 'downs' and " NeutralCount + report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount + report = report " predictions " CorrectCount " proved correct next day.\n" + report = report "A success rate of "\ + int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n" + report = report "Random choice would have produced a 33% success rate.\n" + report = report "Disclaimer: Like every other prediction of the stock\n" + report = report "market, this report is, of course, complete nonsense.\n" + report = report "If you are stupid enough to believe these predictions\n" + report = report "you should visit a doctor who can treat your ailment." + } + + The function `SendMail' goes through the list of customers and opens +a pipe to the `mail' command for each of them. Each one receives an +email message with a proper subject heading and is addressed with his +full name. + + function SendMail() { + # send report to customers + customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge" + customer["more@utopia.org" ] = "Sir Thomas More" + customer["spinoza@denhaag.nl" ] = "Baruch de Spinoza" + customer["marx@highgate.uk" ] = "Karl Marx" + customer["keynes@the.long.run" ] = "John Maynard Keynes" + customer["bierce@devil.hell.org" ] = "Ambrose Bierce" + customer["laplace@paris.fr" ] = "Pierre Simon de Laplace" + for (c in customer) { + MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c + print "Good morning " customer[c] "," | MailPipe + print report "\n.\n" | MailPipe + close(MailPipe) + } + } + + Be patient when running the script by hand. Retrieving the data for +all the ticker symbols and sending the emails may take several minutes +to complete, depending upon network traffic and the speed of the +available Internet link. The quality of the prediction algorithm is +likely to be disappointing. Try to find a better one. Should you find +one with a success rate of more than 50%, please tell us about it! It +is only for the sake of curiosity, of course. `:-)' + + +File: gawkinet.info, Node: PROTBASE, Prev: STOXPRED, Up: Some Applications and Techniques + +3.10 PROTBASE: Searching Through A Protein Database +=================================================== + + Hoare's Law of Large Problems: Inside every large problem is a + small problem struggling to get out. + + Yahoo's database of stock market data is just one among the many +large databases on the Internet. Another one is located at NCBI +(National Center for Biotechnology Information). Established in 1988 as +a national resource for molecular biology information, NCBI creates +public databases, conducts research in computational biology, develops +software tools for analyzing genome data, and disseminates biomedical +information. In this section, we look at one of NCBI's public services, +which is called BLAST (Basic Local Alignment Search Tool). + + You probably know that the information necessary for reproducing +living cells is encoded in the genetic material of the cells. The +genetic material is a very long chain of four base nucleotides. It is +the order of appearance (the sequence) of nucleotides which contains +the information about the substance to be produced. Scientists in +biotechnology often find a specific fragment, determine the nucleotide +sequence, and need to know where the sequence at hand comes from. This +is where the large databases enter the game. At NCBI, databases store +the knowledge about which sequences have ever been found and where they +have been found. When the scientist sends his sequence to the BLAST +service, the server looks for regions of genetic material in its +database which look the most similar to the delivered nucleotide +sequence. After a search time of some seconds or minutes the server +sends an answer to the scientist. In order to make access simple, NCBI +chose to offer their database service through popular Internet +protocols. There are four basic ways to use the so-called BLAST +services: + + * The easiest way to use BLAST is through the web. Users may simply + point their browsers at the NCBI home page and link to the BLAST + pages. NCBI provides a stable URL that may be used to perform + BLAST searches without interactive use of a web browser. This is + what we will do later in this section. A demonstration client and + a `README' file demonstrate how to access this URL. + + * Currently, `blastcl3' is the standard network BLAST client. You + can download `blastcl3' from the anonymous FTP location. + + * BLAST 2.0 can be run locally as a full executable and can be used + to run BLAST searches against private local databases, or + downloaded copies of the NCBI databases. BLAST 2.0 executables may + be found on the NCBI anonymous FTP server. + + * The NCBI BLAST Email server is the best option for people without + convenient access to the web. A similarity search can be performed + by sending a properly formatted mail message containing the + nucleotide or protein query sequence to <blast@ncbi.nlm.nih.gov>. + The query sequence is compared against the specified database + using the BLAST algorithm and the results are returned in an email + message. For more information on formulating email BLAST searches, + you can send a message consisting of the word "HELP" to the same + address, <blast@ncbi.nlm.nih.gov>. + + Our starting point is the demonstration client mentioned in the +first option. The `README' file that comes along with the client +explains the whole process in a nutshell. In the rest of this section, +we first show what such requests look like. Then we show how to use +`gawk' to implement a client in about 10 lines of code. Finally, we +show how to interpret the result returned from the service. + + Sequences are expected to be represented in the standard IUB/IUPAC +amino acid and nucleic acid codes, with these exceptions: lower-case +letters are accepted and are mapped into upper-case; a single hyphen or +dash can be used to represent a gap of indeterminate length; and in +amino acid sequences, `U' and `*' are acceptable letters (see below). +Before submitting a request, any numerical digits in the query sequence +should either be removed or replaced by appropriate letter codes (e.g., +`N' for unknown nucleic acid residue or `X' for unknown amino acid +residue). The nucleic acid codes supported are: + + A --> adenosine M --> A C (amino) + C --> cytidine S --> G C (strong) + G --> guanine W --> A T (weak) + T --> thymidine B --> G T C + U --> uridine D --> G A T + R --> G A (purine) H --> A C T + Y --> T C (pyrimidine) V --> G C A + K --> G T (keto) N --> A G C T (any) + - gap of indeterminate length + + Now you know the alphabet of nucleotide sequences. The last two lines +of the following example query show you such a sequence, which is +obviously made up only of elements of the alphabet just described. +Store this example query into a file named `protbase.request'. You are +now ready to send it to the server with the demonstration client. + + PROGRAM blastn + DATALIB month + EXPECT 0.75 + BEGIN + >GAWK310 the gawking gene GNU AWK + tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat + caccaccatggacagcaaa + + The actual search request begins with the mandatory parameter +`PROGRAM' in the first column followed by the value `blastn' (the name +of the program) for searching nucleic acids. The next line contains +the mandatory search parameter `DATALIB' with the value `month' for the +newest nucleic acid sequences. The third line contains an optional +`EXPECT' parameter and the value desired for it. The fourth line +contains the mandatory `BEGIN' directive, followed by the query +sequence in FASTA/Pearson format. Each line of information must be +less than 80 characters in length. + + The "month" database contains all new or revised sequences released +in the last 30 days and is useful for searching against new sequences. +There are five different blast programs, `blastn' being the one that +compares a nucleotide query sequence against a nucleotide sequence +database. + + The last server directive that must appear in every request is the +`BEGIN' directive. The query sequence should immediately follow the +`BEGIN' directive and must appear in FASTA/Pearson format. A sequence +in FASTA/Pearson format begins with a single-line description. The +description line, which is required, is distinguished from the lines of +sequence data that follow it by having a greater-than (`>') symbol in +the first column. For the purposes of the BLAST server, the text of +the description is arbitrary. + + If you prefer to use a client written in `gawk', just store the +following 10 lines of code into a file named `protbase.awk' and use +this client instead. Invoke it with `gawk -f protbase.awk +protbase.request'. Then wait a minute and watch the result coming in. +In order to replicate the demonstration client's behaviour as closely +as possible, this client does not use a proxy server. We could also +have extended the client program in *note Retrieving Web Pages: GETURL, +to implement the client request from `protbase.awk' as a special case. + + { request = request "\n" $0 } + + END { + BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80" + printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService + printf "Content-Length: " length(request) "\n\n" |& BLASTService + printf request |& BLASTService + while ((BLASTService |& getline) > 0) + print $0 + close(BLASTService) + } + + The demonstration client from NCBI is 214 lines long (written in C) +and it is not immediately obvious what it does. Our client is so short +that it _is_ obvious what it does. First it loops over all lines of the +query and stores the whole query into a variable. Then the script +establishes an Internet connection to the NCBI server and transmits the +query by framing it with a proper HTTP request. Finally it receives and +prints the complete result coming from the server. + + Now, let us look at the result. It begins with an HTTP header, which +you can ignore. Then there are some comments about the query having been +filtered to avoid spuriously high scores. After this, there is a +reference to the paper that describes the software being used for +searching the data base. After a repetition of the original query's +description we find the list of significant alignments: + + Sequences producing significant alignments: (bits) Value + + gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20 + gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20 + emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20 + emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20 + emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20 + emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20 + gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20 + + This means that the query sequence was found in seven human +chromosomes. But the value 0.20 (20%) means that the probability of an +accidental match is rather high (20%) in all cases and should be taken +into account. You may wonder what the first column means. It is a key +to the specific database in which this occurrence was found. The +unique sequence identifiers reported in the search results can be used +as sequence retrieval keys via the NCBI server. The syntax of sequence +header lines used by the NCBI BLAST server depends on the database from +which each sequence was obtained. The table below lists the +identifiers for the databases from which the sequences were derived. + + Database Name Identifier Syntax + ============================ ======================== + GenBank gb|accession|locus + EMBL Data Library emb|accession|locus + DDBJ, DNA Database of Japan dbj|accession|locus + NBRF PIR pir||entry + Protein Research Foundation prf||name + SWISS-PROT sp|accession|entry name + Brookhaven Protein Data Bank pdb|entry|chain + Kabat's Sequences of Immuno... gnl|kabat|identifier + Patents pat|country|number + GenInfo Backbone Id bbs|number + + For example, an identifier might be `gb|AC021182.14|AC021182', where +the `gb' tag indicates that the identifier refers to a GenBank sequence, +`AC021182.14' is its GenBank ACCESSION, and `AC021182' is the GenBank +LOCUS. The identifier contains no spaces, so that a space indicates +the end of the identifier. + + Let us continue in the result listing. Each of the seven alignments +mentioned above is subsequently described in detail. We will have a +closer look at the first of them. + + >gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4 + unordered pieces + Length = 176383 + + Score = 38.2 bits (19), Expect = 0.20 + Identities = 19/19 (100%) + Strand = Plus / Plus + + Query: 35 tggtgaagtgtgtttcttg 53 + ||||||||||||||||||| + Sbjct: 69786 tggtgaagtgtgtttcttg 69804 + + This alignment was located on the human chromosome 7. The fragment +on which part of the query was found had a total length of 176383. Only +19 of the nucleotides matched and the matching sequence ran from +character 35 to 53 in the query sequence and from 69786 to 69804 in the +fragment on chromosome 7. If you are still reading at this point, you +are probably interested in finding out more about Computational Biology +and you might appreciate the following hints. + + 1. There is a book called `Introduction to Computational Biology' by + Michael S. Waterman, which is worth reading if you are seriously + interested. You can find a good book review on the Internet. + + 2. While Waterman's book can explain to you the algorithms employed + internally in the database search engines, most practitioners + prefer to approach the subject differently. The applied side of + Computational Biology is called Bioinformatics, and emphasizes the + tools available for day-to-day work as well as how to actually + _use_ them. One of the very few affordable books on Bioinformatics + is `Developing Bioinformatics Computer Skills'. + + 3. The sequences _gawk_ and _gnuawk_ are in widespread use in the + genetic material of virtually every earthly living being. Let us + take this as a clear indication that the divine creator has + intended `gawk' to prevail over other scripting languages such as + `perl', `tcl', or `python' which are not even proper sequences. + (:-) + + +File: gawkinet.info, Node: Links, Next: GNU Free Documentation License, Prev: Some Applications and Techniques, Up: Top + +4 Related Links +*************** + +This section lists the URLs for various items discussed in this major +node. They are presented in the order in which they appear. + +`Internet Programming with Python' + `http://www.fsbassociates.com/books/python.htm' + +`Advanced Perl Programming' + `http://www.oreilly.com/catalog/advperl' + +`Web Client Programming with Perl' + `http://www.oreilly.com/catalog/webclient' + +Richard Stevens's home page and book + `http://www.kohala.com/~rstevens' + +The SPAK home page + `http://www.userfriendly.net/linux/RPM/contrib/libc6/i386/spak-0.6b-1.i386.html' + +Volume III of `Internetworking with TCP/IP', by Comer and Stevens + `http://www.cs.purdue.edu/homes/dec/tcpip3s.cont.html' + +XBM Graphics File Format + `http://www.wotsit.org/download.asp?f=xbm' + +GNUPlot + `http://www.cs.dartmouth.edu/gnuplot_info.html' + +Mark Humphrys' Eliza page + `http://www.compapp.dcu.ie/~humphrys/eliza.html' + +Yahoo! Eliza Information + `http://dir.yahoo.com/Recreation/Games/Computer_Games/Internet_Games/Web_Games/Artificial_Intelligence' + +Java versions of Eliza + `http://www.tjhsst.edu/Psych/ch1/eliza.html' + +Java versions of Eliza with source code + `http://home.adelphia.net/~lifeisgood/eliza/eliza.htm' + +Eliza Programs with Explanations + `http://chayden.net/chayden/eliza/Eliza.shtml' + +Loebner Contest + `http://acm.org/~loebner/loebner-prize.htmlx' + +Tck/Tk Information + `http://www.scriptics.com/' + +Intel 80x86 Processors + `http://developer.intel.com/design/platform/embedpc/what_is.htm' + +AMD Elan Processors + `http://www.amd.com/products/epd/processors/4.32bitcont/32bitcont/index.html' + +XINU + `http://willow.canberra.edu.au/~chrisc/xinu.html' + +GNU/Linux + `http://uclinux.lineo.com/' + +Embedded PCs + `http://dir.yahoo.com/Business_and_Economy/Business_to_Business/Computers/Hardware/Embedded_Control/' + +MiniSQL + `http://www.hughes.com.au/library/' + +Market Share Surveys + `http://www.netcraft.com/survey' + +`Numerical Recipes in C: The Art of Scientific Computing' + `http://www.nr.com' + +VRML + `http://www.vrml.org' + +The VRML FAQ + `http://www.vrml.org/technicalinfo/specifications/specifications.htm#FAQ' + +The UMBC Agent Web + `http://www.cs.umbc.edu/agents' + +Apache Web Server + `http://www.apache.org' + +National Center for Biotechnology Information (NCBI) + `http://www.ncbi.nlm.nih.gov' + +Basic Local Alignment Search Tool (BLAST) + `http://www.ncbi.nlm.nih.gov/BLAST/blast_overview.html' + +NCBI Home Page + `http://www.ncbi.nlm.nih.gov' + +BLAST Pages + `http://www.ncbi.nlm.nih.gov/BLAST' + +BLAST Demonstration Client + `ftp://ncbi.nlm.nih.gov/blast/blasturl/' + +BLAST anonymous FTP location + `ftp://ncbi.nlm.nih.gov/blast/network/netblast/' + +BLAST 2.0 Executables + `ftp://ncbi.nlm.nih.gov/blast/executables/' + +IUB/IUPAC Amino Acid and Nucleic Acid Codes + `http://www.uthscsa.edu/geninfo/blastmail.html#item6' + +FASTA/Pearson Format + `http://www.ncbi.nlm.nih.gov/BLAST/fasta.html' + +Fasta/Pearson Sequence in Java + `http://www.kazusa.or.jp/java/codon_table_java/' + +Book Review of `Introduction to Computational Biology' + `http://www.acm.org/crossroads/xrds5-1/introcb.html' + +`Developing Bioinformatics Computer Skills' + `http://www.oreilly.com/catalog/bioskills/' + + + +File: gawkinet.info, Node: GNU Free Documentation License, Next: Index, Prev: Links, Up: Top + +GNU Free Documentation License +****************************** + + Version 1.2, November 2002 + + Copyright (C) 2000,2001,2002 Free Software Foundation, Inc. + 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA + + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + 0. PREAMBLE + + The purpose of this License is to make a manual, textbook, or other + functional and useful document "free" in the sense of freedom: to + assure everyone the effective freedom to copy and redistribute it, + with or without modifying it, either commercially or + noncommercially. Secondarily, this License preserves for the + author and publisher a way to get credit for their work, while not + being considered responsible for modifications made by others. + + This License is a kind of "copyleft", which means that derivative + works of the document must themselves be free in the same sense. + It complements the GNU General Public License, which is a copyleft + license designed for free software. + + We have designed this License in order to use it for manuals for + free software, because free software needs free documentation: a + free program should come with manuals providing the same freedoms + that the software does. But this License is not limited to + software manuals; it can be used for any textual work, regardless + of subject matter or whether it is published as a printed book. + We recommend this License principally for works whose purpose is + instruction or reference. + + 1. APPLICABILITY AND DEFINITIONS + + This License applies to any manual or other work, in any medium, + that contains a notice placed by the copyright holder saying it + can be distributed under the terms of this License. Such a notice + grants a world-wide, royalty-free license, unlimited in duration, + to use that work under the conditions stated herein. The + "Document", below, refers to any such manual or work. Any member + of the public is a licensee, and is addressed as "you". You + accept the license if you copy, modify or distribute the work in a + way requiring permission under copyright law. + + A "Modified Version" of the Document means any work containing the + Document or a portion of it, either copied verbatim, or with + modifications and/or translated into another language. + + A "Secondary Section" is a named appendix or a front-matter section + of the Document that deals exclusively with the relationship of the + publishers or authors of the Document to the Document's overall + subject (or to related matters) and contains nothing that could + fall directly within that overall subject. (Thus, if the Document + is in part a textbook of mathematics, a Secondary Section may not + explain any mathematics.) The relationship could be a matter of + historical connection with the subject or with related matters, or + of legal, commercial, philosophical, ethical or political position + regarding them. + + The "Invariant Sections" are certain Secondary Sections whose + titles are designated, as being those of Invariant Sections, in + the notice that says that the Document is released under this + License. If a section does not fit the above definition of + Secondary then it is not allowed to be designated as Invariant. + The Document may contain zero Invariant Sections. If the Document + does not identify any Invariant Sections then there are none. + + The "Cover Texts" are certain short passages of text that are + listed, as Front-Cover Texts or Back-Cover Texts, in the notice + that says that the Document is released under this License. A + Front-Cover Text may be at most 5 words, and a Back-Cover Text may + be at most 25 words. + + A "Transparent" copy of the Document means a machine-readable copy, + represented in a format whose specification is available to the + general public, that is suitable for revising the document + straightforwardly with generic text editors or (for images + composed of pixels) generic paint programs or (for drawings) some + widely available drawing editor, and that is suitable for input to + text formatters or for automatic translation to a variety of + formats suitable for input to text formatters. A copy made in an + otherwise Transparent file format whose markup, or absence of + markup, has been arranged to thwart or discourage subsequent + modification by readers is not Transparent. An image format is + not Transparent if used for any substantial amount of text. A + copy that is not "Transparent" is called "Opaque". + + Examples of suitable formats for Transparent copies include plain + ASCII without markup, Texinfo input format, LaTeX input format, + SGML or XML using a publicly available DTD, and + standard-conforming simple HTML, PostScript or PDF designed for + human modification. Examples of transparent image formats include + PNG, XCF and JPG. Opaque formats include proprietary formats that + can be read and edited only by proprietary word processors, SGML or + XML for which the DTD and/or processing tools are not generally + available, and the machine-generated HTML, PostScript or PDF + produced by some word processors for output purposes only. + + The "Title Page" means, for a printed book, the title page itself, + plus such following pages as are needed to hold, legibly, the + material this License requires to appear in the title page. For + works in formats which do not have any title page as such, "Title + Page" means the text near the most prominent appearance of the + work's title, preceding the beginning of the body of the text. + + A section "Entitled XYZ" means a named subunit of the Document + whose title either is precisely XYZ or contains XYZ in parentheses + following text that translates XYZ in another language. (Here XYZ + stands for a specific section name mentioned below, such as + "Acknowledgements", "Dedications", "Endorsements", or "History".) + To "Preserve the Title" of such a section when you modify the + Document means that it remains a section "Entitled XYZ" according + to this definition. + + The Document may include Warranty Disclaimers next to the notice + which states that this License applies to the Document. These + Warranty Disclaimers are considered to be included by reference in + this License, but only as regards disclaiming warranties: any other + implication that these Warranty Disclaimers may have is void and + has no effect on the meaning of this License. + + 2. VERBATIM COPYING + + You may copy and distribute the Document in any medium, either + commercially or noncommercially, provided that this License, the + copyright notices, and the license notice saying this License + applies to the Document are reproduced in all copies, and that you + add no other conditions whatsoever to those of this License. You + may not use technical measures to obstruct or control the reading + or further copying of the copies you make or distribute. However, + you may accept compensation in exchange for copies. If you + distribute a large enough number of copies you must also follow + the conditions in section 3. + + You may also lend copies, under the same conditions stated above, + and you may publicly display copies. + + 3. COPYING IN QUANTITY + + If you publish printed copies (or copies in media that commonly + have printed covers) of the Document, numbering more than 100, and + the Document's license notice requires Cover Texts, you must + enclose the copies in covers that carry, clearly and legibly, all + these Cover Texts: Front-Cover Texts on the front cover, and + Back-Cover Texts on the back cover. Both covers must also clearly + and legibly identify you as the publisher of these copies. The + front cover must present the full title with all words of the + title equally prominent and visible. You may add other material + on the covers in addition. Copying with changes limited to the + covers, as long as they preserve the title of the Document and + satisfy these conditions, can be treated as verbatim copying in + other respects. + + If the required texts for either cover are too voluminous to fit + legibly, you should put the first ones listed (as many as fit + reasonably) on the actual cover, and continue the rest onto + adjacent pages. + + If you publish or distribute Opaque copies of the Document + numbering more than 100, you must either include a + machine-readable Transparent copy along with each Opaque copy, or + state in or with each Opaque copy a computer-network location from + which the general network-using public has access to download + using public-standard network protocols a complete Transparent + copy of the Document, free of added material. If you use the + latter option, you must take reasonably prudent steps, when you + begin distribution of Opaque copies in quantity, to ensure that + this Transparent copy will remain thus accessible at the stated + location until at least one year after the last time you + distribute an Opaque copy (directly or through your agents or + retailers) of that edition to the public. + + It is requested, but not required, that you contact the authors of + the Document well before redistributing any large number of + copies, to give them a chance to provide you with an updated + version of the Document. + + 4. MODIFICATIONS + + You may copy and distribute a Modified Version of the Document + under the conditions of sections 2 and 3 above, provided that you + release the Modified Version under precisely this License, with + the Modified Version filling the role of the Document, thus + licensing distribution and modification of the Modified Version to + whoever possesses a copy of it. In addition, you must do these + things in the Modified Version: + + A. Use in the Title Page (and on the covers, if any) a title + distinct from that of the Document, and from those of + previous versions (which should, if there were any, be listed + in the History section of the Document). You may use the + same title as a previous version if the original publisher of + that version gives permission. + + B. List on the Title Page, as authors, one or more persons or + entities responsible for authorship of the modifications in + the Modified Version, together with at least five of the + principal authors of the Document (all of its principal + authors, if it has fewer than five), unless they release you + from this requirement. + + C. State on the Title page the name of the publisher of the + Modified Version, as the publisher. + + D. Preserve all the copyright notices of the Document. + + E. Add an appropriate copyright notice for your modifications + adjacent to the other copyright notices. + + F. Include, immediately after the copyright notices, a license + notice giving the public permission to use the Modified + Version under the terms of this License, in the form shown in + the Addendum below. + + G. Preserve in that license notice the full lists of Invariant + Sections and required Cover Texts given in the Document's + license notice. + + H. Include an unaltered copy of this License. + + I. Preserve the section Entitled "History", Preserve its Title, + and add to it an item stating at least the title, year, new + authors, and publisher of the Modified Version as given on + the Title Page. If there is no section Entitled "History" in + the Document, create one stating the title, year, authors, + and publisher of the Document as given on its Title Page, + then add an item describing the Modified Version as stated in + the previous sentence. + + J. Preserve the network location, if any, given in the Document + for public access to a Transparent copy of the Document, and + likewise the network locations given in the Document for + previous versions it was based on. These may be placed in + the "History" section. You may omit a network location for a + work that was published at least four years before the + Document itself, or if the original publisher of the version + it refers to gives permission. + + K. For any section Entitled "Acknowledgements" or "Dedications", + Preserve the Title of the section, and preserve in the + section all the substance and tone of each of the contributor + acknowledgements and/or dedications given therein. + + L. Preserve all the Invariant Sections of the Document, + unaltered in their text and in their titles. Section numbers + or the equivalent are not considered part of the section + titles. + + M. Delete any section Entitled "Endorsements". Such a section + may not be included in the Modified Version. + + N. Do not retitle any existing section to be Entitled + "Endorsements" or to conflict in title with any Invariant + Section. + + O. Preserve any Warranty Disclaimers. + + If the Modified Version includes new front-matter sections or + appendices that qualify as Secondary Sections and contain no + material copied from the Document, you may at your option + designate some or all of these sections as invariant. To do this, + add their titles to the list of Invariant Sections in the Modified + Version's license notice. These titles must be distinct from any + other section titles. + + You may add a section Entitled "Endorsements", provided it contains + nothing but endorsements of your Modified Version by various + parties--for example, statements of peer review or that the text + has been approved by an organization as the authoritative + definition of a standard. + + You may add a passage of up to five words as a Front-Cover Text, + and a passage of up to 25 words as a Back-Cover Text, to the end + of the list of Cover Texts in the Modified Version. Only one + passage of Front-Cover Text and one of Back-Cover Text may be + added by (or through arrangements made by) any one entity. If the + Document already includes a cover text for the same cover, + previously added by you or by arrangement made by the same entity + you are acting on behalf of, you may not add another; but you may + replace the old one, on explicit permission from the previous + publisher that added the old one. + + The author(s) and publisher(s) of the Document do not by this + License give permission to use their names for publicity for or to + assert or imply endorsement of any Modified Version. + + 5. COMBINING DOCUMENTS + + You may combine the Document with other documents released under + this License, under the terms defined in section 4 above for + modified versions, provided that you include in the combination + all of the Invariant Sections of all of the original documents, + unmodified, and list them all as Invariant Sections of your + combined work in its license notice, and that you preserve all + their Warranty Disclaimers. + + The combined work need only contain one copy of this License, and + multiple identical Invariant Sections may be replaced with a single + copy. If there are multiple Invariant Sections with the same name + but different contents, make the title of each such section unique + by adding at the end of it, in parentheses, the name of the + original author or publisher of that section if known, or else a + unique number. Make the same adjustment to the section titles in + the list of Invariant Sections in the license notice of the + combined work. + + In the combination, you must combine any sections Entitled + "History" in the various original documents, forming one section + Entitled "History"; likewise combine any sections Entitled + "Acknowledgements", and any sections Entitled "Dedications". You + must delete all sections Entitled "Endorsements." + + 6. COLLECTIONS OF DOCUMENTS + + You may make a collection consisting of the Document and other + documents released under this License, and replace the individual + copies of this License in the various documents with a single copy + that is included in the collection, provided that you follow the + rules of this License for verbatim copying of each of the + documents in all other respects. + + You may extract a single document from such a collection, and + distribute it individually under this License, provided you insert + a copy of this License into the extracted document, and follow + this License in all other respects regarding verbatim copying of + that document. + + 7. AGGREGATION WITH INDEPENDENT WORKS + + A compilation of the Document or its derivatives with other + separate and independent documents or works, in or on a volume of + a storage or distribution medium, is called an "aggregate" if the + copyright resulting from the compilation is not used to limit the + legal rights of the compilation's users beyond what the individual + works permit. When the Document is included an aggregate, this + License does not apply to the other works in the aggregate which + are not themselves derivative works of the Document. + + If the Cover Text requirement of section 3 is applicable to these + copies of the Document, then if the Document is less than one half + of the entire aggregate, the Document's Cover Texts may be placed + on covers that bracket the Document within the aggregate, or the + electronic equivalent of covers if the Document is in electronic + form. Otherwise they must appear on printed covers that bracket + the whole aggregate. + + 8. TRANSLATION + + Translation is considered a kind of modification, so you may + distribute translations of the Document under the terms of section + 4. Replacing Invariant Sections with translations requires special + permission from their copyright holders, but you may include + translations of some or all Invariant Sections in addition to the + original versions of these Invariant Sections. You may include a + translation of this License, and all the license notices in the + Document, and any Warranty Disclaimers, provided that you also + include the original English version of this License and the + original versions of those notices and disclaimers. In case of a + disagreement between the translation and the original version of + this License or a notice or disclaimer, the original version will + prevail. + + If a section in the Document is Entitled "Acknowledgements", + "Dedications", or "History", the requirement (section 4) to + Preserve its Title (section 1) will typically require changing the + actual title. + + 9. TERMINATION + + You may not copy, modify, sublicense, or distribute the Document + except as expressly provided for under this License. Any other + attempt to copy, modify, sublicense or distribute the Document is + void, and will automatically terminate your rights under this + License. However, parties who have received copies, or rights, + from you under this License will not have their licenses + terminated so long as such parties remain in full compliance. + + 10. FUTURE REVISIONS OF THIS LICENSE + + The Free Software Foundation may publish new, revised versions of + the GNU Free Documentation License from time to time. Such new + versions will be similar in spirit to the present version, but may + differ in detail to address new problems or concerns. See + `http://www.gnu.org/copyleft/'. + + Each version of the License is given a distinguishing version + number. If the Document specifies that a particular numbered + version of this License "or any later version" applies to it, you + have the option of following the terms and conditions either of + that specified version or of any later version that has been + published (not as a draft) by the Free Software Foundation. If + the Document does not specify a version number of this License, + you may choose any version ever published (not as a draft) by the + Free Software Foundation. + +ADDENDUM: How to use this License for your documents +==================================================== + +To use this License in a document you have written, include a copy of +the License in the document and put the following copyright and license +notices just after the title page: + + Copyright (C) YEAR YOUR NAME. + Permission is granted to copy, distribute and/or modify this document + under the terms of the GNU Free Documentation License, Version 1.2 + or any later version published by the Free Software Foundation; + with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts. + A copy of the license is included in the section entitled ``GNU + Free Documentation License''. + + If you have Invariant Sections, Front-Cover Texts and Back-Cover +Texts, replace the "with...Texts." line with this: + + with the Invariant Sections being LIST THEIR TITLES, with + the Front-Cover Texts being LIST, and with the Back-Cover Texts + being LIST. + + If you have Invariant Sections without Cover Texts, or some other +combination of the three, merge those two alternatives to suit the +situation. + + If your document contains nontrivial examples of program code, we +recommend releasing these examples in parallel under your choice of +free software license, such as the GNU General Public License, to +permit their use in free software. + + +File: gawkinet.info, Node: Index, Prev: GNU Free Documentation License, Up: Top + +Index +***** + + +* Menu: + +* /inet/ files (gawk): Gawk Special Files. (line 34) +* /inet/raw special files (gawk): File /inet/raw. (line 6) +* /inet/tcp special files (gawk): File /inet/tcp. (line 6) +* /inet/udp special files (gawk): File /inet/udp. (line 6) +* advanced features, network connections: Troubleshooting. (line 6) +* agent <1>: MOBAGWHO. (line 6) +* agent: Challenges. (line 76) +* AI: Challenges. (line 76) +* apache <1>: MOBAGWHO. (line 42) +* apache: WEBGRAB. (line 72) +* Bioinformatics: PROTBASE. (line 227) +* BLAST, Basic Local Alignment Search Tool: PROTBASE. (line 6) +* blocking: Making Connections. (line 35) +* Boutell, Thomas: STATIST. (line 6) +* CGI (Common Gateway Interface): MOBAGWHO. (line 42) +* CGI (Common Gateway Interface), dynamic web pages and: Web page. + (line 46) +* CGI (Common Gateway Interface), library: CGI Lib. (line 11) +* clients: Making Connections. (line 21) +* Clinton, Bill: Challenges. (line 59) +* Common Gateway Interface, See CGI: Web page. (line 46) +* Computational Biology: PROTBASE. (line 227) +* contest: Challenges. (line 6) +* cron utility: STOXPRED. (line 23) +* CSV format: STOXPRED. (line 128) +* dark corner, RAW protocol: File /inet/raw. (line 13) +* Dow Jones Industrial Index: STOXPRED. (line 44) +* ELIZA program: Simple Server. (line 11) +* email: Email. (line 11) +* FASTA/Pearson format: PROTBASE. (line 102) +* FDL (Free Documentation License): GNU Free Documentation License. + (line 6) +* filenames, for network access: Gawk Special Files. (line 29) +* files, /inet/ (gawk): Gawk Special Files. (line 34) +* files, /inet/raw (gawk): File /inet/raw. (line 6) +* files, /inet/tcp (gawk): File /inet/tcp. (line 6) +* files, /inet/udp (gawk): File /inet/udp. (line 6) +* finger utility: Setting Up. (line 22) +* Free Documentation License (FDL): GNU Free Documentation License. + (line 6) +* FTP (File Transfer Protocol): Basic Protocols. (line 29) +* gawk, networking: Using Networking. (line 6) +* gawk, networking, connections <1>: TCP Connecting. (line 6) +* gawk, networking, connections: Special File Fields. (line 49) +* gawk, networking, filenames: Gawk Special Files. (line 29) +* gawk, networking, See Also email: Email. (line 6) +* gawk, networking, service, establishing: Setting Up. (line 6) +* gawk, networking, troubleshooting: Caveats. (line 6) +* gawk, web and, See web service: Interacting Service. (line 6) +* getline command: TCP Connecting. (line 11) +* GETURL program: GETURL. (line 6) +* GIF image format <1>: STATIST. (line 6) +* GIF image format: Web page. (line 46) +* GNU Free Documentation License: GNU Free Documentation License. + (line 6) +* GNU/Linux <1>: REMCONF. (line 6) +* GNU/Linux <2>: Interacting. (line 27) +* GNU/Linux: Troubleshooting. (line 54) +* GNUPlot utility <1>: STATIST. (line 6) +* GNUPlot utility: Interacting Service. (line 189) +* Hoare, C.A.R. <1>: PROTBASE. (line 6) +* Hoare, C.A.R.: MOBAGWHO. (line 6) +* hostname field: Special File Fields. (line 29) +* HTML (Hypertext Markup Language): Web page. (line 30) +* HTTP (Hypertext Transfer Protocol) <1>: Web page. (line 6) +* HTTP (Hypertext Transfer Protocol): Basic Protocols. (line 29) +* HTTP (Hypertext Transfer Protocol), record separators and: Web page. + (line 30) +* HTTP server, core logic: Interacting Service. (line 6) +* Humphrys, Mark: Simple Server. (line 179) +* Hypertext Markup Language (HTML): Web page. (line 30) +* Hypertext Transfer Protocol, See HTTP: Web page. (line 6) +* image format: STATIST. (line 6) +* images, in web pages: Interacting Service. (line 189) +* images, retrieving over networks: Web page. (line 46) +* input/output, two-way, See Also gawk, networking: Gawk Special Files. + (line 19) +* Internet, See networks: Interacting. (line 48) +* JavaScript: STATIST. (line 56) +* Linux <1>: REMCONF. (line 6) +* Linux <2>: Interacting. (line 27) +* Linux: Troubleshooting. (line 54) +* Lisp: MOBAGWHO. (line 98) +* localport field: Gawk Special Files. (line 34) +* Loebner, Hugh: Challenges. (line 6) +* Loui, Ronald: Challenges. (line 76) +* MAZE: MAZE. (line 6) +* Microsoft Windows: WEBGRAB. (line 43) +* Microsoft Windows, networking: Troubleshooting. (line 54) +* Microsoft Windows, networking, ports: Setting Up. (line 37) +* MiniSQL: REMCONF. (line 111) +* MOBAGWHO program: MOBAGWHO. (line 6) +* NCBI, National Center for Biotechnology Information: PROTBASE. + (line 6) +* networks, gawk and: Using Networking. (line 6) +* networks, gawk and, connections <1>: TCP Connecting. (line 6) +* networks, gawk and, connections: Special File Fields. (line 49) +* networks, gawk and, filenames: Gawk Special Files. (line 29) +* networks, gawk and, See Also email: Email. (line 6) +* networks, gawk and, service, establishing: Setting Up. (line 6) +* networks, gawk and, troubleshooting: Caveats. (line 6) +* networks, ports, reserved: Setting Up. (line 37) +* networks, ports, specifying: Special File Fields. (line 18) +* networks, See Also web pages: PANIC. (line 6) +* Numerical Recipes: STATIST. (line 24) +* ORS variable, HTTP and: Web page. (line 30) +* ORS variable, POP and: Email. (line 36) +* PANIC program: PANIC. (line 6) +* Perl: Using Networking. (line 14) +* Perl, gawk networking and: Using Networking. (line 24) +* Perlis, Alan: MAZE. (line 6) +* pipes, networking and: TCP Connecting. (line 30) +* PNG image format <1>: STATIST. (line 6) +* PNG image format: Web page. (line 46) +* POP (Post Office Protocol): Email. (line 6) +* Post Office Protocol (POP): Email. (line 6) +* PostScript: STATIST. (line 138) +* PROLOG: Challenges. (line 76) +* PROTBASE: PROTBASE. (line 6) +* protocol field: Special File Fields. (line 11) +* PS image format: STATIST. (line 6) +* Python: Using Networking. (line 14) +* Python, gawk networking and: Using Networking. (line 24) +* RAW protocol: File /inet/raw. (line 6) +* record separators, HTTP and: Web page. (line 30) +* record separators, POP and: Email. (line 36) +* REMCONF program: REMCONF. (line 6) +* remoteport field: Gawk Special Files. (line 34) +* robot <1>: WEBGRAB. (line 6) +* robot: Challenges. (line 85) +* RS variable, HTTP and: Web page. (line 30) +* RS variable, POP and: Email. (line 36) +* servers <1>: Setting Up. (line 22) +* servers: Making Connections. (line 14) +* servers, as hosts: Special File Fields. (line 29) +* servers, HTTP: Interacting Service. (line 6) +* servers, web: Simple Server. (line 6) +* Simple Mail Transfer Protocol (SMTP): Email. (line 6) +* SMTP (Simple Mail Transfer Protocol) <1>: Email. (line 6) +* SMTP (Simple Mail Transfer Protocol): Basic Protocols. (line 29) +* SPAK utility: File /inet/raw. (line 21) +* STATIST program: STATIST. (line 6) +* STOXPRED program: STOXPRED. (line 6) +* synchronous communications: Making Connections. (line 35) +* Tcl/Tk: Using Networking. (line 14) +* Tcl/Tk, gawk and <1>: Some Applications and Techniques. + (line 22) +* Tcl/Tk, gawk and: Using Networking. (line 24) +* TCP (Transmission Control Protocol) <1>: File /inet/tcp. (line 6) +* TCP (Transmission Control Protocol): Using Networking. (line 29) +* TCP (Transmission Control Protocol), connection, establishing: TCP Connecting. + (line 6) +* TCP (Transmission Control Protocol), UDP and: Interacting. (line 48) +* TCP/IP, protocols, selecting: Special File Fields. (line 11) +* TCP/IP, sockets and: Gawk Special Files. (line 19) +* Transmission Control Protocol, See TCP: Using Networking. (line 29) +* troubleshooting, gawk, networks: Caveats. (line 6) +* troubleshooting, networks, connections: Troubleshooting. (line 6) +* troubleshooting, networks, timeouts: Caveats. (line 18) +* UDP (User Datagram Protocol): File /inet/udp. (line 6) +* UDP (User Datagram Protocol), TCP and: Interacting. (line 48) +* Unix, network ports and: Setting Up. (line 37) +* URLCHK program: URLCHK. (line 6) +* User Datagram Protocol, See UDP: File /inet/udp. (line 6) +* vertical bar (|), |& operator (I/O): TCP Connecting. (line 25) +* VRML: MAZE. (line 6) +* web browsers, See web service: Interacting Service. (line 6) +* web pages: Web page. (line 6) +* web pages, images in: Interacting Service. (line 189) +* web pages, retrieving: GETURL. (line 6) +* web servers: Simple Server. (line 6) +* web service <1>: PANIC. (line 6) +* web service: Primitive Service. (line 6) +* WEBGRAB program: WEBGRAB. (line 6) +* Weizenbaum, Joseph: Simple Server. (line 11) +* XBM image format: Interacting Service. (line 189) +* Yahoo! <1>: STOXPRED. (line 6) +* Yahoo!: REMCONF. (line 6) +* | (vertical bar), |& operator (I/O): TCP Connecting. (line 25) + + + +Tag Table: +Node: Top2007 +Node: Preface5697 +Node: Introduction7072 +Node: Stream Communications8098 +Node: Datagram Communications9271 +Node: The TCP/IP Protocols10902 +Ref: The TCP/IP Protocols-Footnote-111586 +Node: Basic Protocols11743 +Node: Ports13065 +Node: Making Connections14470 +Ref: Making Connections-Footnote-117051 +Ref: Making Connections-Footnote-217098 +Node: Using Networking17279 +Node: Gawk Special Files19633 +Node: Special File Fields21637 +Ref: table-inet-components25387 +Node: Comparing Protocols27299 +Node: File /inet/tcp27888 +Node: File /inet/udp28914 +Node: File /inet/raw30035 +Ref: File /inet/raw-Footnote-133068 +Node: TCP Connecting33148 +Node: Troubleshooting35486 +Ref: Troubleshooting-Footnote-138537 +Node: Interacting39081 +Node: Setting Up41811 +Node: Email45305 +Node: Web page47631 +Ref: Web page-Footnote-150436 +Node: Primitive Service50633 +Node: Interacting Service53367 +Ref: Interacting Service-Footnote-162496 +Node: CGI Lib62528 +Node: Simple Server69489 +Ref: Simple Server-Footnote-177219 +Node: Caveats77320 +Node: Challenges78463 +Node: Some Applications and Techniques87130 +Node: PANIC89587 +Node: GETURL91305 +Node: REMCONF93928 +Node: URLCHK99404 +Node: WEBGRAB103239 +Node: STATIST107689 +Ref: STATIST-Footnote-1119397 +Node: MAZE119842 +Node: MOBAGWHO126030 +Ref: MOBAGWHO-Footnote-1139974 +Node: STOXPRED140029 +Node: PROTBASE154284 +Node: Links167366 +Node: GNU Free Documentation License170800 +Node: Index193204 + +End Tag Table diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/missing_d/README b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/missing_d/README new file mode 100644 index 0000000..735889d --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/missing_d/README @@ -0,0 +1,14 @@ +Fri Aug 25 13:23:06 IDT 2006 +============================ + +The files memmove.c, mktime.c, snprintf.c, strerror.c, strftime.c, +strncasecmp.c, and system.c are copyright by the Free Software +Foundation. They are licensed under the GPL or the LGPL. See the +COPYING.LIB file in this directory and the COPYING file in the parent +directory for licensing information. + +All other files are public domain. + +Arnold Robbins +arnold@skeeve.com + diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/test/README b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/test/README new file mode 100644 index 0000000..2343be2 --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/test/README @@ -0,0 +1,18 @@ +Mon Jan 22 13:08:58 EST 1996 + +This directory contains the tests for gawk. The tests use the +following conventions. + +Given some aspect of gawk named `foo', there will be one or more +of the following files: + +foo.awk --- actual code for the test if not inline in the Makefile +foo.in --- the data for the test, if it needs data +foo.ok --- the expected results +_foo --- the actual results; generated at run time + +The _foo file will be left around if a test fails, allowing you to +compare actual and expected results, in case they differ. + +If they do differ (other than strftime.ok and _strftime!), send in a +bug report. See the manual for the bug report procedure. diff --git a/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/unsupported/atari/README.1st b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/unsupported/atari/README.1st new file mode 100644 index 0000000..a158cda --- /dev/null +++ b/coreutils-5.3.0-bin/contrib/gawk/3.1.6/gawk-3.1.6-src/unsupported/atari/README.1st @@ -0,0 +1,5 @@ +Tue Nov 7 14:19:41 2000 + +The atari port is no longer supported. If you have an atari, +you are welcome to try and use the port here, but we no longer have +the hardware to test gawk on. |